ID: 912698888

View in Genome Browser
Species Human (GRCh38)
Location 1:111861555-111861577
Sequence CCTGTGTTTACGGAGGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698882_912698888 -5 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data
912698881_912698888 -4 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data
912698880_912698888 1 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data
912698879_912698888 2 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698888 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698888 Original CRISPR CCTGTGTTTACGGAGGGAAG CGG Intronic
No off target data available for this crispr