ID: 912695412

View in Genome Browser
Species Human (GRCh38)
Location 1:111838028-111838050
Sequence AACCTTGCTCACCTGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912695408_912695412 3 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695412 1:111838028-111838050 AACCTTGCTCACCTGGGCTGAGG 0: 1
1: 0
2: 1
3: 37
4: 378
912695407_912695412 20 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695412 1:111838028-111838050 AACCTTGCTCACCTGGGCTGAGG 0: 1
1: 0
2: 1
3: 37
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912695412 Original CRISPR AACCTTGCTCACCTGGGCTG AGG Intronic
901094188 1:6665147-6665169 AACCTTGAACTCCTGGGCTCGGG + Intronic
901127952 1:6942575-6942597 AACCTTGATCTCCTGGGCTCAGG - Intronic
901262122 1:7880174-7880196 AACCTTGACCTCCTGGGCTCAGG - Intergenic
902192678 1:14774550-14774572 AACCTTGACCTCCTGGGCTCAGG + Intronic
902296025 1:15467573-15467595 TACCCTGCTCACCTGGCCTCGGG + Intronic
902608870 1:17585486-17585508 ACCCCTGCTGACCTGGCCTGTGG + Intronic
902854290 1:19188885-19188907 AACCTTGAACTCCTGGGCTCTGG - Intronic
903097708 1:20994707-20994729 AACTTTGACCACCTGGGCTCAGG + Intronic
903344702 1:22676931-22676953 CACCTGGATCACCCGGGCTGGGG - Intergenic
903446778 1:23427384-23427406 AACCTTGAACTCCTGGGCTCAGG - Intergenic
903665927 1:25007534-25007556 AGCCTTGACCTCCTGGGCTGAGG + Intergenic
904260694 1:29285963-29285985 ACCCTTCCCCACCTGGGCTCTGG + Intronic
905029025 1:34869078-34869100 AACCTTGCTCGCCTGGGGAGAGG + Exonic
905124221 1:35706037-35706059 AACCTTGAACTCCTGGGCTCAGG - Intergenic
905754395 1:40496614-40496636 AACCTTGAACTCCTGGGCTCAGG - Intergenic
906751249 1:48263906-48263928 ATCCTTGCACTCCTGGGCTCAGG + Intergenic
907093353 1:51750869-51750891 AACATTTCTCAACTGGGCTGTGG - Intronic
907188713 1:52631896-52631918 AACATTCCTCCCCTGAGCTGTGG - Intergenic
910196259 1:84642538-84642560 AGCCTTGCTCTCCCGGGCTCAGG - Intergenic
912060710 1:105664873-105664895 AATCTTCCTCACCTGTACTGTGG - Intergenic
912695412 1:111838028-111838050 AACCTTGCTCACCTGGGCTGAGG + Intronic
914046135 1:144094406-144094428 AGCCTTGGCCTCCTGGGCTGAGG - Intergenic
914131975 1:144866281-144866303 AGCCTTGGCCTCCTGGGCTGAGG + Intergenic
914382361 1:147128662-147128684 AACCTAGGAGACCTGGGCTGTGG - Intergenic
914854827 1:151343299-151343321 GACTTTGCTGTCCTGGGCTGGGG - Intronic
915986437 1:160470174-160470196 AACCTTTCTCACCACAGCTGTGG + Intergenic
916256953 1:162798612-162798634 AACCTTGATCACCTGGCTTGAGG + Intronic
917816163 1:178712352-178712374 GGCCTTGCCCTCCTGGGCTGAGG - Intergenic
917816183 1:178712548-178712570 GGCCTTGCCCTCCTGGGCTGAGG - Intergenic
917953023 1:180061275-180061297 AACCTTGACCTCCTGGGCTCAGG + Intronic
918413091 1:184280974-184280996 AGCCTTGATCTCCTGGGCTCAGG - Intergenic
919413229 1:197273375-197273397 GACCTTACTCACCTGGGAGGTGG + Intronic
919469183 1:197957720-197957742 TAGCTTGATTACCTGGGCTGTGG + Intergenic
920790539 1:209085956-209085978 ATCCTTGATCTCCTGGGCTCAGG + Intergenic
923125805 1:231033484-231033506 ATCCTTGCCCACCTGGCCTCAGG + Intronic
924410780 1:243803064-243803086 AACCTTGAACTCCTGGGCTCAGG - Intronic
1063385317 10:5612862-5612884 AGCCTTGATCTCCTGGGCTCAGG - Intergenic
1063516481 10:6701154-6701176 GTCTTTGCTCACCTGGGCTTGGG + Intergenic
1063635836 10:7781689-7781711 AACCTTGACCTCCTGGGCTCAGG - Intronic
1064415661 10:15147009-15147031 AACCTTGACCTCCTGGGCTCAGG - Intronic
1064979584 10:21152491-21152513 AACCTTGAACTCCTGGGCTCAGG - Intronic
1065201107 10:23313953-23313975 AGCGTTGCTCACCTGGCCTGTGG - Intronic
1065451929 10:25868278-25868300 AACCTTGATCTCCTGGGCTCAGG - Intergenic
1065692521 10:28350066-28350088 AACCTTGATCTCCTGGGCTCAGG - Intergenic
1066362690 10:34746365-34746387 AACCTTGAACTCCTGGGCTTAGG - Intronic
1066723415 10:38364307-38364329 AACCTTGATCACCTGGCTTGAGG + Intergenic
1067343298 10:45421034-45421056 CACCTTGATCACCTGGCCTAGGG - Intronic
1068694043 10:59946789-59946811 AACCTTGACCTCCTGGGCTCAGG - Intergenic
1069699703 10:70413524-70413546 AACCTTGACCTCCTGGGCTCAGG - Intronic
1070082493 10:73202770-73202792 AGCCTTGATCTCCTGGGCTCAGG + Intronic
1070764452 10:79048477-79048499 CGCCCTGCTCATCTGGGCTGGGG + Intergenic
1070918249 10:80168613-80168635 AACCTCTGTCTCCTGGGCTGAGG + Intronic
1071230537 10:83580432-83580454 ACCCTTGCTCCCCTAGGCTAGGG - Intergenic
1072476553 10:95766959-95766981 AACCTTGAACTCCTGGGCTCAGG + Intronic
1072646883 10:97263029-97263051 AGCCTTGCTCTCCCGGGCTCAGG - Intronic
1072650533 10:97291621-97291643 AACCACGCTCATCTGGGCTCAGG + Intronic
1073273787 10:102290259-102290281 AACCTTGCTGAAATTGGCTGAGG + Intronic
1073348992 10:102805814-102805836 AGCCTTGATCTCCTGGGCTCAGG - Intronic
1073871317 10:107868079-107868101 AGCCTTCCTCAGCTGGGCTTTGG - Intergenic
1074133477 10:110606404-110606426 AACCTTGAACTCCTGGGCTCAGG + Intergenic
1074609302 10:115005785-115005807 AACCTTGCTCTCCCGGGCTCAGG + Intergenic
1077085974 11:751142-751164 AGCCTTGACCTCCTGGGCTGAGG + Intronic
1077155798 11:1090292-1090314 AGCCTGGCTGCCCTGGGCTGTGG - Intergenic
1078387502 11:10905321-10905343 GACCATGCTCACCTGGGCCCAGG + Intergenic
1079198837 11:18356664-18356686 AACCTTGAACTCCTGGGCTCAGG + Intronic
1079508186 11:21178680-21178702 AACCTTGATCTCTTGGGCTCAGG - Intronic
1080050656 11:27855829-27855851 AGCCTTTCTTACCTGGGCTGGGG - Intergenic
1080558412 11:33438562-33438584 ATCCTTGCTCTCCTTGGCCGGGG - Intergenic
1082014265 11:47472634-47472656 AACCTTGGCCTCCTGGGCTCAGG + Intronic
1082811572 11:57482125-57482147 GACCTGTCTCACCTTGGCTGTGG - Intergenic
1082875470 11:57983809-57983831 AACCTTTCCCACATGAGCTGGGG + Intergenic
1083837749 11:65283047-65283069 AACCTTGAACTCCTGGGCTTAGG - Intronic
1084018513 11:66402383-66402405 AGCCTTGATCTCCTGGGCTTAGG - Intergenic
1084257830 11:67955040-67955062 AGCCCTGCTCTGCTGGGCTGCGG - Intergenic
1084814934 11:71640197-71640219 AGCCCTGCTCTGCTGGGCTGCGG + Intergenic
1085158354 11:74317642-74317664 AGCCTTGATCTCCTGGGCTCTGG + Intergenic
1085589696 11:77748304-77748326 AACCTTGACCCCCTGGGCTCAGG + Intronic
1085713599 11:78852599-78852621 AACCTTGAACTCCTGGGCTCGGG - Intronic
1087094366 11:94305675-94305697 AGTCATGCCCACCTGGGCTGGGG + Exonic
1088608159 11:111551235-111551257 AACCATGCTGACGTGGGATGGGG + Intronic
1089209716 11:116791824-116791846 TGCCGTGCTCACCTGGGCTCTGG - Exonic
1089434794 11:118455777-118455799 AACCTTGACCTCCTGGGCTCTGG + Intronic
1089519499 11:119054482-119054504 CCCCTGGCTCACCTGGGCAGTGG + Exonic
1089757393 11:120696673-120696695 ATCCTCTCTCACCTGGCCTGTGG - Intronic
1091554887 12:1565291-1565313 AAACTGGCTGACCTGGGCTTTGG - Intronic
1091677790 12:2503927-2503949 AACCTTGGCCACCTGGACCGTGG - Intronic
1092428061 12:8389837-8389859 AGCCCTGCTCTGCTGGGCTGCGG - Intergenic
1092449130 12:8585495-8585517 AACCTTGATCTCCTAGGCTCAGG - Intergenic
1093431921 12:19094269-19094291 AACCTTGAGCTCCTGGGCTCAGG + Intergenic
1093632704 12:21429299-21429321 AGCCTTGCCCTCCTGGGCTAAGG + Intergenic
1094593089 12:31839553-31839575 AGCCTTGACCTCCTGGGCTGAGG + Intergenic
1095560200 12:43554939-43554961 AACCTTGAGCTCCTGGGCTCAGG - Intergenic
1096395067 12:51259793-51259815 AACCTTGAACTCCTGGGCTCAGG + Intronic
1096942419 12:55361643-55361665 AACCTTGAACTCCTGGGCTCAGG + Intergenic
1097674426 12:62583248-62583270 AGCCTTGTTCTCCTGGGCTCAGG - Intronic
1100313317 12:93418280-93418302 AACCTTGAACTCCTGGGCTCAGG - Intronic
1101943588 12:109119122-109119144 AACCTTGGTTTCCTGGCCTGTGG - Intronic
1102776380 12:115523170-115523192 GACCTTGACCACCTGGGCTCTGG - Intergenic
1103486043 12:121283266-121283288 AACCCTGCTTAGCTGGGCTAGGG - Intronic
1104279983 12:127367912-127367934 AACCCTGCACACCTCGGCTCAGG + Intergenic
1104479058 12:129091486-129091508 ACCTATGCTCACCTGGGCTCTGG + Intronic
1104479064 12:129091516-129091538 ACCTATGCTCACCTGGGCTCTGG + Intronic
1107256791 13:38436924-38436946 AACCTCCATCTCCTGGGCTGAGG - Intergenic
1107537036 13:41345662-41345684 AACCTTGACCTCCTGGGCTCAGG + Intronic
1108323761 13:49310168-49310190 TCCCCTGCTCACCTGGACTGCGG + Exonic
1112761403 13:102697250-102697272 AATCTGGCTCTCTTGGGCTGTGG + Intergenic
1114818791 14:25991539-25991561 AGCCTTGATCTCCTGAGCTGAGG + Intergenic
1117748530 14:58896879-58896901 GACCCTGCTCACCTGGGCCCTGG - Intergenic
1119226200 14:72946321-72946343 AGCCTTGATCTCCTGGGCTCAGG - Intronic
1119313849 14:73674621-73674643 AACCTTGACCTCCTGGGCTCAGG + Intronic
1119798157 14:77418214-77418236 AGCCTTGATCTCCTGGGCTCAGG + Intronic
1121782787 14:96632837-96632859 AACCTTGAACTCCTGGGCTCAGG + Intergenic
1122145181 14:99684526-99684548 AGCCCCGCTCACCTGGGCCGCGG - Exonic
1122400161 14:101462231-101462253 AAGCTTGCTGACCGTGGCTGGGG + Intergenic
1122700637 14:103586287-103586309 AACCTTGAACTCCTGGGCTCAGG + Intronic
1122865883 14:104603778-104603800 AACCTGGTTCACCTGGGGTGCGG - Intronic
1123067428 14:105625667-105625689 TGCCTTGCTGCCCTGGGCTGGGG + Intergenic
1123071445 14:105644391-105644413 TGCCTTGCTGCCCTGGGCTGGGG + Intergenic
1124197432 15:27644737-27644759 AGCCCTGCTTCCCTGGGCTGTGG + Intergenic
1124532578 15:30520407-30520429 AACCAGGCTCACCCAGGCTGGGG - Intergenic
1124766075 15:32487237-32487259 AACCAGGCTCACCCAGGCTGGGG + Intergenic
1125526793 15:40381475-40381497 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1125651128 15:41318774-41318796 AACCTTGAACTCCTGGGCTCAGG + Intronic
1125733931 15:41910437-41910459 AACCTTGATCACTGGGGCTTGGG + Intronic
1127402611 15:58604827-58604849 AGCCTTGCCCTCCTGGGCTGTGG + Intronic
1128082689 15:64865738-64865760 AACATTGCTCAGCCAGGCTGTGG + Exonic
1128497407 15:68206330-68206352 AACCACTCGCACCTGGGCTGGGG - Intronic
1128550360 15:68594430-68594452 AGGGCTGCTCACCTGGGCTGGGG - Intronic
1129028368 15:72600463-72600485 AACCTTGAGCTCCTGGGCTCAGG + Exonic
1129139699 15:73586235-73586257 AATTTGGCTCACCTAGGCTGGGG + Intronic
1130005967 15:80098185-80098207 ATCCTTACTCACCTAGTCTGTGG + Intronic
1130336751 15:82963164-82963186 AGCCTTGAACACCTGGGCTCAGG + Intronic
1132615130 16:837065-837087 CACCATGCTCAACTGGACTGTGG - Intergenic
1132625987 16:891737-891759 AGCTTTCCTGACCTGGGCTGAGG + Intronic
1132973354 16:2699739-2699761 TCCCTGGGTCACCTGGGCTGGGG + Intronic
1132976690 16:2714594-2714616 CAGCTTTCTCACCTGTGCTGTGG + Intronic
1133363818 16:5195385-5195407 AACCTTGACCTCCTGGGCTCAGG + Intergenic
1133370176 16:5240530-5240552 AGCCCTGCTCTGCTGGGCTGCGG + Intergenic
1133578836 16:7123444-7123466 AACCTTGACCTCCTGGGCTCAGG + Intronic
1134057230 16:11178231-11178253 CACCTAGCTCACCAGGGCCGCGG + Intronic
1134464349 16:14460956-14460978 AACCTTCATCACCTGGGTTGAGG - Intronic
1135333443 16:21581099-21581121 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1136091945 16:27927036-27927058 ACCCTTGCTCACCCAGACTGTGG + Intronic
1136398246 16:30004647-30004669 CTCTTAGCTCACCTGGGCTGCGG - Intronic
1136558447 16:31023542-31023564 AACCTTGATCTCCTGGGCTTAGG - Intergenic
1138374436 16:56553145-56553167 AGCCTTGACCTCCTGGGCTGAGG + Intergenic
1138398628 16:56727945-56727967 AGCCTTGACCACCTGGGCTCAGG + Intronic
1138708597 16:58943317-58943339 AACCTTGACCTCCTGGGCTAAGG + Intergenic
1138717253 16:59037623-59037645 AACATTACACACCGGGGCTGGGG - Intergenic
1138793356 16:59936324-59936346 GACCTTGATCACTTTGGCTGAGG + Intergenic
1139691866 16:68646318-68646340 GCCCTGGCACACCTGGGCTGGGG + Intronic
1140335798 16:74103838-74103860 AACCTTGTTCTCCTGGGCTCAGG - Intergenic
1141223189 16:82090746-82090768 AACATTGCTCACCTGGGCTCAGG + Intronic
1142277922 16:89132670-89132692 CACCTTGCCCACAGGGGCTGGGG - Intronic
1142341375 16:89525039-89525061 AGCCTTGATCTCCTGGGCTCAGG + Intronic
1142375953 16:89707252-89707274 CCCCTTACTCACCTTGGCTGTGG - Exonic
1144087385 17:11823024-11823046 GACATTGCTCACCTGGGCAGAGG - Exonic
1144607348 17:16678660-16678682 AGCCTTGACCTCCTGGGCTGTGG + Intergenic
1145805773 17:27728317-27728339 AACCTTCCTCTCCTGGGTTCAGG - Intergenic
1146318939 17:31831428-31831450 AGCCTTGCTCAGCTGGCTTGAGG - Intergenic
1147534254 17:41308482-41308504 AACTTGGCTCACAAGGGCTGGGG + Exonic
1148028351 17:44603709-44603731 AGCCTTGCTCTTCTGGGCTGTGG + Intergenic
1148194179 17:45701441-45701463 AACTTGGCTCTCCTTGGCTGAGG - Intergenic
1148435129 17:47678170-47678192 TACCTTGTCCACCTGGGCTTGGG - Exonic
1149185728 17:53995150-53995172 AACTTTGATCACCTGGTTTGAGG - Intergenic
1149510852 17:57240173-57240195 AGCCTTGACCACCTGGGCTCAGG - Intergenic
1149916856 17:60617458-60617480 AACCTTGACCTCCTGGGCTCAGG - Intronic
1150136480 17:62698109-62698131 CACCTGGGTCTCCTGGGCTGTGG + Intergenic
1150149481 17:62797589-62797611 CACCTTGCTCCCCTGGGCAAAGG - Intronic
1150328677 17:64277022-64277044 AACCTCGGTCTCCTGGGCTCAGG - Intergenic
1150352284 17:64454917-64454939 AGCCTTGAACTCCTGGGCTGAGG - Intronic
1150880114 17:69014955-69014977 TACATGGGTCACCTGGGCTGTGG + Intronic
1151471369 17:74320100-74320122 AACCTTAGTTTCCTGGGCTGAGG + Intergenic
1151474089 17:74335715-74335737 AACTTTGCTCACATGGGAGGCGG - Intronic
1151779137 17:76231018-76231040 AGCCTTGACCTCCTGGGCTGAGG + Intronic
1152867724 17:82734453-82734475 CCACTTGCTCAGCTGGGCTGGGG - Intergenic
1155197255 18:23486657-23486679 AACCTTTGTCTCCTGGGCTCAGG - Intergenic
1155347594 18:24874160-24874182 GACCTTGCACAGCTGGGCTCAGG + Intergenic
1156325896 18:36075015-36075037 AGCCTTGATCTCCTGGGCTCAGG + Intergenic
1156549449 18:38000013-38000035 AACCTTGCCCTCCTGGGCTCAGG - Intergenic
1158003154 18:52642743-52642765 AACCTTAATCTCCTGGGTTGAGG + Intronic
1158227135 18:55213182-55213204 AACCTTGCCCACCTTGCCTTTGG + Intergenic
1159056531 18:63471058-63471080 AACCCGGCTCACCTGGGGTGTGG + Intergenic
1159560775 18:69991132-69991154 AACCTTGGCCTCCTGGGCTCAGG - Intergenic
1160934409 19:1586588-1586610 AACCTTGAACTCCTGGGCTAGGG + Intronic
1160951413 19:1669342-1669364 GGCCTTCCTCACCTGGCCTGGGG + Intergenic
1162527025 19:11212031-11212053 AACCATCCTCACCTATGCTGAGG - Exonic
1162865965 19:13547174-13547196 AACCTTGGCCTCCTGGGCTCAGG - Intronic
1163011937 19:14432088-14432110 AACCTTGGTCTCCGGGGCTCCGG - Intergenic
1163398884 19:17079781-17079803 AGCCTGGCACAGCTGGGCTGGGG - Intronic
1163795171 19:19333838-19333860 CACCTTGCTCACCCAGGCTGGGG + Intronic
1164988656 19:32668552-32668574 AGCCTTGACCTCCTGGGCTGAGG + Intronic
1166149251 19:40859772-40859794 AGCCTTGATCTCCTGGGCTCAGG + Intronic
1166158190 19:40931534-40931556 AACCTTGAACTCCTGGGCTCAGG + Intergenic
1168031881 19:53686707-53686729 AACCTAGCTCTCTTGGGCTCAGG + Intergenic
1168258250 19:55178951-55178973 GGTCTTGCTCACCTGGGCCGTGG + Exonic
1202685688 1_KI270712v1_random:47819-47841 AGCCTTGGCCTCCTGGGCTGAGG - Intergenic
927803083 2:26119327-26119349 AGCCTTGATCTCCTGGGCTCAGG - Intronic
927977954 2:27354199-27354221 AACCTTGAACTCCTGGGCTCAGG - Intronic
928961141 2:36927425-36927447 AGCCTTGGCCTCCTGGGCTGAGG - Intronic
929463283 2:42122051-42122073 AACCTTGCATTCCTGGGCTATGG + Intergenic
931590698 2:63880253-63880275 AGCCTTGACCACCTGGGCTCAGG + Intronic
932244273 2:70183354-70183376 AGCCTTGCTCTCCTGGACTCAGG - Intronic
933043813 2:77507839-77507861 AACCATGCTCACCTTGTCTTCGG - Intronic
934058106 2:88269584-88269606 AAGCTTTCTCACCAGGGGTGGGG + Intergenic
934246033 2:90307014-90307036 AGCCTTGGCCTCCTGGGCTGAGG + Intergenic
934262712 2:91490019-91490041 AGCCTTGGCCTCCTGGGCTGAGG - Intergenic
934991384 2:98924323-98924345 CACCTTGGTCTCCTGGGCTGGGG + Intronic
935942703 2:108257985-108258007 ACACTTGCTCACTTGGTCTGTGG + Intronic
937318279 2:120945832-120945854 TACATTGATCACCTGGGCTCAGG + Intronic
938262333 2:129904912-129904934 CACCTGGCTCTCCTGGGCTGCGG - Intergenic
940166362 2:150777958-150777980 AGCCTTGACCCCCTGGGCTGAGG + Intergenic
941233277 2:162938518-162938540 ACACATGCTCACCTGGGCTTTGG + Intergenic
941381384 2:164796891-164796913 AACCTTGAACTCCTGGGCTCAGG - Intronic
941922093 2:170861528-170861550 AGCCTTGATCTCCTGGGCTCAGG - Intergenic
941990005 2:171546569-171546591 TACCTTGCTAGGCTGGGCTGTGG + Intronic
942181213 2:173382984-173383006 AACCTTGAACTCCTGGGCTCAGG - Intergenic
942330177 2:174815294-174815316 AGCCTTGACCACCTGGGCTCAGG - Intronic
942839275 2:180340140-180340162 AGCCATGCTCACCTTGGCTGTGG - Intergenic
943463829 2:188203791-188203813 ATCCTTGGTCAGCTGTGCTGTGG - Intergenic
943889351 2:193266836-193266858 AAGCTTTGTCACCAGGGCTGGGG + Intergenic
944074167 2:195709104-195709126 AACCTTGACCTCCTGGGCTCAGG + Intronic
944115310 2:196179470-196179492 AACCTTGATCATCTGGCTTGAGG - Intergenic
944816426 2:203381356-203381378 AACCTTGTACTCCTGGGCTCAGG + Intronic
944839402 2:203610732-203610754 CACCATGCACAACTGGGCTGTGG - Intergenic
945277785 2:208005619-208005641 AACCTTGATCACCTGGCTTGAGG + Intronic
946002569 2:216495062-216495084 GACCTTCATCACCTTGGCTGAGG + Intergenic
946002846 2:216497583-216497605 CAACTTGCATACCTGGGCTGAGG - Intergenic
946113098 2:217437437-217437459 CCCCTTGCTGACCTGGGCAGCGG + Intronic
946377571 2:219322080-219322102 AACCTTGAACTCCTGGGCTCAGG + Intergenic
946721605 2:222614755-222614777 AACCTTGAACTCCTGGGCTCAGG - Intronic
947771150 2:232671355-232671377 AACCTTGACCTCCTGGGCTCAGG - Intronic
948088769 2:235273065-235273087 AACCTTGATCACTTGGCTTGAGG - Intergenic
948126732 2:235569552-235569574 GACCATGCTCACATGGGCAGAGG - Intronic
948306570 2:236952609-236952631 AACCATCCCCACCTGGTCTGCGG + Intergenic
948439601 2:237978298-237978320 TGCCTTGCTCACCTGTGATGTGG + Intronic
1169164775 20:3413480-3413502 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1169265502 20:4164957-4164979 AGCCTTACACACCTGGGCTCAGG + Intronic
1169478972 20:5960360-5960382 AACCTTGAACTCCTGGGCTCAGG + Intronic
1170061357 20:12262938-12262960 AGCCTTGACCTCCTGGGCTGAGG - Intergenic
1170251593 20:14289621-14289643 AGCCTTGTTCTCCTGGGCTAAGG + Intronic
1170736606 20:19018437-19018459 AATCCTGCTCACCTTTGCTGGGG + Intergenic
1170834615 20:19873204-19873226 AGCCTTGATCTCCTGGGCTCAGG + Intergenic
1172371684 20:34398142-34398164 AACCTTGATCTCCTGGGGTCAGG + Intronic
1172564220 20:35916053-35916075 AGCCTTGACCTCCTGGGCTGAGG - Intronic
1173409435 20:42796776-42796798 GTCCTTGCTCACCAGGGCTTGGG - Intronic
1174008691 20:47431348-47431370 AACCTTGAACTCCTGGGCTCAGG + Intergenic
1175830758 20:61964514-61964536 AACCTTGAACTCCTGGGCTCAGG + Intronic
1175913824 20:62416542-62416564 AGCCTCCCTCCCCTGGGCTGGGG - Intronic
1175991161 20:62790010-62790032 AAGTTGGCTCACATGGGCTGGGG - Intergenic
1176098101 20:63353422-63353444 ATCCCTGCTCTCCTGAGCTGTGG + Intronic
1176303245 21:5109231-5109253 AATCTTGATCACCTGGGCTCAGG + Intergenic
1177356329 21:20012665-20012687 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1178572120 21:33748365-33748387 AACCTTGAACTCCTGGGCTCAGG - Intronic
1179584228 21:42364860-42364882 AACCTTGCCCTCCTGGGGTCTGG + Intronic
1179842659 21:44087366-44087388 GACCCTGCTCCCCTGGGGTGGGG + Intronic
1179853783 21:44152705-44152727 AATCTTGATCACCTGGGCTCAGG - Intergenic
1179941377 21:44640680-44640702 ATCCTTACTGACCTGGTCTGTGG - Intronic
1180028729 21:45186014-45186036 CACAGTGGTCACCTGGGCTGTGG - Intronic
1180030735 21:45205177-45205199 AACCTTGACCTCCTGGGCTCAGG - Intronic
1180079849 21:45481705-45481727 ATGCTTGCACACCAGGGCTGGGG - Intronic
1181033244 22:20158132-20158154 CCCCTTTCTGACCTGGGCTGGGG + Intergenic
1181510061 22:23385100-23385122 CCCCTTTCTGACCTGGGCTGGGG - Intergenic
1181882491 22:25992112-25992134 GAGCTTGCTCACCTGTGCAGGGG - Intronic
1183674650 22:39292534-39292556 AACCCTACACCCCTGGGCTGCGG + Intergenic
1184758712 22:46532933-46532955 CACCTCGCTCACCTGCTCTGGGG - Intronic
1185329666 22:50246542-50246564 AGCCTTCCTCAGCTGGGGTGTGG - Intronic
949892052 3:8740638-8740660 GACCTAGGACACCTGGGCTGGGG - Intronic
950628051 3:14262856-14262878 AGCCTTGCCCTCCTGGGCTCAGG + Intergenic
950689578 3:14645197-14645219 AACCTTGGTCACCTGGCTCGAGG - Intergenic
952321842 3:32284997-32285019 TACCTTGATCACCTTCGCTGGGG - Intronic
952370266 3:32715885-32715907 AGCCTTGATCTCCTGGGCTCAGG + Intronic
953262530 3:41353584-41353606 AACCTTGAACTCCTGGGCTCAGG - Intronic
953362758 3:42313050-42313072 AACCTTGACCTCCTGGGCTCAGG - Intergenic
953414027 3:42705383-42705405 AACCTTGCCCAGCTCAGCTGTGG + Intronic
953651592 3:44810331-44810353 AACCTAGAACACCTGGGCTCTGG + Intronic
953688242 3:45094914-45094936 ACCCTTGCTCACCTGCACTGTGG + Intronic
954015773 3:47689128-47689150 AACCTTGACCTCCTGGGCTCAGG - Intronic
954020769 3:47739400-47739422 AACCTTGAACTCCTGGGCTCAGG + Intronic
954584459 3:51721262-51721284 CACCCTCCTCTCCTGGGCTGGGG + Intergenic
955271511 3:57504490-57504512 AACCTTGAACTCCTGGGCTCAGG + Intronic
956254930 3:67273434-67273456 ATCCTTGACCACCTGGGCTCAGG + Intergenic
956412590 3:68994260-68994282 AGCCTTGCTCTCCTGGGCTCAGG - Intronic
957072757 3:75579528-75579550 AGCCCTGCTCTGCTGGGCTGCGG - Intergenic
957717333 3:83945749-83945771 ATTCTTCCTCACCTAGGCTGTGG + Intergenic
959885770 3:111497737-111497759 AACCTTCCCCAGCTGGGCTTAGG + Intronic
961281312 3:125767223-125767245 AGCCCTGCTCTGCTGGGCTGCGG + Intergenic
961452968 3:127010722-127010744 AAGCTGGCTCACCTGGCGTGAGG - Intronic
961717568 3:128869152-128869174 ATCCTTGATCTCCTGGGCTCAGG + Intergenic
961857649 3:129888799-129888821 AACCCTGCTCATCTGGCTTGAGG - Intronic
961873058 3:130002356-130002378 AGCCCTGCTCTGCTGGGCTGCGG - Intergenic
962970691 3:140399034-140399056 CACCAGGCTCACATGGGCTGTGG - Intronic
965056219 3:163720436-163720458 AACCTTGATAACCTGGGATATGG + Intergenic
966413107 3:179663540-179663562 ATCCTTTCTCACCTGGACTGTGG + Intronic
966896780 3:184450976-184450998 AACCATGTTCACCTCGCCTGTGG + Intronic
968745394 4:2357283-2357305 CAGCTTGCTCACCTGGGCCCGGG + Intronic
969016364 4:4106838-4106860 AGCCCTGCTCTGCTGGGCTGCGG - Intergenic
969048922 4:4358790-4358812 ACCGTGGCTCATCTGGGCTGAGG - Intronic
969483486 4:7459063-7459085 GATATTGCTCCCCTGGGCTGGGG + Intronic
969537905 4:7767992-7768014 AGCCTTGATCTCCTGGGCTCAGG - Intronic
969737590 4:9001486-9001508 AGCCCTGCTCTGCTGGGCTGCGG + Intergenic
969796788 4:9533047-9533069 AGCCCTGCTCTGCTGGGCTGCGG + Intergenic
970510735 4:16779214-16779236 AACATTGCTCATCTGAGCAGCGG - Intronic
971282530 4:25252692-25252714 AACCTTGACCACCTGGGCTCAGG + Intronic
973561008 4:52135354-52135376 AACCTTGGCCAACTGGGATGTGG + Intergenic
973963649 4:56137769-56137791 AACCTTGAACTCCTGGGCTCAGG - Intergenic
974071234 4:57126220-57126242 AGCCTTGAACTCCTGGGCTGAGG + Intergenic
975130367 4:70826764-70826786 AACCTTGAACTCCTGGGCTCAGG - Intronic
975256796 4:72246309-72246331 AACCTTGCCCTCCCGGGCTCAGG - Intergenic
975548932 4:75590083-75590105 AGCCTTGATCCCCTGGGCTTAGG - Intronic
975577962 4:75881486-75881508 AGCCTTGACCTCCTGGGCTGAGG - Intronic
976651120 4:87436073-87436095 AACCTTGAACTCCTGGGCTCAGG + Intronic
977991160 4:103444192-103444214 AACCTCCCTCTCCTGGGCTCAGG + Intergenic
978593511 4:110351964-110351986 AGCCTTGACCTCCTGGGCTGAGG - Intergenic
979613649 4:122717609-122717631 AACCTCGACCACCTGGGCTCAGG + Intergenic
980637786 4:135531308-135531330 AACCTTGATAAGCTGGACTGAGG - Intergenic
981072727 4:140561432-140561454 AACCTTGAACTCCTGGGCTCAGG + Intronic
981593924 4:146397454-146397476 AACCTTTCTCATTTGTGCTGTGG + Intronic
981996682 4:150982996-150983018 AACCTTGACCTCCTGGGCTCAGG - Intronic
982042765 4:151411429-151411451 AGCCTTGATCTCCTGGGCTCAGG + Intronic
984742134 4:183175341-183175363 AGCCTTGATCTCCTGGGCTCAGG + Intronic
985182723 4:187282284-187282306 AACCTTGGCCTCCTGGGCTCAGG - Intergenic
985642280 5:1069304-1069326 AACCCTGCTCAAGAGGGCTGTGG - Intronic
985869756 5:2545016-2545038 AGCCTTGATCTCCTGGGCTCAGG - Intergenic
986735223 5:10663105-10663127 AACCCTGCCCGCCTTGGCTGTGG + Intergenic
990905705 5:60801007-60801029 AGCCTTGATCTCCTGGGCTAAGG + Intronic
991003201 5:61803508-61803530 AACCTTGTTCTCCTTGGCTCGGG + Intergenic
991130176 5:63113325-63113347 AACCTTGCTCAGTTCTGCTGGGG + Intergenic
992385420 5:76279910-76279932 CACCCTGCTCACATGGGCGGTGG - Intronic
996547487 5:124695684-124695706 AGCCTTGATCTCCTGGGCTCAGG - Intronic
998355260 5:141530000-141530022 AACCTTGACCTCCTGGGCTCAGG - Intronic
999232549 5:150070143-150070165 CACCTCCCTCACCTGGGCTCAGG - Intronic
1002705206 5:181156186-181156208 AGCCTTGATCTCCTGGGCTCAGG + Intergenic
1003158835 6:3618483-3618505 AACCTTGAACACCTGGGCTCAGG + Intergenic
1003176145 6:3752900-3752922 AAATTTCCTCACCTGGTCTGGGG + Intergenic
1004316790 6:14595613-14595635 AACATTCCTCACCTAGGCTGAGG - Intergenic
1004392770 6:15223224-15223246 CACCGTGCCCAGCTGGGCTGGGG + Intergenic
1004719309 6:18252425-18252447 AACCTTGACCTCCTGGGCTCAGG - Intronic
1005523978 6:26627377-26627399 AGCCTTGATCTCCTGGGCTCAGG + Intergenic
1006481240 6:34296185-34296207 AACCTTGAACTCCTGGGCTCAGG - Intronic
1006504150 6:34477041-34477063 ACCATTGCTCATTTGGGCTGTGG + Intronic
1006576623 6:35051110-35051132 AACCTTGAACTCCTGGGCTCAGG - Intronic
1007791137 6:44309182-44309204 AACCTTGCTGAGCTGTGATGTGG + Intronic
1009578708 6:65502915-65502937 AACCTTGATCACCTGTCTTGAGG + Intronic
1009989877 6:70828962-70828984 AGCCTTGATCTCCTGGGCTCAGG - Intronic
1010156287 6:72797421-72797443 AACCTTGACCTCCTGGGCTCAGG - Intronic
1010742284 6:79522766-79522788 AACCTTGAACTCCTGGGCTCAGG + Intronic
1011519826 6:88193390-88193412 CACCCTGCCCACCTGGGCTGGGG + Intergenic
1013126096 6:107186085-107186107 AAACTCACTCACCTGGGCAGTGG - Intronic
1013371542 6:109474959-109474981 AGCCTTGACCTCCTGGGCTGAGG - Intronic
1017167193 6:151419590-151419612 AGCCTTGATCTCCTGGGCTCAGG - Intronic
1017789682 6:157786122-157786144 AGCCTTGATCTCCTGGGCTCAGG + Intronic
1018946962 6:168354511-168354533 AGCCTCCCTCCCCTGGGCTGCGG + Intergenic
1019094276 6:169566307-169566329 AGCCCTGCTCACCTGGGCAGTGG + Intronic
1021206427 7:17786656-17786678 GACCTTGAGCACCAGGGCTGCGG - Intergenic
1021218941 7:17951846-17951868 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1021629495 7:22630313-22630335 CACCCTGCGCACTTGGGCTGGGG - Intronic
1022451350 7:30518377-30518399 AGCCTCGATCACCTGGGCTCTGG - Intronic
1024007877 7:45240973-45240995 AGCCTTGCTCACCTGGATGGTGG - Intergenic
1024180118 7:46883907-46883929 AGCCTTGAACACCTGGGCTCAGG + Intergenic
1024222698 7:47300848-47300870 AACACTGCTCACCATGGCTGAGG - Intronic
1025184648 7:56848135-56848157 AGCCTTGACCACCTGGGCTCAGG + Intergenic
1025687282 7:63728827-63728849 AGCCTTGACCACCTGGGCTCAGG - Intergenic
1026015272 7:66666978-66667000 ACCCTGGCTCAACTGGTCTGGGG - Intronic
1026378594 7:69776495-69776517 AACCTTGAACTCCTGGGCTCCGG + Intronic
1026891676 7:73986130-73986152 ACCCTGGCTCAGCTGGTCTGGGG - Intergenic
1029305627 7:99617497-99617519 AACCTTGAACTCCTGGGCTCAGG - Intronic
1029677050 7:102076950-102076972 AGCCTTGATCTCCTGGGCTCAGG - Intronic
1029897124 7:103994779-103994801 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1030350632 7:108481752-108481774 AAACTTGGTGACCTGGGTTGGGG - Intronic
1030438204 7:109552238-109552260 GTCCTAGCTGACCTGGGCTGAGG + Intergenic
1031065897 7:117105361-117105383 AACCTTGACCTCCTGGGCTCAGG + Intronic
1031900583 7:127405735-127405757 AATCTTGAACACCTGGGCTCAGG - Intronic
1032107674 7:129048144-129048166 AGCCTTGCTCACCTGAGCCTGGG - Intronic
1034325583 7:150228657-150228679 AACCTTGCTGACCCTGGCTTTGG + Intergenic
1034767617 7:153740603-153740625 AACCTTGCTGACCCTGGCTTTGG - Intergenic
1034834215 7:154336865-154336887 AGCCTTGCACACCTGAACTGAGG + Intronic
1035023525 7:155812291-155812313 AACCTTGCCCGCCGCGGCTGCGG + Intergenic
1035333403 7:158111018-158111040 CACCCTGCTCTCCTGGCCTGGGG + Intronic
1036242684 8:7092748-7092770 AGCCCTGCTCTGCTGGGCTGCGG + Intergenic
1036491101 8:9226216-9226238 AACCTTGACCACCTGGGCTCAGG - Intergenic
1036639052 8:10570787-10570809 AAACCTTCTTACCTGGGCTGGGG - Intergenic
1036899130 8:12658691-12658713 AGCCCTGCTCTGCTGGGCTGCGG - Intergenic
1037361872 8:18083151-18083173 AACCTGGCGCATCTGGCCTGAGG - Intronic
1038507381 8:28096340-28096362 CACCCTGCTCCCCTGGTCTGTGG + Intronic
1038543725 8:28410105-28410127 AGCCTTGACCACCTGGGCTCAGG - Intronic
1042581694 8:70286297-70286319 AACCTTGAACTCCTGGGCAGAGG - Intronic
1045029990 8:98125925-98125947 AACCTTGACCTCCTGGGCTCAGG + Intronic
1045286718 8:100798029-100798051 AACCTTGACCTCCTGGGCTCAGG + Intergenic
1047327866 8:123857426-123857448 AACCTTGAACTCCTGGGCTCTGG - Intronic
1047764555 8:127979959-127979981 AGCCTTGATCTCCTGGGCTCAGG + Intergenic
1047950050 8:129925040-129925062 CACCTTGCTAACCTTGGGTGGGG + Intronic
1048242845 8:132761415-132761437 CACCTTGCACATCTGTGCTGAGG - Intergenic
1053378260 9:37626705-37626727 AACCTCTATCACCTGGGCTCAGG - Intronic
1053422433 9:37987950-37987972 GGCCCTGGTCACCTGGGCTGAGG + Intronic
1054916996 9:70503887-70503909 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1055801193 9:80038437-80038459 AGCCTTGATCTCCTGGGCTCAGG + Intergenic
1056496746 9:87163250-87163272 AGCCTTGATCTCCTGGGCTCAGG - Intergenic
1056784228 9:89577949-89577971 AATCTTGGTCACCTGGGGTTAGG - Intergenic
1058859922 9:109106141-109106163 AACCTTGAACTCCTGGGCTCAGG - Intronic
1059101084 9:111472164-111472186 CACCTTGATCTCCTGGGCTCAGG - Intronic
1059169141 9:112108694-112108716 AACCTTGACCTCCTGGGCTCAGG - Intronic
1059316981 9:113434219-113434241 AACCTCGACCTCCTGGGCTGAGG + Intergenic
1060299557 9:122367088-122367110 AGCCTTGATCTCCTGGGCTCAGG - Intergenic
1061333674 9:129914252-129914274 AACCTTGAGCTCCTGGGCTCAGG + Intronic
1062394113 9:136345837-136345859 TACCTTGCTCATCTGGGTGGGGG + Intronic
1062591294 9:137275980-137276002 AACCTTGCTGGCAAGGGCTGGGG + Intergenic
1190393215 X:49953385-49953407 AATCTTGACCACCTGGGCTCAGG + Intronic
1190952912 X:55163238-55163260 AAGCTAGCACACATGGGCTGAGG + Intronic
1192797842 X:74439389-74439411 AGCCTTGATCACCTGGGCTCAGG + Intronic
1195042233 X:101024913-101024935 AGCCTTGACCACCTGGGCTCAGG - Intronic
1196651362 X:118171624-118171646 AACCTTGAACTCCTGGGCTCAGG - Intergenic
1196744531 X:119058193-119058215 AACCTTGAACTCCTGGGCTCAGG + Intergenic
1197016740 X:121634141-121634163 AACCTTGATCACATGGCTTGAGG - Intergenic
1197494300 X:127158635-127158657 AACATTGCTGACCTGGGGAGAGG + Intergenic
1201365056 Y:13195765-13195787 AACCTTGACTTCCTGGGCTGAGG + Intergenic
1201667844 Y:16479006-16479028 GACCTTGATCACCTGGTCTGAGG - Intergenic