ID: 912698880

View in Genome Browser
Species Human (GRCh38)
Location 1:111861531-111861553
Sequence ACAAGGTCCTGCAGTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 281}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698880_912698892 12 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698880_912698883 -9 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698883 1:111861545-111861567 GGACCTTGTTCCTGTGTTTACGG No data
912698880_912698890 5 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698890 1:111861559-111861581 TGTTTACGGAGGGAAGCGGGTGG No data
912698880_912698895 15 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698880_912698891 9 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698891 1:111861563-111861585 TACGGAGGGAAGCGGGTGGCAGG No data
912698880_912698885 -6 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698885 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
912698880_912698897 29 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698880_912698893 13 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698880_912698889 2 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698880_912698896 23 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698880_912698894 14 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698880_912698886 -5 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698886 1:111861549-111861571 CTTGTTCCTGTGTTTACGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 106
912698880_912698888 1 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698880 Original CRISPR ACAAGGTCCTGCAGTGGGCC TGG (reversed) Intronic
900361725 1:2292433-2292455 TCAGGGACCTGCTGTGGGCCAGG + Intronic
901331157 1:8409784-8409806 ACAAGTTCCTGGGGAGGGCCTGG + Intronic
901413690 1:9102935-9102957 ACAGGGTCCTGCTGTTGCCCAGG + Exonic
901650707 1:10741420-10741442 ACAAGCTCCAGCACTGGCCCAGG + Intronic
902409110 1:16202421-16202443 ACCAGTTCCTGCTGCGGGCCCGG - Exonic
902963101 1:19978506-19978528 CCATGGGCCTGCAGTAGGCCTGG + Exonic
903740607 1:25556408-25556430 ACAAGGAGCCCCAGTGGGCCCGG - Intronic
904556906 1:31371283-31371305 ACAAGGTCCTGCTCTGTGCAAGG - Intronic
905294753 1:36947160-36947182 ACCAGGCCCAGGAGTGGGCCAGG - Intronic
905339724 1:37270248-37270270 AACAGTTCCTGCAGTGGGTCTGG - Intergenic
906248187 1:44291823-44291845 TCCAGGTCCTGCAGTAGGCGAGG - Intronic
906520768 1:46465718-46465740 ACAAGGGCCAGCAGTGGGGTGGG + Intergenic
906709229 1:47916697-47916719 ACATGGGCCAGCAGTGGGCAGGG + Intronic
907550502 1:55300935-55300957 CCAAGGTCCTTTAGTGAGCCAGG + Intergenic
907947471 1:59148396-59148418 ACAAGCTCCAGCTGTGAGCCAGG - Intergenic
910234011 1:85016243-85016265 ACAAGATCCCCCAGTGGGCCGGG + Intronic
912698880 1:111861531-111861553 ACAAGGTCCTGCAGTGGGCCTGG - Intronic
912757869 1:112339671-112339693 ACAAGGTCTTGCTGTCGCCCAGG - Intergenic
914766740 1:150644300-150644322 ACAAGGTCTTGCTATGGCCCAGG + Intergenic
915184992 1:154098088-154098110 ACCAGTTGCTGCAGTGGGACAGG + Intronic
915553478 1:156648174-156648196 GTAAGGTCCTGCAGAGGCCCCGG - Intronic
917445931 1:175105850-175105872 CCAAGGACCTGCAATGGTCCTGG + Intronic
918257994 1:182767585-182767607 CCAAGGTTCTGAAGTAGGCCTGG - Intergenic
918296429 1:183161426-183161448 AAAAGGTCCTGCAGTGGAAGTGG + Intergenic
920399997 1:205670512-205670534 ATAAGGGCCGGCAGTGGGACGGG + Intronic
920664069 1:207947276-207947298 AGAATGTCCTGCAGAGGGTCAGG + Intergenic
920745701 1:208625971-208625993 ACAAGGCCCTGCAGGGGAGCTGG - Intergenic
920964517 1:210690900-210690922 ACAAAGTGCTAAAGTGGGCCTGG + Intronic
922039990 1:221887237-221887259 ACATGGTCCTGGAATGGGGCTGG - Intergenic
922208118 1:223466824-223466846 ACCAGGGTCAGCAGTGGGCCAGG - Intergenic
923347260 1:233066558-233066580 ACAGGCTGCTGCAGTGGGGCTGG - Intronic
924517581 1:244779514-244779536 ATAGGGTCCTGCAGTGGGGCCGG + Intergenic
924744065 1:246816327-246816349 ACAAGGTTCTGCTGTCGCCCAGG + Intergenic
1064983830 10:21190182-21190204 ACAAGATCCTGGATTAGGCCAGG + Intergenic
1065717507 10:28586661-28586683 ACAGGGTCTTGCTGTCGGCCAGG - Intronic
1069991964 10:72321559-72321581 CCAAGGTCATGCAGCTGGCCTGG - Intergenic
1070041868 10:72788854-72788876 AAAAGGTACTGCAGTGAACCAGG + Intronic
1070831298 10:79419589-79419611 CCAAGGGCCTCCAGTGTGCCAGG - Intronic
1071809608 10:89165044-89165066 GCAAAGTCCTGCAGTGGGAATGG + Intergenic
1072168811 10:92839869-92839891 AGAAGGCCCTGCAGAGGGCTGGG + Intronic
1072617820 10:97060963-97060985 ACAAGAACCTGCTGTGTGCCAGG - Intronic
1072744155 10:97928284-97928306 ACCATGCCCTGCAGGGGGCCAGG + Intronic
1073134441 10:101212361-101212383 AGAAGGTCCTGCAGTTGGGTGGG + Intergenic
1074563516 10:114555355-114555377 ACTAAGGCCTGGAGTGGGCCCGG + Intronic
1075998056 10:126894109-126894131 ACAAGGACCAGGAGAGGGCCAGG - Intergenic
1076097583 10:127744553-127744575 ACAGGGTCCAGCAGTAGGCCTGG - Intergenic
1076705915 10:132301512-132301534 ACAAGGCCCCGCAGTGGGCTCGG + Intronic
1076849898 10:133087688-133087710 ACAGGGTCGTGCAGTCCGCCCGG + Intronic
1077480361 11:2811735-2811757 AGACGGTGCAGCAGTGGGCCTGG + Intronic
1077783810 11:5360976-5360998 ACCAGGGCCTGCAGTGGGGTGGG + Intronic
1077869887 11:6252795-6252817 AAGAGGTCCTGAAGTAGGCCTGG - Intergenic
1078533602 11:12156105-12156127 GCCAGGGCCTGCAGTGGACCTGG + Intronic
1078708674 11:13769315-13769337 ACAAAGTCCTCCAGTGGGGCAGG - Intergenic
1080557167 11:33428455-33428477 ACTAGGTCCTGTCGTGGGCGGGG - Intergenic
1081868060 11:46370507-46370529 TGAAAGGCCTGCAGTGGGCCAGG - Intronic
1084086018 11:66855825-66855847 ACAAGTTCCTCCTGTAGGCCAGG - Intronic
1084458991 11:69285844-69285866 ACGAGGCTCTGCAGTGAGCCTGG + Intergenic
1087011774 11:93521274-93521296 AGGGGCTCCTGCAGTGGGCCTGG + Intronic
1088626924 11:111736185-111736207 ACAAGGTGCTGCAGTGACCAAGG + Intronic
1088768987 11:113014347-113014369 ACTTAGTCCTGCAGAGGGCCAGG + Intronic
1088779263 11:113118511-113118533 AGAAGGCCCTGCAATGGTCCAGG - Intronic
1088826164 11:113496194-113496216 AGAAGGGGCTGCAGAGGGCCTGG - Intergenic
1089296789 11:117474094-117474116 CCAAGCACCTGCAGTGTGCCAGG + Intronic
1089500504 11:118929050-118929072 ACAAGGTCCTGGGATGGGGCGGG + Intronic
1090004820 11:122992365-122992387 AAAAAGTCATGAAGTGGGCCAGG + Intergenic
1090260060 11:125313005-125313027 ACACGGGCCTCCAGTGGGCTTGG - Intronic
1090285780 11:125497522-125497544 ACAAGGTCTTGCTGTCGCCCAGG - Exonic
1091805859 12:3355345-3355367 CCAAGGTCCTGCAGCTGGCAAGG - Intergenic
1091856751 12:3746673-3746695 AAAGGGTCCTGCAGGGGGTCTGG - Intronic
1097129833 12:56803944-56803966 ACCAGCTGCCGCAGTGGGCCGGG + Intergenic
1099437744 12:82664031-82664053 ATGAGGGCCTGCAGTGTGCCAGG - Intergenic
1101714685 12:107300511-107300533 ACAAGCTCCTGCTATGGCCCTGG - Intergenic
1102911674 12:116719768-116719790 ATGAGGTCCTGCATTTGGCCAGG + Exonic
1103908633 12:124339996-124340018 CCACGGTCCTGAGGTGGGCCAGG - Exonic
1104750749 12:131236610-131236632 ACAGGGTCCTGAAGTGTCCCCGG + Intergenic
1105492507 13:20902555-20902577 GCAAGGGCCTGCAGGGAGCCTGG - Intronic
1105627899 13:22131260-22131282 AGAAGTTACTGCAGTGGACCAGG + Intergenic
1106074297 13:26444314-26444336 ACAAAGCCCAGCAGTGTGCCAGG - Intergenic
1106117654 13:26831019-26831041 AGAAGGCCCTGCAGTGGTCCAGG - Intergenic
1113583773 13:111448822-111448844 ACAAGGTCAGGCTGTGGGGCTGG - Intergenic
1113619084 13:111700971-111700993 ACAAGGGCATGCAGGGGGCCTGG - Intergenic
1113624613 13:111786232-111786254 ACAAGGGCATGCAGGGGGCCTGG - Intergenic
1116512113 14:45758595-45758617 GCAATGTGCTGCAGTGGGACAGG - Intergenic
1117052474 14:51875178-51875200 ACAAGATCATGCAGGGAGCCAGG + Intronic
1117383528 14:55189254-55189276 AGAAGGCCCTGAAGTGGGACAGG - Intronic
1118397994 14:65354061-65354083 ACAAGGTCTTGCTGTTGCCCAGG - Intergenic
1121214920 14:92240320-92240342 CCATGGTCCTTCACTGGGCCCGG + Intergenic
1122103993 14:99437290-99437312 GCATGGCCATGCAGTGGGCCTGG - Intronic
1122539731 14:102491403-102491425 ACAAGGTCTTGCTGTTGCCCAGG + Intronic
1122569989 14:102690563-102690585 ACAGGGTCCTGCTGTTGCCCAGG - Intronic
1122693879 14:103543637-103543659 ACAGTGTCCTGCGGGGGGCCAGG - Intergenic
1122794067 14:104196993-104197015 ACAAGTTCCTGCAGTGAGCTGGG - Intergenic
1122893887 14:104745815-104745837 ACAGAGTCCTGCACAGGGCCGGG + Intronic
1127358611 15:58225613-58225635 ACAAGGACCTGCAGTGCTGCAGG - Intronic
1127904437 15:63365841-63365863 AGAAGGTCCAGCAGTGGGCCAGG + Intronic
1129516506 15:76160659-76160681 ACCTGGTCCTGCAGGGGCCCTGG + Intronic
1129782744 15:78284586-78284608 ACTAGGTCTGGCAGAGGGCCTGG - Intronic
1129794754 15:78367679-78367701 TTAAGATCCAGCAGTGGGCCAGG + Intergenic
1129897058 15:79116197-79116219 GCAAGGCCCGGCAATGGGCCTGG - Intergenic
1130156844 15:81357852-81357874 ACTAGGTCCTATATTGGGCCTGG - Intronic
1130386820 15:83419268-83419290 AAAGGGGCCTGCAGTGGGCGTGG - Intergenic
1131725842 15:95223910-95223932 ACAAGGTGCTGCAGCAGTCCTGG - Intergenic
1132373526 15:101313562-101313584 ACAAGGCCCTGAAGCAGGCCTGG - Intronic
1132976628 16:2714294-2714316 ACCAGGTCCTGCTGGGGGCAAGG - Exonic
1133219150 16:4311484-4311506 GCAAGGTCCTGCCCAGGGCCTGG - Intergenic
1134592118 16:15463102-15463124 ACAAGGTCTTGCTGTTGCCCAGG + Intronic
1135056954 16:19239897-19239919 ACCAGCTGCTGCAGTGGGGCAGG + Intronic
1136461935 16:30416893-30416915 ACAGGGTCTTGCCGTGGCCCAGG - Intronic
1138414780 16:56865367-56865389 AGAAGGTGCTGCTGTGGGTCAGG - Exonic
1138424230 16:56919936-56919958 ACAAAAACATGCAGTGGGCCGGG + Intergenic
1138611169 16:58125656-58125678 ACAAGGTCTTGCTGTTGCCCAGG - Intronic
1139588833 16:67921714-67921736 ACAATGTCCTGGAGTAGCCCTGG - Intronic
1139842836 16:69895475-69895497 AAAAGTTCCTAAAGTGGGCCAGG + Intronic
1140057372 16:71537121-71537143 ACAGGAGCCTGCAGTGAGCCCGG - Exonic
1142995666 17:3758794-3758816 ACAAGGTCCTTCAGTTTGCCCGG + Intronic
1143003834 17:3813765-3813787 ACAAGGTCTTGCTGTTGCCCAGG + Intronic
1143480922 17:7226941-7226963 ACTAGGTCCTGCACTGGCCGAGG - Intronic
1144226338 17:13151246-13151268 AAAATGTCCTTAAGTGGGCCGGG - Intergenic
1144785098 17:17827121-17827143 CAAAGGCCCTGCAGTGGGCGTGG + Intronic
1144873734 17:18385706-18385728 ACACTGTCCTGCTGTGGTCCAGG - Intronic
1145158731 17:20560075-20560097 ACACTGTCCTGCTGTGGTCCAGG + Intergenic
1145211805 17:21018901-21018923 GCAGGGACCTGCAGTGGGCTTGG - Intronic
1145906517 17:28519303-28519325 ACAAGGTCTTGCTGTCGCCCAGG - Intronic
1147450195 17:40499623-40499645 GCCAGGTCCTGCAGGGGGCGGGG + Intronic
1148677760 17:49455102-49455124 ACAAGGCCCTGCTGTGAGCCAGG - Intronic
1149850830 17:60032740-60032762 ACAAGACCCTGCAGTGGGTGAGG + Intergenic
1149859336 17:60113784-60113806 ACAAGACCCTGCAGTGGGTGAGG - Intergenic
1150284762 17:63948551-63948573 AAGAGGACCTGCTGTGGGCCTGG + Intronic
1150561455 17:66299057-66299079 AAGTGGTCCTGCAGTGGCCCAGG + Intergenic
1151424820 17:74024223-74024245 TTAAAGGCCTGCAGTGGGCCGGG - Intergenic
1151576342 17:74954256-74954278 ACAAGGCCCTGCAGCGGCGCCGG - Exonic
1151928310 17:77214614-77214636 CCACTGTCCTGCAGTGGGGCCGG + Intronic
1152115327 17:78382938-78382960 ACAAGGCCATTCTGTGGGCCGGG - Intronic
1152614027 17:81329743-81329765 CCCAGGGCCTGCAGTGGGACAGG + Intronic
1154254261 18:12768879-12768901 ACAGGGACCTGCAGTTGGTCAGG + Intergenic
1154346028 18:13544248-13544270 TCAGAGTGCTGCAGTGGGCCAGG + Intronic
1155383088 18:25246062-25246084 ACAAGGGCCTGTAGTGGGGTGGG + Intronic
1157294947 18:46435640-46435662 TCATGGTCCTGCAGTGGGGGAGG + Intronic
1158012835 18:52748571-52748593 ACAAGAAGCTGCAGTGGGGCCGG - Intronic
1160686593 19:439548-439570 ACAGGGTCCTGAAGGGGCCCCGG + Intronic
1160915090 19:1492645-1492667 ACAAGGACTTGCTCTGGGCCTGG + Intronic
1161551890 19:4917681-4917703 ACAAGGTCTTGCTGTCGTCCAGG + Intronic
1161587990 19:5115685-5115707 GCAGGGCCCTGGAGTGGGCCGGG + Intronic
1162243957 19:9383285-9383307 ACACGGTCTTGCTGTGGCCCGGG - Intergenic
1162718686 19:12649072-12649094 TCAAGGTCCAGCAGGGGTCCAGG + Intronic
1163553694 19:17980879-17980901 ACAAGGTCTTGCTCTGTGCCCGG - Intronic
1165559977 19:36670804-36670826 ACGAGATACTGCACTGGGCCGGG + Intergenic
1165880039 19:39035931-39035953 ACAAGGTCTTGCTGTTGCCCAGG + Intergenic
1166217264 19:41343782-41343804 ACAGGTTCCTGCTGTGTGCCTGG - Intronic
1166252369 19:41579941-41579963 ACAAGGTCATGCACAGAGCCAGG + Intronic
1166384996 19:42375891-42375913 GCAGGGGCCAGCAGTGGGCCGGG + Exonic
1166729317 19:45049741-45049763 TCAAGCGCCTGCTGTGGGCCAGG + Intronic
1166801347 19:45459413-45459435 ACAAGGTCTTGCTGTCGCCCAGG - Intronic
1167254587 19:48419570-48419592 GCCAGGGCCTGCAGGGGGCCAGG - Exonic
1168159764 19:54502442-54502464 AAAAGATCCTACAGTGCGCCGGG - Intronic
925735950 2:6963955-6963977 ACCAGCTGCTGGAGTGGGCCAGG - Intronic
926186413 2:10694431-10694453 AAAAGGGACTACAGTGGGCCAGG - Intergenic
928425075 2:31171080-31171102 TCAAGCTCCTGCAATGGGTCAGG - Intergenic
929593118 2:43159638-43159660 ACAAGGTCCCTCAGTTGCCCAGG - Intergenic
932091568 2:68810443-68810465 GCAAGGCCCAGCAGTGGGCATGG + Intronic
933840634 2:86283368-86283390 ACTAGGTGCAGGAGTGGGCCTGG + Intronic
937044738 2:118845268-118845290 ACCCGGTCCGGCAGGGGGCCGGG - Intronic
937204706 2:120228042-120228064 ACAGGGCCCTGCTGTTGGCCAGG + Intergenic
937974164 2:127571243-127571265 ACCAGGTCCTTCACTGTGCCAGG - Intronic
943799282 2:192037499-192037521 ACAAGGTCCTGCAGGGGCCAAGG - Intronic
945501469 2:210580833-210580855 ACAGGGTCCTGTAGTCGCCCAGG - Intronic
946089041 2:217204475-217204497 ACACGATCTTGCAGTGGGGCTGG - Intergenic
946408818 2:219506536-219506558 CCAAGGGCCTGCTGTGTGCCAGG + Intronic
946478550 2:220032234-220032256 CCAAGGTCCAGCAGTGTGCCAGG - Intergenic
946624041 2:221592103-221592125 TCAAGGTGTTGAAGTGGGCCAGG + Intergenic
946918271 2:224549290-224549312 ACAAGGTCTTGCTGTCGCCCAGG - Intronic
947114556 2:226755068-226755090 ACCAGGTCATGCAGTGTGGCAGG - Intronic
947643343 2:231719878-231719900 TGAAGGTCATGCAGTGGGCCTGG - Intergenic
948835167 2:240622875-240622897 CCAGGGTCCTGCTGTGGGCACGG - Intronic
1169246296 20:4027868-4027890 CCAAGGTCCTGTGCTGGGCCAGG + Intergenic
1172647785 20:36482182-36482204 ACAAGCTCATTCACTGGGCCTGG - Intronic
1173853856 20:46237204-46237226 CCAAGGTCCTGCAGGGAACCAGG + Intronic
1173871099 20:46342673-46342695 GCAAGGCCCTGCAGTTGGGCTGG - Intergenic
1175237700 20:57525553-57525575 ACGAGGGCCTGCAGGGGGCCTGG + Intronic
1175372343 20:58500500-58500522 CCAAGGACCTGCTATGGGCCAGG - Intronic
1175567837 20:59994874-59994896 ACAAGGTCCAGGTGTGGGCTGGG - Intronic
1179034094 21:37745116-37745138 ACAGGGTCTTGCTGTGGCCCAGG + Intronic
1179487789 21:41722082-41722104 ACAAGGGCCAGCACTGGGGCAGG - Intergenic
1180609655 22:17086811-17086833 CCAAGGTCCTTAAGTGGGACAGG + Intronic
1181138735 22:20787989-20788011 ACCTGGTCCTGCAGTGGGTCTGG + Intronic
1181891205 22:26065115-26065137 ACAAGGTCCTGAAGGGAGGCAGG + Intergenic
1182522072 22:30890411-30890433 TCAAGATACAGCAGTGGGCCAGG + Intronic
1183032620 22:35117112-35117134 CCAGGGCCCTGCAGTGTGCCTGG - Intergenic
1183669707 22:39265177-39265199 CCAGGGTCCTGGAGTGTGCCTGG + Intergenic
1184313790 22:43666370-43666392 CCAATGTCCGGCAGTGGGGCAGG + Intronic
1184783394 22:46660087-46660109 ACCAGATCCTGGAGTGGGGCTGG - Intronic
1184880080 22:47299183-47299205 CCAAGGTCCTGCTGGGGACCTGG - Intergenic
1185250412 22:49798867-49798889 GCAAGGCACTGCTGTGGGCCAGG + Intronic
951764904 3:26186791-26186813 ACAAGCTCCTTCTATGGGCCAGG + Intergenic
953461084 3:43081592-43081614 ACAAGCTCCTGCTATGTGCCAGG + Intronic
953905545 3:46866699-46866721 ACCCTGTCCTGGAGTGGGCCCGG + Intronic
954148214 3:48644811-48644833 CCAAGGCCTTGCTGTGGGCCTGG - Exonic
954327579 3:49871937-49871959 ACCATGTCCAGCAGTGGGCAGGG + Intergenic
954674019 3:52305802-52305824 AAAAGTTCCTACAGTGTGCCAGG + Intergenic
955041873 3:55325364-55325386 ACAATGACCTGCTGTGTGCCAGG + Intergenic
956813336 3:72886207-72886229 ACAGGGTCCCACATTGGGCCAGG + Intergenic
960320649 3:116231534-116231556 TCAAGGTGCTTCAGTGGGCACGG + Intronic
960418125 3:117410190-117410212 CAAAGGTCCTGCTGTGGGACTGG + Intergenic
960615685 3:119593915-119593937 TCAAGGTCTTGGACTGGGCCCGG - Intergenic
961318488 3:126056619-126056641 ACAGCGTCCTGGTGTGGGCCAGG - Intronic
962918799 3:139933498-139933520 GCAAGGTCCTGGTGTCGGCCTGG + Intergenic
963698744 3:148597462-148597484 ACAAGGGCCTAGAGTGGTCCAGG - Intergenic
963748435 3:149149337-149149359 AAAAGCACCTGCAGTGGGACCGG - Intronic
964738468 3:159940944-159940966 ACTAGGGCCTGCAGTGGGGTGGG + Intergenic
968526803 4:1062675-1062697 TGAAAGTCCTGCAGTGGGACGGG + Intronic
969636062 4:8370177-8370199 ACAAGGCCCTGGGGTGGGCATGG + Intronic
969692269 4:8710238-8710260 ACTTGGCCCTCCAGTGGGCCGGG + Intergenic
975175233 4:71281220-71281242 TGAATATCCTGCAGTGGGCCTGG + Intronic
976038396 4:80852916-80852938 ACAATGTCCTGCACAGTGCCTGG - Intronic
977050974 4:92128429-92128451 ACCAGCACCTTCAGTGGGCCTGG + Intergenic
977685401 4:99841769-99841791 AAAATGCCCTGCAGTGGGCCAGG - Intronic
978080806 4:104589140-104589162 AAAGGATGCTGCAGTGGGCCTGG - Intergenic
979091708 4:116491794-116491816 TCTAGCTCCTGGAGTGGGCCTGG - Intergenic
980087158 4:128403432-128403454 AGAGGGACCTGCAGTGGGCAGGG + Intergenic
980103557 4:128565723-128565745 CCAGAGTCCAGCAGTGGGCCAGG + Intergenic
982157923 4:152539773-152539795 ACCAGCTGCTGCAGTGGGGCGGG + Intergenic
985014948 4:185623938-185623960 ACAAGGACCTGCTGCGCGCCTGG - Exonic
985782511 5:1878557-1878579 ACGAGGACCTGGAGAGGGCCCGG - Exonic
985904021 5:2819027-2819049 CCAAGCTCTGGCAGTGGGCCTGG + Intergenic
987043315 5:14083430-14083452 AATAGGACCTGCAGTGTGCCAGG - Intergenic
988637167 5:32996908-32996930 AGAAGGTCTTGGTGTGGGCCAGG + Intergenic
989375477 5:40755978-40756000 AGAAGGTCATGCAGTGGGGGCGG - Intergenic
990442452 5:55860341-55860363 ACAAGGTCTTGCTCTGGCCCAGG - Intronic
991601202 5:68352943-68352965 ACAAGGGCCTGCAGAGAACCTGG + Intergenic
995728016 5:115202834-115202856 ACAAGGGCCAGCAGTGTGCTGGG + Intergenic
997385073 5:133465989-133466011 ACATTTTCCTGCAGTGGGGCAGG + Intronic
997886925 5:137638550-137638572 CTCAGGTCATGCAGTGGGCCAGG - Intronic
997907635 5:137835365-137835387 TAAAGGTCCTGCACTGGGCCAGG + Intergenic
998469773 5:142374708-142374730 CCAAGGTCTTGCAAAGGGCCCGG - Intergenic
1001443562 5:171764549-171764571 AGAATGTCCTGCAGTGCACCTGG - Intergenic
1001550049 5:172596115-172596137 CCAAGCACCTGCTGTGGGCCAGG + Intergenic
1002083320 5:176750423-176750445 CCAAGGGCCTGCAGTGCTCCCGG - Intergenic
1002399046 5:178981079-178981101 GGAAGGGCCTGCAGTGGGCGCGG - Exonic
1002495071 5:179606287-179606309 ACAGGGCACTGCAGTGGGGCTGG - Intronic
1002563466 5:180097644-180097666 AGCAGGGCCTGCAGAGGGCCGGG + Intergenic
1002613750 5:180437550-180437572 ATAAGGGCCCGCTGTGGGCCTGG + Intergenic
1002966639 6:1972808-1972830 ACAAGACCTGGCAGTGGGCCTGG - Intronic
1003527270 6:6908853-6908875 ACAAGGTCTGGCTGTGGCCCAGG - Intergenic
1006629736 6:35422478-35422500 ACAAGGCTCTGCAGGAGGCCTGG - Intronic
1013206513 6:107951686-107951708 AAAAGTTCCCGAAGTGGGCCGGG + Intronic
1014845190 6:126267310-126267332 ACAGAGTCCTGCAATGTGCCAGG - Intergenic
1015399059 6:132768231-132768253 AAAAAGTCCTGGAGGGGGCCAGG + Intergenic
1015790211 6:136957987-136958009 ACCAGGGCCTGCACTGGGGCAGG - Intergenic
1015808292 6:137133980-137134002 ACAAGCAGCTGCAGTGGCCCTGG - Intergenic
1016606609 6:145936353-145936375 ACAAGGTCTTGCTGTTGCCCAGG + Intronic
1018007306 6:159634326-159634348 GCAAGCTCCTGAAGTGGGCCTGG + Intergenic
1018921501 6:168179158-168179180 ACCAGGTACTGCAGGGGCCCAGG - Intergenic
1019619226 7:1981546-1981568 ACAAGGTTCTGACTTGGGCCAGG - Intronic
1023054410 7:36279963-36279985 ACAGGCTCCAGCAGTGGGGCTGG + Intronic
1024698406 7:51880608-51880630 ACCAGGGCCTGCAGTGGGTGGGG - Intergenic
1026497022 7:70912215-70912237 ACAGGGCCCTGCTGTTGGCCAGG - Intergenic
1029516440 7:101026291-101026313 AGGAAGTCCTGCTGTGGGCCTGG + Intronic
1030587971 7:111445209-111445231 ACAATGTCCTGCAGTGTTCTTGG - Intronic
1032167629 7:129558178-129558200 ACACGTTTCTACAGTGGGCCGGG - Intergenic
1032979536 7:137265677-137265699 AGATGGTCCTCCAGTCGGCCAGG - Intronic
1035516810 8:240709-240731 ACAAGGACATGCAGTGGGTAGGG - Intronic
1036434415 8:8720174-8720196 GTCAAGTCCTGCAGTGGGCCCGG + Intergenic
1036684882 8:10903012-10903034 ACGGGGTCCTGAAGTGAGCCTGG - Intronic
1036749936 8:11437160-11437182 TCAAAGCCCTGCAGTGGGTCTGG - Intronic
1037604083 8:20422787-20422809 ATTAGTTCCTGCAGTGGCCCTGG + Intergenic
1037811590 8:22089756-22089778 ACAAGGTCCTGGAGTTGTCTGGG - Intronic
1038386249 8:27149412-27149434 ACATGCTCCTGCACTGGCCCAGG - Intergenic
1038645911 8:29361890-29361912 AGAAGTTCCTGCAAAGGGCCGGG - Intergenic
1045252705 8:100494957-100494979 CCCAGGCTCTGCAGTGGGCCAGG - Intergenic
1046395144 8:113631849-113631871 ACCAGCTGCTGCAGTGGGGCAGG + Intergenic
1047418671 8:124687301-124687323 CCAACCTCCTGCAGTGGTCCAGG - Intronic
1048019855 8:130528126-130528148 ACAGAGTCCTGCACTGGGCCAGG - Intergenic
1048766235 8:137847444-137847466 ACAAGTTACTGCAGGGGTCCGGG - Intergenic
1049212582 8:141393500-141393522 TCCAGGTCCAGCATTGGGCCTGG - Intronic
1049260559 8:141636779-141636801 ACCAGGTGCTGCAGTGGCGCTGG + Intergenic
1049303570 8:141884740-141884762 AGGAGGTCCGGCCGTGGGCCAGG - Intergenic
1049518834 8:143077949-143077971 ACTTGGTCCTGCAGTTGCCCAGG - Intergenic
1049571457 8:143372054-143372076 ACAGGCACCTGCTGTGGGCCTGG - Intronic
1049696517 8:143986639-143986661 ACCAGGGGCTGGAGTGGGCCAGG - Intronic
1049784295 8:144443256-144443278 ACACGGAGCTGCAGAGGGCCTGG - Exonic
1053433454 9:38059201-38059223 TCAAGGCCCGGCAGTGGGCCAGG + Intronic
1056654332 9:88496776-88496798 TCAAGGTCCTGCACAGGGCCGGG + Intergenic
1057190502 9:93084438-93084460 CCCAGGCCCTCCAGTGGGCCTGG - Intronic
1057201365 9:93142112-93142134 ACAAGAGCCTGCAGTGGGGTGGG + Intergenic
1057613613 9:96568496-96568518 ATAAGGTGCTGCAGTGTGTCGGG + Intronic
1058744493 9:107976683-107976705 AAAAGTTCTTGCAGTGGTCCAGG + Intergenic
1059798329 9:117724227-117724249 ACAAGGGCCTGCAGCAGGCAAGG - Intergenic
1060188809 9:121579491-121579513 ACTTGGTCCTGCAGTGGGCAGGG - Intronic
1060779417 9:126400594-126400616 TCAGGGCCCTGCAGTGGGCAGGG + Intronic
1061027960 9:128062846-128062868 ACAAGGGCCTGCGCTGTGCCTGG + Exonic
1061498837 9:130990872-130990894 ACAAGGGGCTGCAGTGGGGAGGG + Intergenic
1061805019 9:133133057-133133079 GCAAGGCCCTGCAGAGGGCCTGG - Intronic
1061864713 9:133486189-133486211 CCAAGGTCCTGCAGCCAGCCTGG - Intergenic
1062026117 9:134341580-134341602 CCAAGGTCCTGGCCTGGGCCAGG - Intronic
1062036036 9:134382982-134383004 AGAAGGGGCTGCAGTGGGACTGG + Intronic
1062289025 9:135786339-135786361 GCAAGAGCCTGCAGTGGGCCCGG + Exonic
1062662449 9:137645211-137645233 TCAAGGCCCTGAAGTGTGCCAGG - Intronic
1186247767 X:7632096-7632118 CCAAGGCCCAGGAGTGGGCCTGG + Intergenic
1186908533 X:14137046-14137068 ACAGGTTACTGCAGTGGTCCAGG + Intergenic
1187612302 X:20955647-20955669 CCAAGGTCCTGCAGGTGCCCTGG + Intergenic
1189334673 X:40163726-40163748 AAAAGGTGATGCAGCGGGCCAGG + Intronic
1193689355 X:84622067-84622089 CCAAGGTCCAGAAGTGGACCTGG - Intergenic
1195094977 X:101493519-101493541 GGAAGGTCCTGGATTGGGCCTGG + Exonic
1196443788 X:115735156-115735178 ACAGGGTCCCGCAGTGGGCCAGG + Intergenic
1197166036 X:123378705-123378727 AAAAGGTCCTCAAGTTGGCCAGG - Intronic
1197722586 X:129755357-129755379 TCAAGTACCTGTAGTGGGCCAGG - Exonic
1197745058 X:129927087-129927109 AAAGGGTGCTTCAGTGGGCCAGG + Intronic
1198396737 X:136226790-136226812 ACAATGACCTGCAGTGGTACTGG + Intronic
1200907638 Y:8500800-8500822 AAAGGGTCATGCAGTGGCCCAGG + Intergenic