ID: 912698882

View in Genome Browser
Species Human (GRCh38)
Location 1:111861537-111861559
Sequence ACAGGAACAAGGTCCTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698882_912698889 -4 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698882_912698891 3 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698891 1:111861563-111861585 TACGGAGGGAAGCGGGTGGCAGG No data
912698882_912698890 -1 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698890 1:111861559-111861581 TGTTTACGGAGGGAAGCGGGTGG No data
912698882_912698892 6 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698882_912698894 8 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698882_912698888 -5 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data
912698882_912698897 23 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698882_912698893 7 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698882_912698896 17 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698882_912698895 9 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698882 Original CRISPR ACAGGAACAAGGTCCTGCAG TGG (reversed) Intronic
No off target data available for this crispr