ID: 912698881

View in Genome Browser
Species Human (GRCh38)
Location 1:111861536-111861558
Sequence CAGGAACAAGGTCCTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698881_912698897 24 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698881_912698892 7 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698881_912698890 0 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698890 1:111861559-111861581 TGTTTACGGAGGGAAGCGGGTGG No data
912698881_912698888 -4 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data
912698881_912698893 8 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698881_912698896 18 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698881_912698886 -10 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698886 1:111861549-111861571 CTTGTTCCTGTGTTTACGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 106
912698881_912698894 9 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698881_912698889 -3 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698881_912698891 4 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698891 1:111861563-111861585 TACGGAGGGAAGCGGGTGGCAGG No data
912698881_912698895 10 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698881 Original CRISPR CAGGAACAAGGTCCTGCAGT GGG (reversed) Intronic
902374930 1:16026216-16026238 CAGGAACAGGGTGCTGCCGGTGG - Exonic
903065186 1:20695715-20695737 CAAGCACAAGGTCCTGGAGCTGG - Intronic
904995367 1:34627453-34627475 CAGGAACAAAGTCCTTGAGAAGG + Intergenic
906854797 1:49292580-49292602 CAGAGACGAGGTCCTGTAGTGGG - Intronic
909271269 1:73626845-73626867 CAGGAGCTAGGTCCTGGAATGGG - Intergenic
910102530 1:83594039-83594061 CAGGAGCAAGGTCCTAGAATGGG + Intergenic
910281680 1:85508431-85508453 GATGAACCAGGTACTGCAGTTGG - Intronic
911664506 1:100538560-100538582 CTGGAACTAGGTCCTCCAGCTGG + Intronic
912045149 1:105444535-105444557 CTGGAACAAGGTTCTCCAGAAGG + Intergenic
912698881 1:111861536-111861558 CAGGAACAAGGTCCTGCAGTGGG - Intronic
913508475 1:119540958-119540980 CTCTAAGAAGGTCCTGCAGTGGG - Intergenic
917138990 1:171815789-171815811 CAGTAACAAGGTTTTTCAGTAGG + Intergenic
918203797 1:182291400-182291422 CAGGAGCCTGCTCCTGCAGTTGG - Intergenic
918854182 1:189729595-189729617 CAGGAGCAAAGACCTGGAGTCGG + Intergenic
919642239 1:200056997-200057019 CAGGAACAAGGGCTTGCTCTTGG - Intronic
920261654 1:204692483-204692505 CATGAGCAAGGCCCTCCAGTGGG - Intergenic
921748767 1:218768323-218768345 CAGGAACAAGGTCATAGAGCTGG + Intergenic
922482738 1:225950501-225950523 CAGGAGCAGGTTCCTGCAGATGG - Intergenic
924517579 1:244779509-244779531 TAGGCATAGGGTCCTGCAGTGGG + Intergenic
1067234526 10:44436806-44436828 CAGGAACAAGGTCCTGAGGCAGG - Intergenic
1068118670 10:52762140-52762162 CAGTGACAAAGTCCTGCTGTGGG + Intergenic
1070597389 10:77842132-77842154 GCAGAACAAGGACCTGCAGTGGG - Exonic
1070599281 10:77854426-77854448 GAGGAACCAGGTCCTGGATTAGG + Intronic
1071849705 10:89556559-89556581 CAGGAAAAAGTTCCTGCCTTGGG - Intronic
1072374541 10:94801050-94801072 GATGAACAAGGTACCGCAGTTGG + Intronic
1072768299 10:98114533-98114555 AATGAACAGGGTCCTGCTGTGGG + Intergenic
1075271437 10:121055090-121055112 CAGGAACACCATGCTGCAGTTGG - Intergenic
1076166286 10:128285159-128285181 CAGGAAGAGGGTCCTGCAGAGGG + Intergenic
1076669030 10:132109456-132109478 CAGGAACAAGGGCAGGCAGCCGG - Intronic
1079121133 11:17686021-17686043 CAGGAAAAGAGTCCTGCAGTAGG + Intergenic
1080305251 11:30828195-30828217 CAGGAGCAAAGTCCTGAGGTGGG - Intergenic
1080908809 11:36574599-36574621 CAGGAACAAGGTCATGCACACGG - Exonic
1081999912 11:47388595-47388617 TAGGAACAAGGGCATGCAGCTGG + Intergenic
1084710471 11:70840786-70840808 CAGGGACAAGGAACTGCAGTGGG + Intronic
1088813179 11:113405123-113405145 CAGGAAGAAGGGCCTGGGGTTGG - Intergenic
1090184846 11:124730819-124730841 CAGCAAGAAGGTCCTGCACTTGG - Intergenic
1090478521 11:127046893-127046915 CAGGAACTAGGGCCCACAGTAGG + Intergenic
1091123365 11:133075380-133075402 CTGGGACAAGGTGCTGCAGCAGG + Intronic
1091656400 12:2349626-2349648 CAGGAGGAAGGTACTGCAGAGGG + Intronic
1092709754 12:11323292-11323314 CAGGAGCAAGGTCATGCTGAAGG + Intergenic
1093259496 12:16917824-16917846 CAGGAACCAAGTCCTGGAATTGG + Intergenic
1095174307 12:39073355-39073377 CAGGAACACATCCCTGCAGTTGG - Intergenic
1095372877 12:41490776-41490798 CTGGAACAAGGTCCTCTACTTGG + Intronic
1096193470 12:49634446-49634468 GAGGGACAAGGTGCTGGAGTGGG + Exonic
1097425983 12:59445540-59445562 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1097753673 12:63385599-63385621 CTGGAACAAGGTTCTTCAGGAGG - Intergenic
1098333908 12:69382326-69382348 CAGGAGCCAGGGCCTGGAGTTGG + Intronic
1098853810 12:75629457-75629479 CAAGGCCAAGTTCCTGCAGTGGG - Intergenic
1101552315 12:105774208-105774230 CAGGAATCAAGTCCTGCACTTGG + Intergenic
1102824908 12:115940907-115940929 ACGGAACAAGGTTCTGTAGTAGG - Intergenic
1106738227 13:32610004-32610026 CTGGAGCAATGTCCTGCAGTAGG + Intronic
1107098343 13:36560694-36560716 CTGGAACATGGCCCTGCACTGGG + Intergenic
1107805845 13:44153261-44153283 CACAAACAGGGCCCTGCAGTGGG - Intronic
1110508882 13:76325090-76325112 CAGTAACAAGGGCCTGGACTAGG - Intergenic
1113396131 13:109949487-109949509 GAAGAACAAGTTCCTGCATTTGG + Intergenic
1115094580 14:29619456-29619478 CAGGAACAATTTCTGGCAGTGGG + Intronic
1115312480 14:31993443-31993465 CAGCAAAAAGGCCCTGCAGCTGG + Intergenic
1116413270 14:44650136-44650158 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1117434930 14:55706841-55706863 CAGGCACAAGCTCCTGCATCTGG + Intergenic
1118568965 14:67173237-67173259 CAGGAACCCGGTGCTGCAGTAGG + Intronic
1119297258 14:73543047-73543069 CAGGTAAAAGGTCCAGGAGTTGG + Exonic
1119301489 14:73574905-73574927 CAGGTAAAAGGTCCAGGAGTTGG + Exonic
1124417499 15:29485333-29485355 CAGGGGCCAGGTCCTGCACTGGG - Intronic
1124865619 15:33487675-33487697 CAGGAACAACGGCCTGATGTAGG - Intronic
1125854612 15:42936913-42936935 CAGTAAGAAAGTGCTGCAGTGGG + Intergenic
1129030663 15:72615504-72615526 CAGGAGCTAGGTCCTGGAATGGG + Intergenic
1129472960 15:75765368-75765390 CAGGAACTAAGTCCTGGAGGAGG - Intergenic
1129477509 15:75796019-75796041 CAGGAGCTAGGTCCTGGAATGGG + Intergenic
1129642357 15:77393477-77393499 CAGGAACTAGGGCCTGGAATAGG - Intronic
1129642465 15:77394142-77394164 CAGGAGCCAGGGCCTGGAGTTGG - Intronic
1132471213 16:104419-104441 CAGGAACAAGTTCCAGCTATGGG + Intronic
1132593598 16:737836-737858 CAGGAACAAGGTGTTCCAGTCGG + Intronic
1134322513 16:13176582-13176604 CAGGAACACGGACCCACAGTGGG + Intronic
1134407087 16:13970099-13970121 CAGGAACTAGGACCTGGAATGGG + Intergenic
1135937859 16:26796338-26796360 CAGGAGGAAGGTTCTGCAGCAGG + Intergenic
1136332264 16:29588001-29588023 CAGGCACAAGCTACTGCACTGGG - Intergenic
1136446959 16:30328070-30328092 CAGGCACAAGCTACTGCACTGGG - Intergenic
1138383256 16:56618119-56618141 GAGGAAGAAGGTACAGCAGTGGG - Intergenic
1139119325 16:63996849-63996871 CAGGACCCAGATCCTACAGTTGG + Intergenic
1139513907 16:67442331-67442353 CAGGAACATGGATCCGCAGTGGG - Intronic
1139633162 16:68242927-68242949 CAGGAACGAGGGCGTGCATTGGG + Intergenic
1140522949 16:75597922-75597944 CAGGAACAAGGTCACACAGCAGG - Intronic
1140901587 16:79372870-79372892 CAGGCTGAAGGTCCTGCAGTGGG - Intergenic
1140954235 16:79847381-79847403 CAGCAAAATGGTCCTGCACTGGG + Intergenic
1141301203 16:82817174-82817196 AAGGAACAGGTACCTGCAGTGGG - Intronic
1141657017 16:85421859-85421881 TAGGAAAAAGGCCCTGAAGTCGG - Intergenic
1144588253 17:16502054-16502076 CTGCAACAGGGTCTTGCAGTAGG - Intergenic
1144685381 17:17222735-17222757 CAGGAGTCAGGTCCTGGAGTTGG - Intronic
1146676982 17:34780519-34780541 CAGAAACAAGGTCCAGCACTTGG + Intergenic
1147137045 17:38440543-38440565 CTTGACCAAGGTCATGCAGTTGG + Intronic
1148544116 17:48503888-48503910 CAGGCTCAAGCTGCTGCAGTGGG - Intergenic
1150637640 17:66926548-66926570 CTTGCACAAGGTCCTACAGTTGG - Intergenic
1153354643 18:4121713-4121735 CTGCAACAGGGTCTTGCAGTAGG - Intronic
1153469908 18:5432427-5432449 CAGGAACAATGTCATCCTGTTGG + Intronic
1154235959 18:12605963-12605985 CAAGCACAAAGGCCTGCAGTGGG - Intronic
1155443481 18:25885556-25885578 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1156259157 18:35428598-35428620 CAGGAGCAAGGTCATGCTGGAGG - Intergenic
1158481208 18:57823514-57823536 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1159225089 18:65523294-65523316 CAGGAACTAGGGCCTGCAATGGG - Intergenic
1161302835 19:3551326-3551348 CAGGAGCGAGGGTCTGCAGTCGG + Intronic
1162218017 19:9152380-9152402 TAGGAACAAGGCCCTGCCGCAGG + Intronic
1163722738 19:18905953-18905975 CAGGAACAAGGCCCTAGAGGAGG + Intronic
1163738042 19:18993837-18993859 CAGGCCCAAGGCCCTGCAGAAGG + Exonic
1165316078 19:35056127-35056149 CAAGAACAAAGACCTGCAGGAGG - Intronic
1166899098 19:46044487-46044509 CAGGACCAAGTTCCTGGGGTGGG + Intronic
1168111388 19:54193236-54193258 CAGCAACCAGGTCTTGGAGTGGG - Exonic
925027265 2:619957-619979 CAGGAAGAGGGGCCTGCAGCAGG + Intergenic
925723388 2:6849888-6849910 CAGAGAAAAGGTCCTGCAGACGG - Exonic
925962024 2:9026750-9026772 CAGGATCAAGGTCCAGGAGAAGG + Intergenic
926156488 2:10457169-10457191 CAATCACAAGGTCCTGCAATAGG + Intergenic
927169599 2:20357828-20357850 CTGGAACCAGCTGCTGCAGTTGG - Intergenic
927213425 2:20652353-20652375 CATGAACACGGCCCTGCAGACGG - Intergenic
927852645 2:26510095-26510117 CAGGAGAAGGGTCCTGCAGGTGG - Intronic
930288886 2:49468261-49468283 CAGGAACTAGGGCCTGGAATGGG + Intergenic
930494257 2:52119414-52119436 GAGGAACAAGGTCCTGGAGAAGG - Intergenic
931555532 2:63499587-63499609 CAGTAACAAGGACCTGAATTGGG + Intronic
931839652 2:66135159-66135181 GAGGAACAAGGCCCAGCTGTGGG - Intergenic
932730908 2:74221482-74221504 CAGGAAAAAGATCTTCCAGTTGG - Exonic
932839965 2:75072801-75072823 GAGGAAAAAAGTCCTGAAGTTGG - Intronic
932991413 2:76792717-76792739 CAGGAAAAATGTACTGAAGTAGG - Intronic
933188269 2:79303233-79303255 CAGGATCCACGTCCTGAAGTGGG + Intronic
933396081 2:81733048-81733070 CAGGAGGAAGTACCTGCAGTGGG + Intergenic
936096732 2:109536023-109536045 CAGGCAGAAGTTGCTGCAGTGGG + Intergenic
937321957 2:120966391-120966413 CTGGAACAGTGGCCTGCAGTGGG - Intronic
938378862 2:130825594-130825616 GAGGGAGAAGGTCCTGCCGTGGG + Intergenic
938619223 2:133031814-133031836 TGGGAACTAGGTCCTGAAGTGGG - Intronic
938713109 2:133992531-133992553 CAGGAAACAGATCCTTCAGTGGG + Intergenic
942080068 2:172391843-172391865 CATGAAGAAGGCCCTGCACTGGG + Intergenic
942972301 2:181971362-181971384 CAGGAGCTAGGTCCTGGAATGGG + Intronic
943012280 2:182464294-182464316 CTGCAACAGGGTCTTGCAGTGGG + Intronic
943487582 2:188505929-188505951 CATTAATAAGGTCATGCAGTTGG - Intronic
944352596 2:198746366-198746388 CAGGGCCAGGGTCCTGCTGTGGG - Intergenic
944529464 2:200653051-200653073 CTGGCTCAAGGTCCTGCAGCTGG + Intronic
947083093 2:226420532-226420554 CAGCAAAAAGGTACAGCAGTGGG - Intergenic
948695083 2:239729311-239729333 CAGGCCCCAGGTCCTGCAGGAGG - Intergenic
1168736430 20:142721-142743 CTGGAACAGGGTCCTGCACATGG + Intronic
1172110024 20:32539091-32539113 CTGGAACAAAGCCCTGCAGCTGG - Intronic
1172184721 20:33024183-33024205 CAGGGACAAGGTCCAGCTCTGGG - Intergenic
1173559409 20:43992154-43992176 CAGCACCAAGGCCCCGCAGTGGG + Intronic
1175502410 20:59459951-59459973 GAGGAAGGAGGTCCTGCAGCAGG - Intergenic
1175571562 20:60026616-60026638 CACAAACAAGGACCTGCATTTGG + Intronic
1175788390 20:61726081-61726103 CACGACCAGGGCCCTGCAGTGGG + Intronic
1178854579 21:36239755-36239777 GACAAACAAGGACCTGCAGTGGG - Exonic
1181016398 22:20071561-20071583 CAGGAATGAGATTCTGCAGTGGG + Intergenic
1182176516 22:28295187-28295209 CAGGAACATGGTCAGGCACTAGG - Intronic
1182715300 22:32353152-32353174 CAGGAACTAGGGCCTGGAGTGGG + Intergenic
1184601381 22:45545618-45545640 CAAGAACTCGGTCCTGCACTGGG + Intronic
1185328457 22:50239630-50239652 CAGGAAAAAGCTGCTGCAGCTGG + Intronic
949919944 3:8992791-8992813 GGGGAACAAGGGGCTGCAGTAGG + Intronic
951122174 3:18942137-18942159 CAATCACAAGGTCCTGCAATAGG - Intergenic
953495046 3:43378668-43378690 CAGGAACAGGGCCCTGCTCTGGG - Intronic
953905869 3:46868020-46868042 CAGGTACAAGGACCAGCAGAAGG + Intronic
954389962 3:50263610-50263632 CAGGGACACGGTCCTGCAGAGGG + Intergenic
955142943 3:56287721-56287743 TAGGAACAAGGTACTTCAATCGG + Intronic
956271086 3:67447571-67447593 CAGGAACAAGATACTTCAGGAGG + Intronic
960490708 3:118313896-118313918 CAGGAACAAGGACCTGGAATGGG - Intergenic
962953486 3:140242968-140242990 CAGGAACAAGGAACAGCAGCAGG - Intronic
964258864 3:154811220-154811242 CAGGAGCCAGGACCTGGAGTTGG + Intergenic
965813379 3:172614130-172614152 CAGGGAGAAGGTCCTAGAGTGGG + Intergenic
966405446 3:179592720-179592742 CAGGCACAAGTTCAAGCAGTGGG - Exonic
966491043 3:180529175-180529197 CAGGAATCAAGTCCTGGAGTTGG - Intergenic
968612360 4:1563092-1563114 CAGGGACAAGGACCTGGAGAGGG + Intergenic
969636061 4:8370172-8370194 CAGGCACAAGGCCCTGGGGTGGG + Intronic
970377639 4:15475398-15475420 CAGGATCAAGGGCCTGGAGGAGG + Intronic
970497595 4:16642609-16642631 GAGGAACAGGGTCCTGAAGCTGG - Intronic
971053328 4:22885689-22885711 CAGGCAGAAGGTTCTGCAGTTGG - Intergenic
973169401 4:47120770-47120792 CAGGAGCTAGGGTCTGCAGTGGG + Intronic
975179987 4:71333655-71333677 CAGGAACCAGGGCCTGGAGCCGG + Intronic
976272897 4:83248388-83248410 CAGAAACAGGGTCCTGGAGCTGG - Intergenic
979111351 4:116761703-116761725 CAGGAACTAGGGCCTGAAATGGG - Intergenic
979395109 4:120178285-120178307 CAGGAGCCAGGGTCTGCAGTTGG - Intergenic
979852906 4:125595258-125595280 CAGTCACAGGGGCCTGCAGTAGG + Intergenic
985384784 4:189434155-189434177 CAGGAGGAAGGGCCTGCAATGGG + Intergenic
985727879 5:1525169-1525191 CAGGAATAAGGCCATGCAGCGGG - Intergenic
985839437 5:2295168-2295190 CAGTAAGAAGGTCATGCTGTCGG + Intergenic
985850316 5:2383788-2383810 CAGGCTCTGGGTCCTGCAGTAGG + Intergenic
985924976 5:3008848-3008870 CAGCAACAAGGTCTTGCTGAGGG - Intergenic
986280976 5:6322146-6322168 TAGGAACACAGTCTTGCAGTGGG + Intergenic
986548401 5:8924770-8924792 CAGGAGCCAGGACCTGGAGTTGG - Intergenic
986756272 5:10839566-10839588 CAGGAGCCAGGTCCTGGAATAGG - Intergenic
987163932 5:15174152-15174174 CAGGAACTAGGACCTGGAATAGG - Intergenic
987224033 5:15821016-15821038 CAGGAAGACAGTACTGCAGTAGG - Intronic
988672411 5:33396170-33396192 TGGCAACAAGGTCATGCAGTAGG + Intergenic
988931704 5:36041247-36041269 CAGGAACTGGGTCCTGGAATTGG - Intronic
991511096 5:67376903-67376925 GAAGAAGAAGGTCCTACAGTAGG - Intergenic
992139282 5:73779871-73779893 TAGGAACAATGCCCTGCAGCTGG - Intronic
993246789 5:85461457-85461479 CAGGAATTTGGGCCTGCAGTTGG - Intergenic
993981221 5:94545561-94545583 TAGGAACTAGGTCCTGGAATAGG - Intronic
998162496 5:139821530-139821552 CAGGGACAGGGTCCGGCTGTAGG + Intronic
1000642163 5:163715800-163715822 GAGGATCAAGGTACTGCTGTGGG + Intergenic
1002090477 5:176802673-176802695 CAGGACCACGGTCATGCAGCGGG + Intergenic
1002093027 5:176815837-176815859 CAGGCCCAAGTCCCTGCAGTGGG - Intronic
1002280556 5:178127555-178127577 CAGGCACACAGTCCTGCTGTGGG + Intergenic
1003558110 6:7158493-7158515 CAGGAGCCAGGTCCTGCTGAAGG - Intronic
1004638614 6:17492406-17492428 CAGGAACATGGAACTGCAGCTGG + Intronic
1005037333 6:21569191-21569213 CAGGATCCAGGTCCCGAAGTTGG + Intergenic
1005836229 6:29711459-29711481 CAGGAAGGAGGTCCTATAGTTGG + Intergenic
1007925835 6:45648964-45648986 CAGGAACCAGGTCTGGCAGGTGG + Intronic
1011779604 6:90772076-90772098 CTGCAACAGGGTCTTGCAGTTGG - Intergenic
1012589920 6:100968804-100968826 CAGGAACCAGGTACCTCAGTTGG - Intergenic
1016021206 6:139237855-139237877 CAGGAAGAAGGACTTGCATTTGG + Intergenic
1017283390 6:152647182-152647204 ATGGAAAAAGGTCCTGCAGTGGG - Intergenic
1017990177 6:159480916-159480938 CAGGAAGATGGACCTGCAATAGG - Intergenic
1021287984 7:18805968-18805990 CAGGATCAGGGACCAGCAGTGGG - Intronic
1021561354 7:21971797-21971819 CAGAAACAAGGCCCTGGAGAGGG + Intergenic
1021895060 7:25225733-25225755 CACTAATAAGGTCCTGCAGAGGG - Intronic
1023689310 7:42769922-42769944 CAGGAATGATGTCCTCCAGTGGG + Intergenic
1023716317 7:43047480-43047502 TGGGAACAAGGGCCTGGAGTCGG - Intergenic
1023802179 7:43844732-43844754 CAGGAAGACTGTCCTGGAGTTGG + Intergenic
1024109397 7:46130043-46130065 GAGGTACAGGGTCCTGTAGTAGG + Intergenic
1024698409 7:51880613-51880635 CATGCACCAGGGCCTGCAGTGGG - Intergenic
1026334707 7:69383704-69383726 CAGGAGCAAGAGCCTGAAGTGGG - Intergenic
1026968710 7:74455113-74455135 CAGGACCAAGGTCCTGCGGTGGG + Intronic
1027187680 7:75981670-75981692 CTGGAACAAGGGCTGGCAGTGGG + Intronic
1027799351 7:82732714-82732736 CAGGAGCAACGTCCTGGAATGGG - Intergenic
1028266618 7:88733799-88733821 CAGGAGCAAGGGCCTGGAATGGG + Intergenic
1030460388 7:109827782-109827804 CAATAACAAGGTCCTGCAATAGG + Intergenic
1030653435 7:112140293-112140315 GAAGAACAAGGTCCTGCAGGTGG - Intronic
1031337640 7:120555429-120555451 CAGGGACATGCTCCTGCAATTGG + Intronic
1031975112 7:128088814-128088836 CTGGAGCAAGGTCCTGCTGGAGG + Intronic
1032155878 7:129467381-129467403 CAGGATCAAGGGGATGCAGTTGG - Exonic
1032375177 7:131407656-131407678 CAGGAAAAGGGTCTGGCAGTTGG - Intronic
1033063304 7:138128617-138128639 CAGGAGCAAGGGAGTGCAGTGGG + Intergenic
1034516507 7:151584821-151584843 CAGGAACTGGGGGCTGCAGTGGG + Intronic
1034540789 7:151756649-151756671 CTGGAACCAGGAGCTGCAGTTGG - Intronic
1034581713 7:152049753-152049775 CTGGAGCCAGGTCCTGGAGTTGG + Intronic
1035332899 7:158107886-158107908 CAGGTACATGGGCCTGCTGTGGG - Intronic
1036918585 8:12830112-12830134 CAGGCAAAATGTCCTTCAGTGGG - Intergenic
1036941405 8:13056146-13056168 CAGGAACTGGGTCCTACTGTTGG - Intergenic
1037589794 8:20303323-20303345 CAGGAAGAGGGTCCGGCGGTCGG - Intronic
1037623039 8:20583862-20583884 CTGCAACAAAGTCTTGCAGTAGG + Intergenic
1037988103 8:23302208-23302230 CAGGAAGAGGGTGCGGCAGTGGG - Intronic
1039822384 8:41145516-41145538 CAGGAACAAACTCCCGAAGTAGG - Intergenic
1039841153 8:41294063-41294085 CAGGAACAGGGTCCTCCATATGG + Intronic
1040550126 8:48431200-48431222 CAGGAGGAAGCTGCTGCAGTGGG - Intergenic
1042054644 8:64750966-64750988 CAGCAAGAAGATCCAGCAGTTGG - Intronic
1042180100 8:66079267-66079289 CAGGTACTAAGTCCTTCAGTAGG + Intronic
1042784886 8:72536673-72536695 CAGGGTCAGGGTCCTGCTGTGGG + Intergenic
1042980321 8:74519193-74519215 CAGGAGCCAGGACCTGGAGTTGG - Intergenic
1044935027 8:97285704-97285726 CAGGTACAGGGTCATGCAGGTGG + Intergenic
1045412903 8:101936860-101936882 AAGAGACAAGGTCCTGCAGGAGG - Intronic
1045733474 8:105267782-105267804 CAGGAACTAGGGCCTGGAATGGG + Intronic
1048029950 8:130621573-130621595 CAGGAACTAGGGCCTGGAATGGG + Intergenic
1048265898 8:132985688-132985710 CAGGAAGCAGGTGCTGCAGAGGG - Intronic
1049322968 8:142006923-142006945 CAGGCCCCAGGTCCTGCAGCTGG + Intergenic
1050949255 9:11567100-11567122 CAGGAGCTAGGTCCTGGAATGGG + Intergenic
1051505810 9:17826533-17826555 CAATCACAAGGTCCTACAGTAGG + Intergenic
1052469367 9:28874895-28874917 CAGAAACAAGGACCTGTAGTGGG - Intergenic
1055435794 9:76290820-76290842 CAAGGTCAAGGTCCTGGAGTGGG + Intronic
1055544493 9:77354947-77354969 CTGGAACAATGTCCTCAAGTAGG - Intronic
1056326788 9:85486733-85486755 CAGCAACAAGGGCCTGGAGAAGG + Intergenic
1058537556 9:105977829-105977851 CTGGAACAGGGTCTTGCAGTAGG + Intergenic
1058778434 9:108309123-108309145 AAGGAACAAGGAACTGCATTTGG + Intergenic
1058820958 9:108728860-108728882 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1059449242 9:114359924-114359946 CAGGCACAAGGAGCTGCAGATGG - Exonic
1059798330 9:117724232-117724254 CAGAGACAAGGGCCTGCAGCAGG - Intergenic
1059841857 9:118226356-118226378 CTGGAACAAGGACCAGCATTTGG + Intergenic
1060185598 9:121562209-121562231 CTGGAACAGGATCATGCAGTGGG + Intergenic
1062259346 9:135652575-135652597 CAATCACAAGGTCCTACAGTAGG + Intergenic
1062424024 9:136497857-136497879 CAGGGAAGAGGGCCTGCAGTTGG - Intronic
1186691748 X:11985250-11985272 CAGGAACTAGGGCCTGGAATGGG - Intergenic
1186858851 X:13651790-13651812 CTGCAACAGGGTCTTGCAGTGGG - Intergenic
1188192021 X:27182911-27182933 CAGGAGCCAGGTCCTGGAGTTGG - Intergenic
1188258156 X:27987777-27987799 CAGGATCTAGGTCCTTCAGATGG - Intergenic
1188578946 X:31687018-31687040 CAGGAACTAGGGCCTGGAATGGG - Intronic
1188859835 X:35243867-35243889 CAGAGAGAAGGCCCTGCAGTTGG + Intergenic
1191786483 X:64921969-64921991 CAGGAACAAGACCCTGCAGATGG - Exonic
1193463430 X:81817746-81817768 CAGGAGCCAGGGCCTGGAGTTGG + Intergenic
1196018872 X:110968228-110968250 CAGCAAAAATGTCCTGCAATTGG - Intronic
1196443787 X:115735151-115735173 CAAGGACAGGGTCCCGCAGTGGG + Intergenic
1197582281 X:128298708-128298730 CAGGAACAAGTTCTGGCACTTGG - Intergenic
1198996705 X:142580759-142580781 CAGGAGCTAGGTCCTGGAATGGG + Intergenic
1199928647 X:152495632-152495654 CTGGAACAAGGGCCTACAATTGG + Intergenic
1202054790 Y:20818566-20818588 GATGAACAAGGTCCTTCAGTTGG - Intergenic
1202137554 Y:21682697-21682719 CAGAGAGAAGGCCCTGCAGTGGG + Intergenic