ID: 912695411

View in Genome Browser
Species Human (GRCh38)
Location 1:111838022-111838044
Sequence GAGGTCAACCTTGCTCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912695408_912695411 -3 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695411 1:111838022-111838044 GAGGTCAACCTTGCTCACCTGGG No data
912695407_912695411 14 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695411 1:111838022-111838044 GAGGTCAACCTTGCTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912695411 Original CRISPR GAGGTCAACCTTGCTCACCT GGG Intronic
No off target data available for this crispr