ID: 912698889

View in Genome Browser
Species Human (GRCh38)
Location 1:111861556-111861578
Sequence CTGTGTTTACGGAGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698881_912698889 -3 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698880_912698889 2 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698882_912698889 -4 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133
912698879_912698889 3 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698889 Original CRISPR CTGTGTTTACGGAGGGAAGC GGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907434161 1:54433438-54433460 CTGTCTCTACGGAGGAAAGCTGG - Intergenic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG + Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
924881504 1:248166089-248166111 CTGTATTTACCGAGGGATCCTGG - Intergenic
924884201 1:248194922-248194944 CTGTATTTACCGAGGGATACCGG - Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069838135 10:71322149-71322171 CTGTCTCTAAGGAGGGAAACTGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1076493548 10:130880898-130880920 ATGTGTTTACCGAGGGAAATTGG - Intergenic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG + Intronic
1077597560 11:3547049-3547071 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1085406034 11:76262795-76262817 CTATGTATACGGAGAGATGCAGG - Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1092423736 12:8356343-8356365 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
1096838120 12:54364153-54364175 CTGGGTTTACTGAGAGCAGCGGG - Exonic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG + Intergenic
1098899655 12:76099812-76099834 CTTTGTTTAAAGGGGGAAGCTGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1104212625 12:126704425-126704447 CTTTGTTTACATAGGGAAGAGGG - Intergenic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG + Intronic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112899355 13:104340042-104340064 TTGTGTATACAGAGGCAAGCAGG - Intergenic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135421634 16:22309065-22309087 CTGTGTGAACGCAGGGAAACCGG - Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1137501127 16:49012612-49012634 ATGTCTTTAAGGAGAGAAGCAGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
933902205 2:86858166-86858188 CTGTGTTTCGGGATGCAAGCCGG - Exonic
935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG + Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
945527989 2:210912697-210912719 CTGTGTTGTCGGAGGGACCCAGG + Intergenic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1175462709 20:59165126-59165148 CTGTGCTTCCGCTGGGAAGCTGG + Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1180476090 22:15708991-15709013 TTCTGTTTAGGGAGGGAACCAGG + Intronic
1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG + Intronic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
957067726 3:75539422-75539444 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG + Intergenic
969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG + Intergenic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983900601 4:173129238-173129260 GTGTGTTCACGGATGGAAGATGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1010641012 6:78327297-78327319 ATGTATTTAAGGAGGGAAACAGG - Intergenic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1018793167 6:167165531-167165553 CTGTCTTTGCTGATGGAAGCTGG - Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036197499 8:6733200-6733222 CTTTGTCTCCGGAGGGAACCAGG - Intronic
1036246982 8:7126291-7126313 CTGTGTTTAAGGTGAGAAGGGGG + Intergenic
1036253816 8:7188078-7188100 CTGTGTTTAAGGTGAGAAGTTGG - Intergenic
1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG + Intergenic
1036577904 8:10045437-10045459 GTGTCTTTCAGGAGGGAAGCGGG + Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037843341 8:22261311-22261333 CTGAGATTGCTGAGGGAAGCAGG - Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1186442379 X:9597311-9597333 CTGGGTTTAAGGAGAGCAGCAGG - Intronic
1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG + Intergenic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic