ID: 912698879

View in Genome Browser
Species Human (GRCh38)
Location 1:111861530-111861552
Sequence CAAGGTCCTGCAGTGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 276}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698879_912698893 14 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698879_912698892 13 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698879_912698883 -8 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698883 1:111861545-111861567 GGACCTTGTTCCTGTGTTTACGG No data
912698879_912698890 6 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698890 1:111861559-111861581 TGTTTACGGAGGGAAGCGGGTGG No data
912698879_912698896 24 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698879_912698897 30 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698879_912698891 10 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698891 1:111861563-111861585 TACGGAGGGAAGCGGGTGGCAGG No data
912698879_912698895 16 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698879_912698885 -5 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698885 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
912698879_912698889 3 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698879_912698894 15 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698879_912698886 -4 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698886 1:111861549-111861571 CTTGTTCCTGTGTTTACGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 106
912698879_912698888 2 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698879 Original CRISPR CAAGGTCCTGCAGTGGGCCT GGG (reversed) Intronic
900991540 1:6100451-6100473 CAGGGTCCTGCAGTGGCCAATGG + Exonic
901158969 1:7160498-7160520 CATGGTACTCCAGAGGGCCTAGG - Intronic
904317502 1:29675202-29675224 CAGGGTCCTGCACATGGCCTGGG + Intergenic
904876433 1:33658106-33658128 CAACGTCCTGCAATGACCCTGGG - Exonic
905339723 1:37270247-37270269 ACAGTTCCTGCAGTGGGTCTGGG - Intergenic
905868695 1:41390895-41390917 AAAGGCCCTGCAGTGAGCATGGG - Intergenic
906203265 1:43973402-43973424 GCAGGTCCTGCACTGGTCCTGGG + Intergenic
906207092 1:43992556-43992578 CAGGGTCCTGCACTTTGCCTTGG + Exonic
907550503 1:55300936-55300958 CAAGGTCCTTTAGTGAGCCAGGG + Intergenic
907560014 1:55379576-55379598 CAAGGCCTGTCAGTGGGCCTGGG + Intergenic
912698879 1:111861530-111861552 CAAGGTCCTGCAGTGGGCCTGGG - Intronic
912801268 1:112720982-112721004 CAAGGTGGTGCAGTGGGCAGAGG + Intronic
913508471 1:119540952-119540974 GAAGGTCCTGCAGTGGGGGGAGG - Intergenic
915476515 1:156155809-156155831 CAAGGTCATGGAGAGGACCTAGG + Intronic
915553477 1:156648173-156648195 TAAGGTCCTGCAGAGGCCCCGGG - Intronic
916080687 1:161230086-161230108 AAAGGTCCTCCAGGGGGCCTCGG + Exonic
917445932 1:175105851-175105873 CAAGGACCTGCAATGGTCCTGGG + Intronic
919415805 1:197307769-197307791 CAAGAGCCTGCTGTGAGCCTTGG - Intronic
919690758 1:200526716-200526738 CATTGTCCTACAGTGGGGCTGGG - Intergenic
920964518 1:210690901-210690923 CAAAGTGCTAAAGTGGGCCTGGG + Intronic
922796148 1:228340849-228340871 CCAGGGCCTGCAGGGTGCCTGGG - Exonic
923347259 1:233066557-233066579 CAGGCTGCTGCAGTGGGGCTGGG - Intronic
924022242 1:239796679-239796701 AAAGGTCTTGCAGTGTGACTTGG - Intronic
924205935 1:241711319-241711341 CAAGATACTGCAGTGGGAGTGGG + Intronic
924517582 1:244779515-244779537 TAGGGTCCTGCAGTGGGGCCGGG + Intergenic
1065218340 10:23472094-23472116 AAAGTTCCTGCTGTGTGCCTAGG - Intergenic
1066614696 10:37282966-37282988 CAAGAACCTGCAGTGGTCCCTGG + Intronic
1067971992 10:50982658-50982680 CAATGTCTAGCAGAGGGCCTGGG + Intergenic
1069991963 10:72321558-72321580 CAAGGTCATGCAGCTGGCCTGGG - Intergenic
1070597388 10:77842126-77842148 CAAGGACCTGCAGTGGGAGATGG - Exonic
1071258596 10:83897883-83897905 TAAGGTCCTGCAGTGTGCTATGG + Intergenic
1072440062 10:95446519-95446541 CAAGGTCCTGCAAAGGTTCTTGG + Intronic
1073013920 10:100383014-100383036 CCAGGTGATGCAGTGCGCCTAGG + Intergenic
1073366044 10:102941870-102941892 CCAGGCCCTGCTGTGGGCCCTGG - Intronic
1074493736 10:113960587-113960609 AAAGGGCTTGCAGGGGGCCTTGG - Intergenic
1076391985 10:130110385-130110407 CGAGGTCCTGCAATGAGTCTCGG + Intergenic
1076591652 10:131587619-131587641 CTGGGTCCTGCCCTGGGCCTTGG - Intergenic
1076627238 10:131829593-131829615 GAATGGCCTGCAGTGGGCCCAGG + Intergenic
1076705916 10:132301513-132301535 CAAGGCCCCGCAGTGGGCTCGGG + Intronic
1077480362 11:2811736-2811758 GACGGTGCAGCAGTGGGCCTGGG + Intronic
1077538758 11:3136663-3136685 CCAGGGCCTCCTGTGGGCCTGGG - Intronic
1077869886 11:6252794-6252816 AGAGGTCCTGAAGTAGGCCTGGG - Intergenic
1078533604 11:12156106-12156128 CCAGGGCCTGCAGTGGACCTGGG + Intronic
1080041370 11:27762895-27762917 CAAGGTCCAGCAGTGGGCAGAGG + Intergenic
1081033295 11:38113067-38113089 CAAGAACCTGCAGTGGTCCCTGG - Intergenic
1081814636 11:45931704-45931726 CCAGGGCCTGGAGTGGGCTTGGG + Intronic
1083472145 11:62891200-62891222 CTGTGTCCTGGAGTGGGCCTGGG + Intergenic
1084317529 11:68354056-68354078 CAAGGGGCTGCAGTGGCCCCCGG + Intronic
1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG + Intronic
1084876872 11:72139605-72139627 AAAGGTGCTGCAGAGGGCCCCGG - Exonic
1087061837 11:93986607-93986629 CAAGGTCCTGTGGTGGGGCAAGG - Intergenic
1087157941 11:94922933-94922955 CCTGGGCCTTCAGTGGGCCTGGG - Intergenic
1088826163 11:113496193-113496215 GAAGGGGCTGCAGAGGGCCTGGG - Intergenic
1090627102 11:128617161-128617183 CAAGGTCTTTCCGTGTGCCTGGG + Intergenic
1091805858 12:3355344-3355366 CAAGGTCCTGCAGCTGGCAAGGG - Intergenic
1092632289 12:10395032-10395054 CAAGGAGCTGCAGTGGGCACTGG - Intronic
1094552051 12:31462195-31462217 CTAGCTTCTTCAGTGGGCCTTGG - Intronic
1096539234 12:52295530-52295552 CAGGGCCCTGCAGAGGGCATGGG - Intronic
1096654305 12:53079146-53079168 CCAGGCCCTGCACTGGGCCGAGG + Intronic
1098247855 12:68538905-68538927 CAAGGGCGTCCAGAGGGCCTGGG - Intergenic
1100445715 12:94657704-94657726 CAGGGTCTTGCTGTGTGCCTAGG + Intergenic
1100980230 12:100157539-100157561 CCAGGCCCTGCAGGGGGCCATGG - Intergenic
1101714684 12:107300510-107300532 CAAGCTCCTGCTATGGCCCTGGG - Intergenic
1102124713 12:110470432-110470454 CAGGATCCTGCAGTCGGCCAAGG - Intronic
1102423617 12:112823601-112823623 CAAGTTTCTGCAGTGGTCCTAGG + Intronic
1103400705 12:120641101-120641123 CCGGGGCCTGCAGTGCGCCTGGG - Exonic
1103797733 12:123516432-123516454 CAGGGTCCGGCAGAGGGCCGTGG - Intronic
1104282727 12:127392533-127392555 AAGCGTCCTGCAGTGAGCCTGGG + Intergenic
1104685066 12:130779508-130779530 AAAGGTCCTGAGGTGGGCATGGG - Intergenic
1106117653 13:26831018-26831040 GAAGGCCCTGCAGTGGTCCAGGG - Intergenic
1107887956 13:44890284-44890306 CAGGGTCCTGCAGTGGCCACTGG - Intergenic
1108962263 13:56248351-56248373 CAAGGTCCTGAAGTGAACATAGG - Intergenic
1109053395 13:57513840-57513862 CTAGGTCCTGCAAAGGGCTTTGG - Intergenic
1109266035 13:60201334-60201356 AAAAGTCCTGCAGTGTTCCTGGG - Intergenic
1113619083 13:111700970-111700992 CAAGGGCATGCAGGGGGCCTGGG - Intergenic
1113624612 13:111786231-111786253 CAAGGGCATGCAGGGGGCCTGGG - Intergenic
1116934492 14:50725016-50725038 CCAGGTCCTGCCGTGGGCACAGG - Intronic
1121214921 14:92240321-92240343 CATGGTCCTTCACTGGGCCCGGG + Intergenic
1121526137 14:94620813-94620835 CCAGACCCTGCAGTGGGCCCAGG + Intronic
1122783414 14:104153311-104153333 GAAGTTCCTCCAGTGAGCCTCGG - Intronic
1122794066 14:104196992-104197014 CAAGTTCCTGCAGTGAGCTGGGG - Intergenic
1123948506 15:25250396-25250418 CATGGTCCTGGTGTGGCCCTGGG + Intergenic
1125907180 15:43403748-43403770 CACGCTCATCCAGTGGGCCTAGG - Exonic
1127297970 15:57626825-57626847 CACTGTCCTGGAGTGGGTCTGGG + Intronic
1127371584 15:58346480-58346502 CAAGGGCCTGCAGAGTGGCTGGG + Intronic
1128079126 15:64845762-64845784 CAAGTTCCAGCTGTGGCCCTAGG + Intronic
1128243970 15:66120344-66120366 CAAGGTCATGGAGTGGAACTTGG + Intronic
1129238945 15:74240452-74240474 GAAGTTCCTGCAGTGAGGCTGGG - Intronic
1129516508 15:76160660-76160682 CCTGGTCCTGCAGGGGCCCTGGG + Intronic
1129741316 15:77990976-77990998 CAAGGTCAGGGAGAGGGCCTGGG + Intronic
1129782743 15:78284585-78284607 CTAGGTCTGGCAGAGGGCCTGGG - Intronic
1129844348 15:78761423-78761445 CAAGGTCAGGGAGAGGGCCTGGG - Intronic
1129897057 15:79116196-79116218 CAAGGCCCGGCAATGGGCCTGGG - Intergenic
1130257451 15:82332356-82332378 CAAGGTCAGGGAGAGGGCCTGGG + Intergenic
1130485222 15:84394964-84394986 CCAGGCCCTGCAGGGGGCCATGG + Intergenic
1130554674 15:84914456-84914478 CAAGGTCCTGCCATGCCCCTTGG - Intronic
1130597493 15:85257609-85257631 CAAGGTCAGGGAGAGGGCCTGGG - Intergenic
1132335494 15:101045921-101045943 CAGGGCCCTGCAGTGGAGCTTGG + Intronic
1132373525 15:101313561-101313583 CAAGGCCCTGAAGCAGGCCTGGG - Intronic
1132701261 16:1223077-1223099 CAAGGTGCTGCCGTGGTCCTTGG - Intronic
1133378990 16:5314181-5314203 CCAGGTCATGCAGTGGGTATTGG + Intergenic
1134070884 16:11259029-11259051 CAAGGTCATGCAGCAGGTCTGGG - Intronic
1135156533 16:20057669-20057691 CAGGGTCCTCTGGTGGGCCTTGG - Intronic
1136332263 16:29587995-29588017 CAAGCTACTGCACTGGGCCACGG - Intergenic
1136446958 16:30328064-30328086 CAAGCTACTGCACTGGGCCATGG - Intergenic
1139402189 16:66691673-66691695 CAAGGTCCTGCTCTGTGCCCAGG - Intronic
1141183808 16:81772925-81772947 CAGGGTCCTGCAGTGGTCATAGG - Intronic
1141354204 16:83328412-83328434 CAAGGTCCTGATGTGAACCTTGG - Intronic
1141938899 16:87261236-87261258 CACGGACCAGCAGTGGGGCTGGG + Intronic
1141954417 16:87360892-87360914 CAGGGCCCTGCACTGGGCCCTGG - Intronic
1141984872 16:87573167-87573189 CCAGGTGCTGCACTGGGGCTGGG + Intergenic
1142995667 17:3758795-3758817 CAAGGTCCTTCAGTTTGCCCGGG + Intronic
1143296148 17:5873453-5873475 CAAAGTCCTCCACTGGGCTTAGG + Intronic
1143474591 17:7195484-7195506 CATCATCCTGCTGTGGGCCTGGG - Intronic
1143649855 17:8256708-8256730 CAGGCCCCTGGAGTGGGCCTGGG + Intronic
1144143236 17:12370616-12370638 CAAGCTCCTGCTGAGGGTCTTGG - Intergenic
1144785099 17:17827122-17827144 AAAGGCCCTGCAGTGGGCGTGGG + Intronic
1144843961 17:18206278-18206300 CATGGTTGTGGAGTGGGCCTGGG + Intronic
1144847402 17:18227044-18227066 CAAGGGGCTGCTGTGGTCCTGGG + Intronic
1145211804 17:21018900-21018922 CAGGGACCTGCAGTGGGCTTGGG - Intronic
1145288148 17:21521885-21521907 GAAGGACCTGCAGTGGCCCCAGG + Intergenic
1145389489 17:22444558-22444580 GAAGGACCTGCAGTGGCCCCAGG - Intergenic
1146664127 17:34685531-34685553 CAAGGTTTTGCAGTGGGAATGGG - Intergenic
1146788144 17:35735622-35735644 CCAGGCCCTGCAGTGGGCACTGG + Intronic
1146798136 17:35797399-35797421 CAAAACCCTGCAGTGGACCTTGG - Intronic
1147460121 17:40562993-40563015 CAAGGAGCTGCAATGGGCCCAGG - Intronic
1148407149 17:47425216-47425238 CAAGGTCATACAGTAGGTCTTGG - Intronic
1148544115 17:48503882-48503904 CAAGCTGCTGCAGTGGGCGATGG - Intergenic
1151928311 17:77214615-77214637 CACTGTCCTGCAGTGGGGCCGGG + Intronic
1152018061 17:77765001-77765023 CTAGAGTCTGCAGTGGGCCTGGG + Intergenic
1152587437 17:81195353-81195375 CCAGGTTCTGGAGTGGGGCTTGG - Intronic
1153359452 18:4176959-4176981 CAAGATCCAGCTGTGAGCCTGGG - Intronic
1154337424 18:13476734-13476756 CAAGATCCTGCAGAGGCTCTTGG - Intronic
1154346029 18:13544249-13544271 CAGAGTGCTGCAGTGGGCCAGGG + Intronic
1155063155 18:22246476-22246498 CAAGGTCCTGGGGTGGGCCCAGG + Intergenic
1156741002 18:40327667-40327689 CAAGGTCCTGAATTGGACTTGGG + Intergenic
1157294948 18:46435641-46435663 CATGGTCCTGCAGTGGGGGAGGG + Intronic
1158574671 18:58626137-58626159 CGAGGTACTCCAATGGGCCTGGG + Intronic
1158725812 18:59970450-59970472 CAAGGTCATACAGTAGGTCTTGG - Intergenic
1159887534 18:73923271-73923293 CAAGGTCCTTCAATGGTACTCGG + Intergenic
1160915091 19:1492646-1492668 CAAGGACTTGCTCTGGGCCTGGG + Intronic
1160995167 19:1879101-1879123 GCAGTCCCTGCAGTGGGCCTGGG - Intronic
1161237711 19:3206098-3206120 CAGGCCCCTGCAGTGGGGCTGGG - Intronic
1161635341 19:5385189-5385211 CAAGGGCATGCAGAGGGGCTTGG - Intergenic
1162060487 19:8091692-8091714 CCAGGGGCTGCAGTGGGGCTGGG + Intronic
1164437311 19:28241796-28241818 CAAGATCCTTCAGTAGCCCTTGG + Intergenic
1164513127 19:28913359-28913381 CAAAGCCCTGCACTGAGCCTTGG + Intergenic
1164590662 19:29505147-29505169 CCAGGAGCTGCAGGGGGCCTTGG - Intergenic
1165434633 19:35789257-35789279 CATGGTGCTCCAGCGGGCCTGGG + Intergenic
1165942096 19:39419808-39419830 CAAGAGCTTGCAGTGAGCCTAGG + Intronic
1167244378 19:48364851-48364873 GAAGGGCCTGCAGAGGGACTGGG - Intronic
1168597097 19:57686209-57686231 CAAAGTCCTGCTGAGGGCTTTGG + Intronic
927093725 2:19731776-19731798 CCAGGTGCTGCAATGGCCCTGGG + Intergenic
927972343 2:27313639-27313661 CAGGGTCTTGCATTGGGCTTGGG - Intronic
928425853 2:31177155-31177177 CAAGCTCCTGCTGTGGGTATTGG + Intronic
933720435 2:85394290-85394312 CACAGCCCTGCAGTGGCCCTGGG + Intergenic
933887554 2:86733729-86733751 CAGGCTCATGCATTGGGCCTGGG + Intronic
933922623 2:87062983-87063005 CAGGCTCATGCATTGGGCCTGGG - Intergenic
934682182 2:96291997-96292019 CAAGGTCCTGGAGAGGGGCAAGG + Intronic
935332698 2:101988704-101988726 CCAGGTACTGCATGGGGCCTGGG + Intergenic
935416100 2:102821033-102821055 CAAAGTCCTGCAGTGGCCACAGG + Intronic
936345929 2:111675006-111675028 AATGGTCCTGCATTGGGCATAGG + Intergenic
937216925 2:120318775-120318797 CAAGGGCCTCCAGTCGGCCCTGG - Intergenic
937242788 2:120473387-120473409 CAAGTTCCTGTCTTGGGCCTAGG - Intergenic
939062170 2:137435504-137435526 CAAAGCCCTGCAGTGGACATTGG - Intronic
941549542 2:166897820-166897842 CAAGGCCATGCAGTGGGGGTTGG + Intronic
942516656 2:176761095-176761117 CTCGGTGCTGCAGTGGACCTTGG + Intergenic
943799281 2:192037498-192037520 CAAGGTCCTGCAGGGGCCAAGGG - Intronic
946401199 2:219469234-219469256 CCAGGTCCTGCAGTGGCCGCAGG - Exonic
947472126 2:230410196-230410218 CCAGGTCATGAAGTGGCCCTGGG - Intergenic
948657140 2:239483490-239483512 GAGGGACCTGAAGTGGGCCTTGG - Intergenic
948663030 2:239518426-239518448 CGGGGCCCTGCAGCGGGCCTGGG + Intergenic
948835166 2:240622874-240622896 CAGGGTCCTGCTGTGGGCACGGG - Intronic
948869721 2:240791923-240791945 CCAGGCCCTGCACTGGGGCTGGG + Intronic
1168929687 20:1611022-1611044 CAAGGTCCAGCCCTGTGCCTGGG + Intronic
1169197703 20:3692421-3692443 CAAAGGACTGCAGTGGGCCCAGG - Intronic
1169246297 20:4027869-4027891 CAAGGTCCTGTGCTGGGCCAGGG + Intergenic
1171112254 20:22494896-22494918 GAAACTCCTGCAGTGGGCCTTGG + Intergenic
1171278746 20:23879587-23879609 CAAGGTCCTAGATTGGGCCGAGG + Exonic
1173570318 20:44071623-44071645 GAAGGCCCTGGAGTGGGGCTTGG - Intergenic
1175216638 20:57394780-57394802 CAGGCGCCTGCTGTGGGCCTGGG - Intronic
1175223870 20:57433625-57433647 CAGGGGCCTGCAGAGGCCCTGGG - Intergenic
1175237701 20:57525554-57525576 CGAGGGCCTGCAGGGGGCCTGGG + Intronic
1175743344 20:61435999-61436021 AAAGGTCCTGTGGTGGGGCTGGG - Intronic
1175921865 20:62453858-62453880 CAGGGACCTCCCGTGGGCCTGGG + Intergenic
1176020241 20:62958998-62959020 CCAGCTCCTGCAGTGGGACCTGG - Intronic
1179799593 21:43804720-43804742 CCAGGGCTTGGAGTGGGCCTGGG + Exonic
1179996770 21:44977791-44977813 CCATGTCCTGCAGCGGGGCTGGG + Intergenic
1180609656 22:17086812-17086834 CAAGGTCCTTAAGTGGGACAGGG + Intronic
1180847333 22:18991072-18991094 CACTGTCCTGCAGTGTCCCTGGG + Intergenic
1181315950 22:21970983-21971005 GAAGGCCGTGCAGTGGGACTAGG + Intronic
1181747725 22:24967529-24967551 CCAAGGCCTGCACTGGGCCTTGG + Intronic
1182167227 22:28188386-28188408 CAGGGTCCTGCAGCTGGGCTTGG - Intronic
1182817449 22:33178272-33178294 CAAGGGGCTGCAAGGGGCCTGGG - Intronic
1182899220 22:33884187-33884209 CAAGGCCATGCGGTTGGCCTCGG + Intronic
1183475045 22:38031518-38031540 CCAGGTCCTGCACTGGGCTCTGG - Intronic
1183598804 22:38828257-38828279 CTGGGTCCTGCAGAGGGCATTGG - Intronic
1183669708 22:39265178-39265200 CAGGGTCCTGGAGTGTGCCTGGG + Intergenic
1185286231 22:50001024-50001046 GCAGGTCCAGCAGTGGGCCCAGG - Intronic
950530434 3:13549577-13549599 CAAGGTCCTGCGGTCGGGGTGGG - Intronic
952392044 3:32888899-32888921 AAAGGTCCTGCTGTGGGCACAGG - Intronic
955438090 3:58925487-58925509 CGAGTTCCTGCTGTGGGCCAAGG - Intronic
957776094 3:84758847-84758869 TAAGTTCCTGCAGTGGTTCTTGG - Intergenic
961489690 3:127246099-127246121 CAAGTTCCTGCTGTGAGTCTGGG - Intergenic
962256287 3:133872302-133872324 GAAGGACCTGCAGAGGGACTCGG + Intronic
962918800 3:139933499-139933521 CAAGGTCCTGGTGTCGGCCTGGG + Intergenic
962940689 3:140122233-140122255 CAAGTTCCTGTAGTGGGGATAGG - Intronic
963504630 3:146168250-146168272 TAAGGTGCTGCAGTGAGACTGGG - Intergenic
963667420 3:148206498-148206520 CATGGTCCTAAACTGGGCCTTGG + Intergenic
963746946 3:149134138-149134160 CAGGGGCCTGCACTGGGCCACGG + Intronic
967367571 3:188705012-188705034 CAGGGTCCTTCACTTGGCCTGGG + Intronic
967700938 3:192591576-192591598 CAAGGCCCTACAGTGGGCTCAGG + Intronic
968295316 3:197571869-197571891 CAAGGTCTTGCTGTTTGCCTAGG - Intronic
968735263 4:2291863-2291885 CATGGTGCTGCACTGGGCCAAGG + Intronic
969211293 4:5689455-5689477 CACGGTCTCGCAGAGGGCCTGGG + Intronic
969416555 4:7063923-7063945 CCATGGCCTGCAGTGGGCCCAGG - Intronic
969470000 4:7382078-7382100 CAAGGTCCTTCTGGAGGCCTTGG - Intronic
969477252 4:7428650-7428672 AAAGGCCCTGGGGTGGGCCTGGG + Intronic
969540793 4:7787766-7787788 CAAGGTGCTGCCCAGGGCCTCGG + Intronic
969636063 4:8370178-8370200 CAAGGCCCTGGGGTGGGCATGGG + Intronic
972407739 4:38762730-38762752 CAAGGACCTGCAAAGGGCCCAGG + Intergenic
973676106 4:53264331-53264353 CATGTTCCTGCAGTGGTTCTTGG + Intronic
974432504 4:61817039-61817061 CAAGGTGGTGGAGTGGGGCTGGG - Intronic
977050976 4:92128430-92128452 CCAGCACCTTCAGTGGGCCTGGG + Intergenic
978080805 4:104589139-104589161 AAGGATGCTGCAGTGGGCCTGGG - Intergenic
981188020 4:141828025-141828047 CTGGGGCCTGCATTGGGCCTAGG + Intergenic
982402332 4:154982355-154982377 CAAGGGGCTGCAGTGGGCAAAGG - Intergenic
983984511 4:174041936-174041958 CAAGGCCCTGCAGGGAGCCCTGG + Intergenic
986310170 5:6545469-6545491 AAAGGTCCTGCTGGAGGCCTGGG - Intergenic
986618013 5:9639539-9639561 CATGTTCCTGCAGTGGTTCTTGG + Intronic
990330794 5:54723512-54723534 AAAGGCCATGCACTGGGCCTGGG - Intergenic
990734062 5:58840993-58841015 CAAGGCTCTTCAGTTGGCCTGGG + Intronic
991215194 5:64151926-64151948 TATGGTCCTGCAGTGGTTCTTGG + Intergenic
991485808 5:67135484-67135506 CAAGGTCCAGCAGTGGAAGTAGG + Intronic
994231874 5:97316603-97316625 CAAGAACCTGCAGTGGTCCCTGG + Intergenic
994355246 5:98787363-98787385 CGAGGCCCTGCTCTGGGCCTAGG - Intronic
994408971 5:99382314-99382336 AAGAGTCCTGCAGTGGGGCTTGG + Intergenic
996135627 5:119838513-119838535 AATGGTGCTGCAGTGAGCCTCGG + Intergenic
999552160 5:152701036-152701058 AAAGTTCCTGCAGTGGCCCATGG - Intergenic
1002399045 5:178981078-178981100 GAAGGGCCTGCAGTGGGCGCGGG - Exonic
1003164896 6:3668819-3668841 CAAGGTCATTCAGTGGGCAAAGG + Intergenic
1006509329 6:34513431-34513453 CGAGGCCCTGCAGTGGTGCTGGG + Intronic
1006732034 6:36243496-36243518 CAAAGTCCTGGGGTGGGCCCAGG + Intronic
1006875484 6:37291814-37291836 CAAGGTCCTGGAGTCCTCCTTGG - Intronic
1007769693 6:44183025-44183047 CAAGGGTCAGGAGTGGGCCTTGG + Intronic
1008290233 6:49705954-49705976 CATGCTCCTGCAGTGGTTCTTGG + Intronic
1012549305 6:100453210-100453232 CAAGGTCCTGCACACAGCCTGGG + Intronic
1013233171 6:108175128-108175150 CAAGTTCCTGATGTGGGCATGGG - Intronic
1013506494 6:110805555-110805577 TCAGGTCCTGCAGTTGGCCCTGG + Intronic
1015808291 6:137133979-137134001 CAAGCAGCTGCAGTGGCCCTGGG - Intergenic
1016990892 6:149926852-149926874 CAAGGCCCTGCATTTGACCTAGG - Intergenic
1017076083 6:150620262-150620284 CAAAGTCCTTCACTGGCCCTGGG + Intronic
1017931510 6:158959446-158959468 CAGGGTCCTGAGGTGGCCCTGGG + Intergenic
1019283398 7:211523-211545 CATGGTCCTGCAGCGGGCAGAGG + Intronic
1019469606 7:1211701-1211723 GAAAGTCCTGCTGTGGGCCCCGG - Intergenic
1021664763 7:22965650-22965672 CAAGGTCTTGCTGTGTGCCTAGG + Intronic
1021996663 7:26184829-26184851 CAAGGTCATACAGTAGGTCTTGG - Exonic
1022739171 7:33105110-33105132 CCTGGTCCAGCAGTGGTCCTAGG - Intronic
1026536776 7:71245048-71245070 GAAGGTCCTAGAGTGGGGCTAGG - Intronic
1028401432 7:90429963-90429985 TATGTTCCTGCAGTGGGTCTTGG - Intronic
1029113535 7:98225005-98225027 CCCGTCCCTGCAGTGGGCCTGGG - Exonic
1029516441 7:101026292-101026314 GGAAGTCCTGCTGTGGGCCTGGG + Intronic
1029713710 7:102314291-102314313 CCATGTCCTGCCGTGGGACTTGG - Intronic
1030587970 7:111445208-111445230 CAATGTCCTGCAGTGTTCTTGGG - Intronic
1034431999 7:151045751-151045773 CAGGGTCTGGAAGTGGGCCTGGG + Intronic
1036752087 8:11449780-11449802 CAAGGAGCCGCTGTGGGCCTGGG - Intronic
1039952591 8:42183521-42183543 CAACGTGCTTCAGTGGGGCTGGG + Intronic
1040276319 8:46015884-46015906 CAAGGCCCAGGAGGGGGCCTGGG - Intergenic
1043667341 8:82832434-82832456 CAACTGCCTGCGGTGGGCCTTGG + Intergenic
1049064167 8:140299646-140299668 CAATCTCCTGCAAGGGGCCTCGG + Intronic
1049616724 8:143578731-143578753 CCAGCTCCTGCCCTGGGCCTGGG + Intergenic
1049636313 8:143691413-143691435 CCAGGGCCTTCCGTGGGCCTTGG + Intronic
1049784294 8:144443255-144443277 CACGGAGCTGCAGAGGGCCTGGG - Exonic
1053286036 9:36850108-36850130 AAAGGCCCGGCAGTGGGGCTGGG + Intronic
1053433455 9:38059202-38059224 CAAGGCCCGGCAGTGGGCCAGGG + Intronic
1054906989 9:70420539-70420561 CAGGATCCAGCACTGGGCCTGGG - Intergenic
1055941158 9:81651327-81651349 CCAGGTCCTGCAGTGGGGGGCGG + Intronic
1056311859 9:85348904-85348926 GAAGGGCCTGCCCTGGGCCTTGG - Intergenic
1057190500 9:93084437-93084459 CCAGGCCCTCCAGTGGGCCTGGG - Intronic
1057691170 9:97287811-97287833 ATAGTGCCTGCAGTGGGCCTAGG + Intergenic
1058364716 9:104195383-104195405 CAGGTTCCTGCTGTGGGCTTGGG - Intergenic
1058508797 9:105694364-105694386 CCAGGTCCTGCACTGCGCCCAGG + Intergenic
1058932271 9:109732893-109732915 AAAGACCCTGCAGTGGGCATGGG + Intronic
1059341498 9:113599952-113599974 CAAGGTCCTCCAGGGAGCCCAGG - Intergenic
1059925895 9:119208816-119208838 CAAGCTCCTGCAGAGTGCCACGG - Exonic
1060188808 9:121579490-121579512 CTTGGTCCTGCAGTGGGCAGGGG - Intronic
1061027961 9:128062847-128062869 CAAGGGCCTGCGCTGTGCCTGGG + Exonic
1062242561 9:135548140-135548162 CAAGTTCCTGAAGTGGGAGTGGG + Intronic
1187612303 X:20955648-20955670 CAAGGTCCTGCAGGTGCCCTGGG + Intergenic
1188496161 X:30785101-30785123 CAAGGTCCTGAAGAGGTCTTAGG - Intergenic
1192640801 X:72859973-72859995 CTAGGTCCTACAGTGGACATAGG + Intergenic
1192640910 X:72860803-72860825 CTAGGTCCTACAGTGGACATAGG - Intergenic
1195094978 X:101493520-101493542 GAAGGTCCTGGATTGGGCCTGGG + Exonic
1196443789 X:115735157-115735179 CAGGGTCCCGCAGTGGGCCAGGG + Intergenic
1197716078 X:129706923-129706945 CCAGGCCCTGCAGTGGGAGTGGG - Intergenic
1197722585 X:129755356-129755378 CAAGTACCTGTAGTGGGCCAGGG - Exonic
1198396738 X:136226791-136226813 CAATGACCTGCAGTGGTACTGGG + Intronic
1198932761 X:141878936-141878958 CAGAGTCCTGCCTTGGGCCTGGG + Intronic
1200150913 X:153951054-153951076 CATGGACCTGCAGTGTTCCTGGG - Intronic
1200163509 X:154020694-154020716 CAGGGGCCAGCTGTGGGCCTTGG - Intergenic
1200697464 Y:6373697-6373719 CAAGGTCCTGCAGTGGGTTTTGG - Intergenic
1201036649 Y:9791002-9791024 CAAGGTCCTGCAGTGGGTTTTGG + Intergenic
1201947174 Y:19523839-19523861 CAGGCTCCTGCATTGGGCTTAGG - Intergenic