ID: 912698892

View in Genome Browser
Species Human (GRCh38)
Location 1:111861566-111861588
Sequence GGAGGGAAGCGGGTGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1871
Summary {0: 1, 1: 1, 2: 9, 3: 194, 4: 1666}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698879_912698892 13 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698882_912698892 6 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698884_912698892 -5 Left 912698884 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698881_912698892 7 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666
912698880_912698892 12 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG 0: 1
1: 1
2: 9
3: 194
4: 1666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698892 Original CRISPR GGAGGGAAGCGGGTGGCAGG AGG Intronic
900264999 1:1753024-1753046 GGAGGGGAGCGGGTAGCATGAGG + Exonic
900391712 1:2436566-2436588 GGAGGGAGGAGGGAGGAAGGAGG - Intronic
900395243 1:2450707-2450729 GGCGGGGAGCGGGGGGCAGGCGG - Intronic
900395252 1:2450725-2450747 GGCGGGGAGCGGGGGGTAGGCGG - Intronic
900409132 1:2504932-2504954 GCTGGGGAGGGGGTGGCAGGGGG + Exonic
900477474 1:2882675-2882697 GGATGTGAGCGGGTGTCAGGTGG + Intergenic
900490729 1:2947932-2947954 GGAGGGAAGGGGGTGGGGTGGGG - Intergenic
900551468 1:3258452-3258474 TGATGGAAGTGGGTGTCAGGTGG - Intronic
900802015 1:4743132-4743154 TGAGGGTAGCAGTTGGCAGGTGG - Intronic
900809669 1:4792331-4792353 GGTGGGGGGCGGGGGGCAGGTGG + Exonic
900820806 1:4886506-4886528 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
900932896 1:5747835-5747857 GGAGGGAGGAGGGAGGGAGGAGG + Intergenic
901066126 1:6495415-6495437 GGAGGGGAGCGGGGGGTGGGGGG + Intronic
901069079 1:6508337-6508359 GGTGGGAGGTGGGAGGCAGGAGG - Intronic
901078690 1:6571482-6571504 GGAGGGAAGTGGAGGGCAGCAGG - Intronic
901449341 1:9326460-9326482 AGAGGGAACAGGGAGGCAGGAGG + Intronic
901530394 1:9849160-9849182 CCAGGGAAGGGGGTGGCAGGTGG + Exonic
901531117 1:9853088-9853110 CCAGGGAAGGGGGTGGCAGCTGG - Intronic
901636390 1:10672211-10672233 GGAGGGGAGGGGGTGGCGGGGGG - Intronic
901656314 1:10771830-10771852 GGCTGGAAGCGGGTTCCAGGGGG - Intronic
901675073 1:10878575-10878597 TGAGGGAACGGGGAGGCAGGCGG + Intergenic
901702618 1:11053709-11053731 GGTGGGGAGTGGGGGGCAGGTGG + Intergenic
901866330 1:12109409-12109431 GAAGGGGAACGGGTGCCAGGCGG + Intronic
901890083 1:12255502-12255524 GGAGGTAAGTGGGTGGCTGGGGG + Intronic
902018742 1:13328622-13328644 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
902139632 1:14341973-14341995 GAAGGGTAGTGGGTGGGAGGAGG - Intergenic
902338764 1:15768974-15768996 GAAGGAAACCGGGTGGTAGGGGG - Intronic
902418284 1:16256105-16256127 GAAAGGTAGCAGGTGGCAGGTGG - Intronic
902671746 1:17979551-17979573 GGAGGGAAGTAGGAGGCAAGAGG - Intergenic
902931638 1:19735567-19735589 AGAGGGAAGAGGGAGGCAGGTGG - Intronic
902937136 1:19772572-19772594 GGTGTGAGCCGGGTGGCAGGTGG + Intronic
902985750 1:20153107-20153129 GAAAGGGAGCGGGTGGGAGGAGG + Intergenic
903020443 1:20390081-20390103 GGGTGGAAAGGGGTGGCAGGAGG - Intergenic
903081686 1:20816314-20816336 GGAGGGAGGCGGGGGGGGGGGGG + Intronic
903232990 1:21933275-21933297 TGAGAGGAGCAGGTGGCAGGAGG + Intronic
903233040 1:21933544-21933566 GGTGGAAAGAAGGTGGCAGGAGG - Intronic
903365527 1:22803226-22803248 CTAGGGCAGCGGGTGGGAGGTGG - Intronic
903474996 1:23613421-23613443 GGAGGGATGAGGGTGCGAGGTGG + Intronic
903637895 1:24833832-24833854 GGAGGGAGGCGGGGGGGGGGGGG - Intronic
903736914 1:25535618-25535640 GGAGGGGTGCGGGAGCCAGGTGG + Intergenic
903758907 1:25684188-25684210 GGAGAGAGGCAGGTGGCTGGGGG - Intronic
903907226 1:26695981-26696003 GGAGGGAGGCGAGGGGGAGGGGG - Intergenic
903930170 1:26857363-26857385 GGAGGGTTGGGGGTGGGAGGTGG - Exonic
903997443 1:27316354-27316376 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
904043451 1:27597146-27597168 GGTGGGGGGCAGGTGGCAGGGGG + Intronic
904130585 1:28272648-28272670 GGAGGAGAGCGAGTGGCAGTGGG - Exonic
904462375 1:30687741-30687763 GGAGGAAAGGGGGTGACAGGAGG - Intergenic
904812664 1:33173523-33173545 AGAGGGGAGGGTGTGGCAGGAGG - Intronic
904842089 1:33379347-33379369 GGGGGGATGGGGGGGGCAGGGGG - Intronic
904842101 1:33379365-33379387 GGGGGGAAGGGGGGGACAGGGGG - Intronic
904900251 1:33851518-33851540 GGAGGAAAGCAGGTGACAGGTGG - Intronic
904927343 1:34059361-34059383 TGAGGGAAGAGGGTGTCAGATGG - Intronic
905172065 1:36115297-36115319 GGGAGGCAGCGGGTGGCGGGTGG - Intronic
905929513 1:41777299-41777321 GGGTGGAGGCTGGTGGCAGGAGG - Intronic
906156204 1:43615421-43615443 GGAGGGAAGCAGGTAGAAGATGG - Intronic
906225589 1:44118949-44118971 GGAGCTGAGCCGGTGGCAGGCGG + Exonic
906381124 1:45332744-45332766 GAAGGTAAGGGGATGGCAGGAGG - Exonic
906591013 1:47024002-47024024 GGAGGGAGGAGGGAGGAAGGAGG + Intronic
906761505 1:48382630-48382652 GGAGGGAGGCGGGGGGGGGGGGG - Intronic
907323558 1:53620671-53620693 GGAGGGCTGGGGGTGGAAGGCGG + Intronic
907404470 1:54245408-54245430 GGCGGGAGGCGGGTGGGAAGGGG + Intronic
907726257 1:57023503-57023525 GAAGGGAAGCTGGTGGAAGAGGG + Intronic
907735884 1:57111514-57111536 AGAGGGAAGGGTGTTGCAGGTGG - Intronic
907915138 1:58861352-58861374 GGAGGGAAGGGGGAGGAAGAAGG + Intergenic
908058301 1:60316972-60316994 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
908217152 1:61965577-61965599 GAGGGGAAGTGGGTAGCAGGAGG + Intronic
908766833 1:67561839-67561861 AGAGGCAGGCAGGTGGCAGGAGG + Intergenic
908804921 1:67920339-67920361 GGAGGGAAGAGGGTAGGAGGAGG - Intergenic
908819841 1:68074185-68074207 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
908981329 1:69962822-69962844 GGAGGACAGAGGGTGGGAGGCGG + Intronic
909045905 1:70709490-70709512 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
909255859 1:73420553-73420575 GGAGGGTGGAGGGTGGAAGGAGG + Intergenic
910085315 1:83394993-83395015 GAAGGCAACCAGGTGGCAGGTGG - Intergenic
910876912 1:91886298-91886320 GGCGGGAGGCGGGAGGCGGGAGG - Intronic
911543932 1:99192713-99192735 TGAGGGTAGAGGGTGGAAGGAGG + Intergenic
911696576 1:100896032-100896054 GGAGGGAGGCCGGTCGCGGGCGG - Intergenic
912023437 1:105137728-105137750 GGGGGTGAGGGGGTGGCAGGCGG - Intergenic
912255744 1:108056189-108056211 GGAGGGTAGAGGGTGGGAAGAGG + Intergenic
912326078 1:108764028-108764050 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
912370500 1:109170546-109170568 AGAGGGAAGAGGATGTCAGGAGG + Intronic
912404955 1:109429467-109429489 GGAGGGCGGAGGGTGGCAGGAGG - Intergenic
912504561 1:110147381-110147403 GGAGGGAAGAGAGTGTCAGAAGG + Intergenic
912698892 1:111861566-111861588 GGAGGGAAGCGGGTGGCAGGAGG + Intronic
912854010 1:113151288-113151310 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
912890977 1:113530445-113530467 TGAGGGTAGAGGGTGGGAGGAGG + Intronic
913022766 1:114804505-114804527 GGAGGGAGGCGGTGGGGAGGGGG - Intergenic
913097184 1:115529581-115529603 GGAGGTAAGGGGTTTGCAGGTGG + Intergenic
913114359 1:115682924-115682946 GGAGTTGAGTGGGTGGCAGGAGG + Intronic
913128674 1:115816929-115816951 AGAGGGAAGCAGGTGGAAGTGGG + Intergenic
913206648 1:116545166-116545188 GGAGGGCAAGGGGTGGCTGGTGG + Intronic
913688255 1:121254332-121254354 GGAGGGCAGGGGATGGGAGGAGG - Intronic
914001665 1:143699717-143699739 GGAGGGCTCCGGGTGGCATGGGG - Intergenic
914040111 1:144041974-144041996 GGAGGGCAGGGGATGGGAGGCGG - Intergenic
914149346 1:145025945-145025967 GGAGGGCAGGGGATGGGAGGCGG + Intronic
914888260 1:151600968-151600990 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
914918400 1:151831839-151831861 GGAGGGCGGAGGGTGGAAGGCGG + Exonic
915305647 1:154975924-154975946 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
915512079 1:156391982-156392004 GCAGGGAAGGGCGTGGAAGGAGG - Intergenic
915547517 1:156609758-156609780 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
915570739 1:156743925-156743947 GGAGAGGAGTGGGTGGCTGGTGG - Intronic
915602821 1:156932970-156932992 AGAGGCAAGCAGGTGGGAGGGGG - Exonic
915622022 1:157091882-157091904 GGAGGGAAGAGACTGGCTGGTGG + Intergenic
915656765 1:157367090-157367112 TGAGAGAGGCAGGTGGCAGGGGG - Intergenic
915951394 1:160191989-160192011 GAAGGGAGGCGGTTGGCAGGTGG - Intronic
916107460 1:161441920-161441942 GCAGGGAAGAGCGTGGAAGGTGG - Intergenic
916109045 1:161449338-161449360 GCAGGGAAGAGCGTGGAAGGTGG - Intergenic
916110632 1:161456719-161456741 GCAGGGAAGAGCGTGGAAGGTGG - Intergenic
916112218 1:161464129-161464151 GCAGGGAAGAGCGTGGAAGGTGG - Intergenic
916113805 1:161471510-161471532 GCAGGGAAGAGCGTGGAAGGTGG - Intergenic
916634861 1:166657606-166657628 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
916696499 1:167242937-167242959 GGAGAGAGGCAGGTGGAAGGAGG - Intronic
916708372 1:167377812-167377834 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
917253558 1:173089329-173089351 TGAGGGAGGAGGGTGGGAGGAGG - Intergenic
917295660 1:173516456-173516478 GGAGGGTGGAGGGTGGAAGGAGG - Intronic
917320968 1:173781033-173781055 GGAGGGAGGAGGGAGGGAGGTGG + Intronic
917421255 1:174866089-174866111 GGAGGGGAGAGGGAGGGAGGGGG + Intronic
917535174 1:175869311-175869333 GGGGAGAAGCAGGTGGCAGGGGG - Intergenic
917560958 1:176154632-176154654 GGAGGGTAGAGGGTGGGAAGAGG + Intronic
917585215 1:176419267-176419289 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
917677185 1:177330907-177330929 GGTGGGAAGCAGGCAGCAGGAGG - Intergenic
917980324 1:180265325-180265347 GGAGGGAGGCGGGAGGCATTGGG - Intronic
918124044 1:181566909-181566931 GGTGGGAGGGGGTTGGCAGGAGG + Intronic
918581987 1:186142147-186142169 TGAGGGAGGAGGGTGGAAGGAGG - Intronic
918752150 1:188286488-188286510 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
918798042 1:188930804-188930826 GGAGGGTAGAGGGTGGAAGGAGG + Intergenic
919151115 1:193700340-193700362 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
919176717 1:194028423-194028445 GGAGGGGAGGGGGAGGAAGGAGG - Intergenic
919202395 1:194372712-194372734 GGAGAGTGGAGGGTGGCAGGAGG - Intergenic
919253823 1:195096322-195096344 GAAGGGACTAGGGTGGCAGGGGG - Intergenic
919484302 1:198127920-198127942 AGAGGGAAGAGGATGGCAGGTGG - Intergenic
919712060 1:200738815-200738837 GGAGGGAAGCGGGGAGGGGGCGG + Intergenic
919789775 1:201283677-201283699 GGCGGGAGGCGGGTGGCGCGCGG - Exonic
919795695 1:201320239-201320261 GGAGAGAAGAGGGTGGAAGAGGG - Intronic
919801975 1:201359568-201359590 GTAGGGAAGGAGGGGGCAGGGGG + Intronic
919923177 1:202178212-202178234 GCAGAGCAGCTGGTGGCAGGAGG + Intergenic
920037332 1:203074850-203074872 TGAGGGGGGCAGGTGGCAGGGGG + Intronic
920180044 1:204127026-204127048 GGAGTGAAGGGGAGGGCAGGAGG - Exonic
920279686 1:204833445-204833467 GGCGGGGAGGGGGTGGGAGGTGG - Intronic
920437456 1:205956684-205956706 GGAGGGAACAGGCTGGCAGCAGG - Intergenic
920450989 1:206060929-206060951 GGAGGGGAGCGGGTAGTGGGAGG + Intronic
920475575 1:206272831-206272853 GGAGGGCAGGGGATGGGAGGTGG - Intronic
920560596 1:206935770-206935792 GTGGTGAAGGGGGTGGCAGGAGG - Exonic
921214887 1:212928348-212928370 GGAGGCAAGCAGGGTGCAGGTGG - Intergenic
921724169 1:218506270-218506292 GGAGGTTAGAGGGTGGGAGGAGG - Intergenic
921808061 1:219478463-219478485 AGCGGGAAGCCGGTGGTAGGAGG + Intergenic
921931092 1:220754883-220754905 GGAGGGAAGCTGTTGGGAGGTGG + Intronic
922024268 1:221736380-221736402 GCAGGGAAGTTGGTGGGAGGGGG - Intronic
922024966 1:221741628-221741650 GGAGTGAAGCGGGGGGCGGGGGG - Intronic
922580739 1:226695891-226695913 AGAGGGAAGCGGGGAGGAGGGGG + Intronic
922618877 1:226978753-226978775 GGAGGTATGCGGGTGTGAGGTGG - Intronic
922723308 1:227909859-227909881 GGAGGGGAGGAGGAGGCAGGAGG + Intergenic
923096230 1:230777452-230777474 GGAGAGAAGAGAGTTGCAGGAGG - Intronic
923749060 1:236729580-236729602 GGAGGCAGGCTGGGGGCAGGAGG - Intronic
923784098 1:237051220-237051242 GGAGGGAAAGGGGAGGAAGGGGG - Intronic
924332347 1:242952885-242952907 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
924712476 1:246541343-246541365 GCAGGGAAGAGGATGGGAGGAGG + Intronic
924860354 1:247914194-247914216 GGAGGGTAGTAGGTGGGAGGAGG + Intergenic
1062857047 10:784664-784686 GGCGGGAGGTGGGGGGCAGGTGG - Intergenic
1063016920 10:2087551-2087573 GGAGGGAAGAGGAAGGGAGGAGG + Intergenic
1063269962 10:4497293-4497315 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1063287437 10:4705757-4705779 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1063498027 10:6528091-6528113 GGAGGGAAGAGGGAGGAGGGAGG - Intronic
1063692103 10:8296804-8296826 GGAGGGAAGCGGAGAGGAGGGGG - Intergenic
1063710225 10:8470049-8470071 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1063960354 10:11301384-11301406 GGGGGGAAGCGGGGGGAGGGGGG - Intronic
1064102362 10:12474740-12474762 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
1064108329 10:12519393-12519415 GGAGGGAGGCGGGGGGGGGGGGG - Intronic
1064137002 10:12759499-12759521 GGAGAGAAGTTGGTGTCAGGAGG + Intronic
1064194536 10:13234371-13234393 GGAGGGAAGAGAGAGGCAGGAGG + Intergenic
1064241632 10:13635040-13635062 GGAGGATGGCGGGTGGGAGGAGG - Intronic
1064312817 10:14226853-14226875 GGAAGGCAGCGGGGAGCAGGAGG - Intronic
1064713034 10:18145955-18145977 GGAGGGAGGAGGGAGGAAGGAGG - Intronic
1064945467 10:20783132-20783154 GGAGGGAAGCACGTGGAAAGTGG + Exonic
1065181568 10:23131346-23131368 GGAGGGCAGAGGGTGGAAGGAGG + Intergenic
1065250402 10:23805522-23805544 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1065426450 10:25609453-25609475 GAAGGGTAGTGGGTGGCAGGGGG - Intergenic
1065483749 10:26217428-26217450 GAAGGCAAGCGGGAGGCTGGCGG - Intronic
1065550369 10:26863474-26863496 GGAGGGGAGCAGGAGGCAGGCGG - Intergenic
1065950181 10:30644401-30644423 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
1066022667 10:31319173-31319195 GGGGGGAAGGGGGAGGGAGGGGG + Exonic
1066350585 10:34633342-34633364 GGAGGTTAGCGGTTGGGAGGGGG - Intronic
1066481363 10:35798746-35798768 GAAGGGAACTGGGAGGCAGGAGG - Intergenic
1066671461 10:37844930-37844952 GGAGGGAAGGGGGAGGGAAGAGG - Intronic
1067064112 10:43094079-43094101 GGAGGGAAGCGGTGGGGGGGTGG + Intronic
1067214736 10:44292949-44292971 GGAGGGCCGCGGGTGGGAGGCGG + Intronic
1067214778 10:44293049-44293071 GGAGGGCCGCGGGTGGGAGGGGG + Intronic
1067214806 10:44293111-44293133 GGAGGACCGCGGGTGGGAGGTGG + Intronic
1067216614 10:44309437-44309459 GGAGGGAAGGAGGTGGCGGGGGG + Intergenic
1067303665 10:45037711-45037733 AGAGGGAAGAGGGTGAGAGGAGG + Intergenic
1067685336 10:48463497-48463519 GGAGGGAGGCAGGAGGCAGGCGG - Intronic
1067806191 10:49395193-49395215 GGAGGGAGCTGGGAGGCAGGTGG + Intronic
1068054184 10:51990711-51990733 AGAGGGTAGAGGGTGGGAGGAGG - Intronic
1068075542 10:52249009-52249031 GGAGGGAAGGGGAGGGAAGGAGG - Intronic
1068099424 10:52533049-52533071 GAAGGGAAGGGGGGGGAAGGGGG - Intergenic
1068783297 10:60944205-60944227 GGAGGGCTGCGGGTGGAAAGGGG - Exonic
1069853160 10:71423604-71423626 GCAGAGAAGCTGGTGGCAGGAGG + Intronic
1069913225 10:71772343-71772365 GGAGGGAGGCAGGAGGGAGGTGG - Intronic
1069939126 10:71941675-71941697 GGGGGGGAGAGGGGGGCAGGGGG + Intergenic
1069958434 10:72065731-72065753 GGAGTGATGCTGGTCGCAGGAGG + Intronic
1069990079 10:72309760-72309782 GAAGGGAAGCGGGAGGCACTGGG - Intergenic
1070028199 10:72651680-72651702 GGAGGGAAGGGAGGGGAAGGGGG + Intergenic
1070045301 10:72828472-72828494 GGAAGGGAGGGAGTGGCAGGGGG - Intronic
1070448993 10:76538752-76538774 GGAGGGAAGAGGTGGGCAGAAGG - Intronic
1070622560 10:78024499-78024521 AGAGGCAGGCGGGAGGCAGGCGG + Intronic
1070795322 10:79213039-79213061 GGCGGGGTGGGGGTGGCAGGGGG - Intronic
1071151459 10:82639913-82639935 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1071250608 10:83815232-83815254 GGAGAGAAGTGAGAGGCAGGAGG - Intergenic
1071316866 10:84409907-84409929 AGAGGGCAGGGGGTGGGAGGAGG - Intronic
1071367986 10:84920364-84920386 TGAGGGCAGAGGGTGGGAGGAGG + Intergenic
1071532890 10:86402378-86402400 GGAGGGAGGGCGGTGGCAGGAGG + Intergenic
1071718453 10:88120024-88120046 GGGGGGAAGCGGGAAGGAGGGGG + Intergenic
1071718461 10:88120042-88120064 GGGGGGAAGCGGGAAGGAGGGGG + Intergenic
1071803336 10:89089503-89089525 TGAGGGTAGCGGGTGGGAGGAGG - Intergenic
1071820224 10:89272240-89272262 GGAGGGCAGGGGGTGGGAGGAGG - Intronic
1072039720 10:91595416-91595438 GGTGGGTAGTGGGGGGCAGGAGG - Intergenic
1072091209 10:92129344-92129366 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1072670483 10:97425913-97425935 GGAGGGCGGCGGGCGGCGGGCGG - Intronic
1072681988 10:97514347-97514369 GGAGGGATGAGGGTGGCAGGTGG - Intronic
1072743185 10:97922521-97922543 GCAGGGGAGCAGGTGACAGGAGG + Intronic
1072847056 10:98843187-98843209 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1073458321 10:103651069-103651091 GAAGGAGAGAGGGTGGCAGGTGG + Intronic
1073481953 10:103791645-103791667 GGAAGGAAGGTGGTGGCAGCGGG - Intronic
1073616868 10:105004808-105004830 GGGGGGAAGTGGGGGGCGGGGGG + Intronic
1073626439 10:105102529-105102551 TGAGGGAAGAGGTTGGGAGGAGG + Intronic
1073649173 10:105340664-105340686 GGAGGGAGGAGGCTGGCGGGTGG + Intergenic
1073680542 10:105698875-105698897 GGAGGGGAGTGGGAGGCAGGTGG - Intergenic
1073820686 10:107260139-107260161 GGAGGGGAAAGGGTGGGAGGAGG + Intergenic
1073977731 10:109119509-109119531 GGAGGGAAGGGGGAGGGAAGGGG + Intergenic
1073977737 10:109119520-109119542 GGAGGGAAGGGGGAGGGAAGGGG + Intergenic
1073977743 10:109119531-109119553 GGAGGGAAGGGGGAGGGAAGGGG + Intergenic
1073989240 10:109244037-109244059 GGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1073989885 10:109250820-109250842 GGAGTGCAGAGGGTGGAAGGAGG - Intergenic
1074013661 10:109510171-109510193 TGAGGGTGGCGGGTGGCAGGAGG - Intergenic
1074229191 10:111516825-111516847 GAAGGGAACCGGGTAGCTGGTGG + Intergenic
1074311652 10:112327798-112327820 GGAGGGAAGAGGGAGGAAGGAGG + Intergenic
1074318565 10:112380447-112380469 GGGGGGCGGGGGGTGGCAGGGGG - Intronic
1074532097 10:114305104-114305126 GGAGGGGACCGGGCTGCAGGAGG + Intronic
1074539838 10:114355195-114355217 GGATGGATGCGGGTGGGGGGAGG + Intronic
1074686224 10:115964686-115964708 CGAGGGAAGGGGGTTGCAAGGGG + Intergenic
1074794846 10:116932458-116932480 GGAGGGAAGAGGGTGGGGGATGG - Intronic
1074952594 10:118353703-118353725 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1075105287 10:119536238-119536260 GCAGGAAAGCTGGTGGCAGAGGG + Intronic
1075206395 10:120453151-120453173 GGAATGTGGCGGGTGGCAGGTGG + Intergenic
1075245212 10:120816091-120816113 GGAGGGTAGAGGATGGGAGGAGG - Intergenic
1075323562 10:121511722-121511744 GGTGGGAGGCAGATGGCAGGTGG - Intronic
1075385948 10:122055557-122055579 GGAGGGAGGAGGCTGGGAGGAGG + Intronic
1075582425 10:123632130-123632152 GGAGGGTGGGGGGTGGGAGGAGG - Intergenic
1076633628 10:131868525-131868547 GAAGGGCAGCGGGAGGCAGGTGG - Intergenic
1076840711 10:133043893-133043915 GGAGGGAAGCAGGGGGCCTGGGG - Intergenic
1076874857 10:133210995-133211017 GGAGGAAAGCGGAGGGCAGGTGG + Intronic
1076888883 10:133274483-133274505 GGAGGGCAGAGGGTGGGGGGCGG + Intronic
1076934059 10:133555747-133555769 GAGGGGAAGAGGGTGGGAGGAGG - Intronic
1076997298 11:304323-304345 GGCGGGTGGCGGGTGGCGGGTGG - Intergenic
1077023683 11:430580-430602 GGAGGGATGGGGGAGGGAGGGGG + Intronic
1077048868 11:557842-557864 GGAGGGCAGCCTGGGGCAGGAGG + Intronic
1077062808 11:625230-625252 GGAGAGAAGCTGGGGGCTGGGGG + Intronic
1077094778 11:794660-794682 GAAGGGAAACGGGAGGCAGGCGG - Intronic
1077159345 11:1105636-1105658 GGAGGCAGGAGGGAGGCAGGAGG - Intergenic
1077163240 11:1123068-1123090 GGAGGGAATCAGGAGGAAGGAGG - Intergenic
1077163245 11:1123086-1123108 AGAGGGAAGAGGGAGGAAGGAGG - Intergenic
1077187016 11:1239951-1239973 GGTGGGAAGCGGGTGGCGCTGGG + Intronic
1077210812 11:1370233-1370255 GGAGGGCAGCGGGCGGGGGGAGG - Intergenic
1077268566 11:1664601-1664623 GAAGGGAAGGGGGAGGGAGGAGG + Intergenic
1077272228 11:1686755-1686777 GAAGGGAAGGGGGAGGAAGGAGG - Intergenic
1077272313 11:1687017-1687039 GAAGGGAAGGGGGAGGGAGGAGG - Intergenic
1077539931 11:3141781-3141803 GGTGGGAGGCGGGTGGGGGGTGG - Intronic
1077650064 11:3963230-3963252 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1077888846 11:6404814-6404836 GGAGGGAGGGTGGAGGCAGGAGG - Intronic
1078039606 11:7847604-7847626 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1078040366 11:7856088-7856110 GGAGGGAAGAAGGTGGGGGGGGG - Intergenic
1078372054 11:10756397-10756419 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1078432545 11:11298938-11298960 GGTTGGAGGCGGGAGGCAGGAGG - Intronic
1078523980 11:12086663-12086685 GATGGGAAGCAGGAGGCAGGAGG - Intergenic
1078630218 11:12995843-12995865 TGAGGGTAGAGGGTGGAAGGAGG - Intergenic
1079111953 11:17610122-17610144 AGCGGGAAGCGAGGGGCAGGGGG - Exonic
1079728452 11:23907612-23907634 TGAGGGCAGAGGGTGGGAGGAGG + Intergenic
1079920767 11:26431548-26431570 TGAGGGTGGAGGGTGGCAGGAGG - Intronic
1080754648 11:35185046-35185068 GGAGGGAGGCAGGTAGCAGAAGG + Intronic
1081088801 11:38835563-38835585 GGAGGGCAGAGGGTGAGAGGAGG + Intergenic
1081262889 11:40982815-40982837 GGAGGGCAGAGGGTAGGAGGAGG - Intronic
1081437579 11:43043898-43043920 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1081668453 11:44930127-44930149 ACAGGGAAGGGGGTGGCATGTGG - Exonic
1081834447 11:46142772-46142794 GCGGTGAAGCGGGTGGGAGGAGG - Intergenic
1081960608 11:47133969-47133991 GAAGGGAGGCTGATGGCAGGAGG - Intronic
1082007213 11:47426122-47426144 AGAGGGAAGGAGGTGGCTGGGGG - Intronic
1082028495 11:47589005-47589027 GGAGGGAAGCAGGGGGAGGGAGG + Exonic
1082760037 11:57118559-57118581 GGAGGGTAGAGGGTGGAAGAAGG + Intergenic
1082807753 11:57461115-57461137 GGTGGGACGCAGGGGGCAGGTGG + Intronic
1082820896 11:57543954-57543976 TGAGGGAAGCAGGAGGTAGGGGG - Intronic
1082828415 11:57597976-57597998 GGAGGGGAGGTGGTGGGAGGGGG - Intronic
1083208612 11:61168564-61168586 GGGGGGATGAGGGTGGGAGGGGG - Intergenic
1083311054 11:61783938-61783960 GTGGGGAAGTGGGAGGCAGGAGG + Intronic
1083406843 11:62463472-62463494 GGAGGGAGGCTGGAGGCTGGAGG - Intronic
1083553265 11:63606771-63606793 GGAGGGCAGAGGGTGGGAAGCGG + Intronic
1083616361 11:64028458-64028480 GGAGGGAGGTGGGAGGCAGGAGG + Intronic
1083638265 11:64131917-64131939 GGAGGGAAGTGAGTGGCGGGAGG + Intronic
1083662655 11:64258982-64259004 GGAGCGAGGGGGGTGGCATGGGG + Intronic
1083669338 11:64291608-64291630 GGAGGGAAGCGCGGCGCCGGAGG + Intronic
1083713532 11:64562920-64562942 GGAGTGAAGCTGGTGGGTGGGGG - Intronic
1083743443 11:64722888-64722910 GGAGGGGAGCGGATCGGAGGGGG - Intronic
1083857269 11:65399471-65399493 GGAGGGAAGCGCGTGGCCCCAGG - Intronic
1083885072 11:65569393-65569415 GGAAGGAAGAGGGGGCCAGGAGG + Intergenic
1083932364 11:65852997-65853019 GGAGGGAGGGAGGTGGGAGGTGG - Intronic
1084085541 11:66853389-66853411 GGACAGAGGCGGGTGGGAGGGGG + Intronic
1084155329 11:67309974-67309996 GGATGGGAGCGAGTGGCAGGGGG + Intronic
1084162311 11:67356511-67356533 GCTGGGAAGCTGGAGGCAGGTGG + Intronic
1084404164 11:68961410-68961432 GGAGTGAAGGGAGTGGCCGGGGG - Intergenic
1084654069 11:70505192-70505214 GCAAGGAAGCGGTAGGCAGGGGG + Intronic
1084671596 11:70610054-70610076 TGAGGGGAGCGGCTGCCAGGAGG + Intronic
1084678292 11:70649638-70649660 GGAGGGAGGAGGGGGGCAGGTGG + Intronic
1084984714 11:72858614-72858636 GGAGGGTAGAGGGTGGAAGGAGG + Intronic
1085000087 11:73025488-73025510 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1085011034 11:73142022-73142044 GCAGGCCAGCGGGCGGCAGGCGG + Exonic
1085034887 11:73293755-73293777 GGAGGGGAGGGGGTCCCAGGAGG + Intronic
1085200292 11:74697740-74697762 GGAGGGAAGTGGAAGGCAGGAGG + Intronic
1085229759 11:74956060-74956082 GGAGGAAAGCTGGGGGCAAGTGG - Intronic
1086518827 11:87646245-87646267 GAAGGGAAGCGGAGGGGAGGAGG - Intergenic
1086537245 11:87862507-87862529 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1086579018 11:88375095-88375117 GGAGTGAGGTGGGTGGCAGGTGG - Intergenic
1087332624 11:96800146-96800168 GGAGGGTAGAGGGTAGAAGGAGG - Intergenic
1087498738 11:98923674-98923696 GGAGGGAAGCAGGGAGTAGGAGG - Intergenic
1087647238 11:100822377-100822399 GGTGGGTAGTGGGTGGCAGGTGG + Intronic
1087786227 11:102357255-102357277 GGAGGGAAGAGGGAGTAAGGAGG - Intronic
1087842825 11:102937518-102937540 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1087857463 11:103109539-103109561 GGAGGGAAGTTGGGGGAAGGGGG - Intronic
1087912080 11:103765778-103765800 TGAGGGAGGAGGATGGCAGGAGG - Intergenic
1087954225 11:104264980-104265002 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1087978091 11:104575407-104575429 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1088226539 11:107626529-107626551 GGAGGGAAGGGAGGGACAGGAGG - Intronic
1088319003 11:108535549-108535571 GGAAGGAGGAGGGAGGCAGGTGG + Intronic
1088945633 11:114509769-114509791 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1089289179 11:117427487-117427509 GGAGGGAAGCTTGTAGCAGATGG - Intergenic
1089323127 11:117639825-117639847 GGAAGGGAGCGGGAGGCATGGGG - Intronic
1089396748 11:118141106-118141128 GGGGGGAAGGAGGAGGCAGGTGG + Intronic
1090020640 11:123125463-123125485 GGAGGGAGGAGGGAGGGAGGAGG - Intronic
1090022279 11:123138589-123138611 GGAGGGGGGTGGGGGGCAGGTGG - Intronic
1090577238 11:128118532-128118554 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1090591429 11:128274353-128274375 GGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1090653060 11:128823960-128823982 GGTGGGAGGCGGCGGGCAGGGGG - Intergenic
1090719401 11:129458297-129458319 GGAGGAAGGTGGGTGGGAGGGGG + Intergenic
1090918981 11:131191844-131191866 GGTGGGACGGGGGTGGGAGGTGG - Intergenic
1091136872 11:133199199-133199221 GGTGGGGAGAGGGTGGCAAGAGG + Intronic
1091223856 11:133946346-133946368 GGAGGGCAGCTGGTGGGGGGCGG - Intronic
1091286685 11:134412077-134412099 GCAGGGAGGCGGGGGGCGGGGGG + Intergenic
1091434820 12:464095-464117 GGAGGGGTCCGGGTGGCAGTGGG + Intronic
1091628135 12:2138376-2138398 GGGGGAAGGCAGGTGGCAGGTGG + Intronic
1091789048 12:3260794-3260816 GGAGGGAAGGGCGTGGCTGGTGG + Intronic
1091922456 12:4316318-4316340 GGCGGGAGGCGGGAGGCAGGAGG + Intergenic
1091966789 12:4750329-4750351 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1092274339 12:7047961-7047983 GGAGGGAAGGGGAGGGAAGGTGG - Intronic
1092291157 12:7160187-7160209 GGAGGCAGGTGGGAGGCAGGTGG - Intergenic
1092291185 12:7160268-7160290 GGAGGCAGGTGGGAGGCAGGCGG - Intergenic
1092291205 12:7160325-7160347 GGAGGCAGGTGGGAGGCAGGTGG - Intergenic
1092727768 12:11501066-11501088 GGAAGCAAGCGGGTGTGAGGGGG + Intergenic
1092889836 12:12958982-12959004 TGAGGGGAGAGGGTGGGAGGTGG - Intergenic
1093218489 12:16390440-16390462 TGAGGGTGGAGGGTGGCAGGAGG - Intronic
1093263095 12:16965172-16965194 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1093675024 12:21928256-21928278 GGAGGGGAGAGGATGGAAGGGGG + Intronic
1093686027 12:22054870-22054892 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
1093968602 12:25353316-25353338 CGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1095302946 12:40608578-40608600 GGAGGGTGGGGGGTGGGAGGAGG - Intergenic
1095325664 12:40888935-40888957 GGAGTGAACCGAGTGGCAGGAGG - Intronic
1095398956 12:41792596-41792618 GGAGGGTGGTGGGTGGAAGGAGG - Intergenic
1095613860 12:44165067-44165089 GGGGTGAAGGCGGTGGCAGGGGG - Intronic
1095836385 12:46643881-46643903 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1095953295 12:47793334-47793356 GGAGGGTGGCGGGTGGAGGGAGG - Intronic
1096049163 12:48591768-48591790 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1096095491 12:48932782-48932804 GGGGGGAAGCAGGTGCCAGGCGG + Intronic
1096110583 12:49026953-49026975 GAAGGGCAGTGGGCGGCAGGAGG - Exonic
1096218276 12:49810184-49810206 GGAGGGAAGGGGGTGGGGAGAGG + Intronic
1096252091 12:50040024-50040046 GGAGGGAAGGGAGTGGAAGGAGG - Intergenic
1096311414 12:50524555-50524577 AGAGGGAAGCGGGAGGATGGAGG - Intronic
1096475751 12:51907712-51907734 GGACGGGACCGGGTGGCGGGCGG + Intronic
1096490503 12:52010262-52010284 GGAAGGAAGGGGGTGGGAGTGGG + Intronic
1096549163 12:52360895-52360917 GGAGGAACGAGGCTGGCAGGGGG + Exonic
1096555405 12:52400667-52400689 CCAGGCAAGCTGGTGGCAGGGGG + Intronic
1096591732 12:52664643-52664665 GGAGGCAGGCTGGAGGCAGGTGG - Intergenic
1096630927 12:52926316-52926338 GGAGGGCAGCTAGTGCCAGGTGG - Intronic
1096633568 12:52944908-52944930 GGGAGGATGCGGGTGGCAGCTGG - Intronic
1096648840 12:53052275-53052297 TGAGGGAAGAGTGTGGCAGTGGG - Intronic
1096826859 12:54285872-54285894 GGTGGGAGGTGGGTGGGAGGTGG + Intronic
1096911270 12:54986754-54986776 GGAGGGTAGAGGGTGGAAGGAGG - Intergenic
1096983667 12:55743232-55743254 GGAGGGAGGAGGGAGGGAGGAGG - Intergenic
1097009336 12:55941124-55941146 GGAGGGAAACAGGAGGGAGGGGG + Intronic
1097152647 12:56991042-56991064 TTGGGGAAGCTGGTGGCAGGAGG + Intergenic
1097697803 12:62791283-62791305 GGAGGGGCACGGGTGTCAGGTGG + Intronic
1097725754 12:63074126-63074148 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1097863896 12:64543446-64543468 GGTGGGGAGCGGGGGGCGGGCGG - Intergenic
1097967327 12:65595295-65595317 GGCGGGAAGTGGGTTGTAGGGGG - Intergenic
1098384952 12:69908900-69908922 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1098413015 12:70202830-70202852 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
1098459025 12:70711389-70711411 GGAGGGTAGAGAGTGGGAGGAGG + Intronic
1098872181 12:75828884-75828906 GGAAGGTAGAGGGTGGGAGGAGG - Intergenic
1099477212 12:83122062-83122084 GCTGGGAAGCGGGTAGCATGGGG - Intronic
1099477225 12:83122146-83122168 GCTGGGAAGCGGGTAGCATGGGG - Intronic
1099593073 12:84621164-84621186 GGTGGGAGGCGGGAGGCGGGAGG + Intergenic
1099656108 12:85494120-85494142 GGAGGGTGGCGGATGGGAGGAGG - Intergenic
1100393389 12:94163611-94163633 GGAGGGGAGAGGGTAGAAGGAGG + Intronic
1100519285 12:95357867-95357889 GGAGGGAAGGGGGTTGCTGCAGG - Intergenic
1100553765 12:95672225-95672247 GGAGGGGAGGCGGGGGCAGGGGG + Intronic
1100570672 12:95841387-95841409 GGAGGGAGGCGGGGGGGGGGGGG - Intergenic
1100880859 12:99015361-99015383 GGAGGGCAGAGGATGGGAGGAGG + Intronic
1100905678 12:99295751-99295773 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1100912637 12:99382956-99382978 GAAGGGAAGTGGGTGGGAGGGGG - Intronic
1100916099 12:99423836-99423858 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1100938577 12:99699152-99699174 TGTGTGAAGTGGGTGGCAGGGGG - Intronic
1101349326 12:103913895-103913917 GGATGGAAAATGGTGGCAGGTGG - Intergenic
1101511103 12:105393145-105393167 AGACGGTAGGGGGTGGCAGGAGG - Intronic
1101654787 12:106710467-106710489 GGAGGAATGGGGGTGGGAGGGGG - Intronic
1101863209 12:108499654-108499676 GAAGGGAAGAGTGTTGCAGGGGG - Intergenic
1101975995 12:109359318-109359340 GGCGGGAGGGAGGTGGCAGGTGG + Intronic
1102042753 12:109811069-109811091 GGAGGGAAGGGTGTTGTAGGTGG - Intronic
1102157509 12:110742835-110742857 GTAGGGAGCGGGGTGGCAGGGGG - Exonic
1102197166 12:111034003-111034025 GAGGGGCAGCGGGTGGCAGGAGG + Exonic
1102198197 12:111039343-111039365 GGATGGTAGAGGTTGGCAGGGGG + Intronic
1102518425 12:113465093-113465115 AGAGGGAAGAGGGTGGCAGGGGG - Intronic
1102599209 12:114016249-114016271 GGAGGGAAGAGGGAAGCTGGAGG + Intergenic
1102789853 12:115635942-115635964 GGAGGGAAGGGGGAGGGGGGAGG + Intergenic
1103017818 12:117509263-117509285 AGAGGGAAGGGGATGGAAGGAGG - Intronic
1103047926 12:117753661-117753683 GGAGGGTAGACGGTGGGAGGAGG + Intronic
1103366968 12:120390571-120390593 GGAGGGAAGAGGGAAGAAGGAGG + Intergenic
1103415749 12:120740650-120740672 GGAGGGAAGCGGGAGGGAGACGG + Intergenic
1103748977 12:123146153-123146175 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1103902431 12:124310368-124310390 GGAGGGAAGAGTGGGGTAGGGGG + Intronic
1103908018 12:124337115-124337137 AGTGGGCAGTGGGTGGCAGGTGG + Exonic
1104229277 12:126868559-126868581 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1104518278 12:129448366-129448388 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1104576472 12:129971151-129971173 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1104670674 12:130677946-130677968 GGAGGGGAGAGGGAGCCAGGTGG - Intronic
1104693671 12:130847162-130847184 GGAGGGTAGAGGGTAGGAGGAGG - Intergenic
1104732897 12:131118311-131118333 GGAGGGATGGGGGAGGCGGGAGG + Intronic
1104908484 12:132228247-132228269 GGAGGGATGCAGGTGTCAGAGGG - Intronic
1104918942 12:132280607-132280629 GTAGGGAGGAGGCTGGCAGGCGG + Intronic
1105683294 13:22752041-22752063 GGCGGGAAGAGGGTGGCAGCTGG - Intergenic
1105688445 13:22810404-22810426 AGAGGGCAGAGGGTGGGAGGAGG + Intergenic
1105794195 13:23834203-23834225 GGGAGGAAGCGGATCGCAGGGGG - Intronic
1105806638 13:23955315-23955337 GGGGGGAAGAGGATGGCAAGTGG + Intergenic
1105815187 13:24029767-24029789 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1105930550 13:25047963-25047985 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1105964535 13:25372372-25372394 GGAGGGGAGCGGGGCGCGGGCGG - Intronic
1106295521 13:28410186-28410208 GGAGGGGAGAGGAAGGCAGGAGG - Intronic
1106512230 13:30421877-30421899 GGAGAGGAGCGGGGGGGAGGAGG + Intergenic
1106866500 13:33970079-33970101 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1107262704 13:38514356-38514378 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1107817131 13:44254311-44254333 GGAGGGAATCCAGTGGCAGCAGG - Intergenic
1107889068 13:44898320-44898342 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1108373964 13:49796249-49796271 GGAGGGATTGGGGAGGCAGGTGG - Intergenic
1108946860 13:56037345-56037367 GGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1108972268 13:56392459-56392481 GGAGGGGTGGGGGTGGGAGGGGG + Intergenic
1109001291 13:56809743-56809765 GGAGGGTGGGGGGTGGGAGGAGG - Intergenic
1109191080 13:59325007-59325029 GGAGGGCAGTGGGTGGGAGGAGG + Intergenic
1109308049 13:60662166-60662188 GGGGGGGTGGGGGTGGCAGGGGG - Intergenic
1110012144 13:70350228-70350250 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1110021676 13:70481182-70481204 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1110190761 13:72727132-72727154 GGCGGGAATCGGGTGGGACGCGG + Intronic
1110482090 13:75990547-75990569 TGAGGGCAGAGGGTGGGAGGAGG + Intergenic
1110523328 13:76506250-76506272 GGAGGGAGGAGGGAGGGAGGAGG + Intergenic
1110716022 13:78705053-78705075 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1110825730 13:79969600-79969622 GGAGGGCGGAGGGTGGGAGGAGG - Intergenic
1111086372 13:83380552-83380574 GGAAGGAAGGGGGAGGGAGGGGG - Intergenic
1111086388 13:83380606-83380628 GGAAGGAAGGGGGAGGGAGGGGG - Intergenic
1111450859 13:88413388-88413410 GGAGGGCAGAGGGTGGGAGGAGG + Intergenic
1111474554 13:88727311-88727333 AGAGGGTAGAGGGTGGAAGGAGG - Intergenic
1111892379 13:94099959-94099981 TGAGGGTAGAGGGTGGGAGGAGG + Intronic
1111948995 13:94694895-94694917 GGAGAGAACAGGGTGGTAGGAGG + Intergenic
1112051163 13:95644641-95644663 GGAGGGGAGGGGGCGGGAGGGGG - Intronic
1112266898 13:97932622-97932644 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1112402164 13:99086636-99086658 CGAGGGAGGCTGGTGGCATGGGG - Intergenic
1112460256 13:99597812-99597834 TGAGGGTGGAGGGTGGCAGGAGG - Intergenic
1113358582 13:109607176-109607198 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1113367009 13:109685474-109685496 GCAGGGGAGAGGGTGGAAGGAGG + Intergenic
1113642876 13:111970829-111970851 GGAGGGAAGCGGCCAGCATGGGG - Intergenic
1113653899 13:112056397-112056419 GGAGAGGAGCGGGGAGCAGGAGG + Intergenic
1113737884 13:112690710-112690732 GGCGGGAAGGGGGCGCCAGGCGG - Intronic
1113794802 13:113050768-113050790 GGGGGGAGGGGGGCGGCAGGGGG + Intronic
1113852922 13:113428420-113428442 AGAGGGGAGGGGGCGGCAGGGGG - Intronic
1113931896 13:113973015-113973037 ACAGGGCAGCGGGAGGCAGGAGG + Intergenic
1113939419 13:114010673-114010695 GGAGGGAAGTGGGGAGGAGGGGG + Intronic
1114155213 14:20094819-20094841 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1114532215 14:23403187-23403209 GGAGGGAAGCGAGAGGGAGCTGG + Intronic
1114698054 14:24645883-24645905 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1115016042 14:28615684-28615706 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1115190028 14:30738092-30738114 GAAGGGAAGGGGGCGGGAGGAGG + Intergenic
1115371193 14:32616596-32616618 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1115735714 14:36327103-36327125 GGAGGGAGGAGGGTGAGAGGAGG - Intergenic
1115940557 14:38603747-38603769 GGAGGGTAGAGAGTGGGAGGAGG - Intergenic
1116166983 14:41346404-41346426 GAAGGGAGGAGGGTGGGAGGAGG + Intergenic
1116381035 14:44268190-44268212 GGAGGGTAGAGGTTGGGAGGAGG - Intergenic
1116510063 14:45733885-45733907 GGAGGGTAGAGGGTGGGAGAAGG + Intergenic
1116592398 14:46795049-46795071 TGAGGGCAGAGGGTGGGAGGAGG - Intergenic
1116805231 14:49488073-49488095 TGAGGGTAGAGGGTGGAAGGAGG - Intergenic
1116816612 14:49590034-49590056 TGAGGGTAGAGGGTGGGAGGAGG + Intronic
1117687386 14:58268478-58268500 GGAGGGGAGGAGGTGGCAAGAGG - Intronic
1117738149 14:58788379-58788401 GGAGGGTGGGGGGTGGAAGGGGG - Intergenic
1117742530 14:58833681-58833703 GGAGGGAAGCAGGAAGCAGAGGG + Intergenic
1117755877 14:58973556-58973578 GGTGGGAGGGGGGTGGGAGGGGG + Intergenic
1117948121 14:61053029-61053051 GGTGGGTAGAGGGTGGGAGGAGG - Intronic
1118025590 14:61764869-61764891 GAAGGGAAGGGGGTAGTAGGAGG - Intronic
1118467152 14:66041340-66041362 GGAAGGAAGGGGGTGGGAGATGG + Intergenic
1118522728 14:66604845-66604867 GGAGGGAGGGGGGAGGGAGGGGG - Intronic
1118536036 14:66765609-66765631 TGAGGGTAGAGGGTGGGAGGAGG + Intronic
1118843365 14:69528465-69528487 GGAGGGGAAGGGGTGGCAGAGGG + Exonic
1118925452 14:70187311-70187333 GAAGAGAAGCGGGGGGCGGGGGG + Intronic
1119113475 14:71996780-71996802 GGGAGGAAGGGGGTGGCGGGAGG + Intronic
1119140863 14:72265941-72265963 GGGGGGGGGCGGGAGGCAGGTGG + Intronic
1119246643 14:73115317-73115339 GTAGGGCAGAGGGTGGGAGGAGG - Intronic
1119423963 14:74524137-74524159 GATGGGAAGCAGGGGGCAGGGGG - Intronic
1119641379 14:76317689-76317711 GGAAGGAGGCGGGTACCAGGCGG + Intronic
1119656612 14:76421772-76421794 GGAGGGAGGAGAGTGACAGGGGG - Intronic
1119702224 14:76762828-76762850 GGGGGGAAGAAGGTGGCTGGGGG + Exonic
1119704827 14:76776976-76776998 GGAGGCCAGCGGGCGGTAGGTGG + Intronic
1119887149 14:78152637-78152659 GGAGGGAAGTGGCTGACAGACGG - Intergenic
1119934564 14:78579567-78579589 GGAGGCAAGCTGGAGGCACGTGG + Intronic
1119967148 14:78929349-78929371 GGAGGGTAGAGGGTGGGAGGAGG - Intronic
1120015806 14:79471985-79472007 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1120300445 14:82699647-82699669 GGAGGGAAACGCCTGGCAGTAGG + Intergenic
1120331802 14:83102693-83102715 GGAGGGTGGAGGGTGGAAGGAGG + Intergenic
1120543742 14:85783989-85784011 AGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1120610529 14:86636008-86636030 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1120878617 14:89397283-89397305 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1120884573 14:89441747-89441769 GGAGGGAGGGGGGTGGAAGTAGG + Intronic
1121150347 14:91627722-91627744 GGAGGAAAGCCTGAGGCAGGAGG + Intronic
1121168866 14:91836490-91836512 GGAGGGAAGTGGAGGGGAGGGGG - Intronic
1121234639 14:92383317-92383339 GGAGGGGGCCGGGAGGCAGGAGG + Intronic
1121447489 14:93988088-93988110 GGGAGGAAGGGGGTGGAAGGAGG + Intergenic
1121487750 14:94331542-94331564 GTAGGGCAGGGGCTGGCAGGTGG - Intergenic
1121634264 14:95443136-95443158 GGAGGTAAGGGGCTGGCAGAAGG - Exonic
1122080382 14:99263017-99263039 AGAGGGAGGCTGGTGTCAGGAGG + Intronic
1122100994 14:99409379-99409401 GGAGGGGAGCGGGTGGCAGCCGG + Intronic
1122163658 14:99804895-99804917 TCAGGGAAGCAGGTGGCAAGTGG - Intronic
1122171154 14:99876751-99876773 GGAGGGGAGGGGCAGGCAGGGGG - Intronic
1122271231 14:100569156-100569178 GGGGGGAAGGGGGAGGCAGCTGG + Intronic
1122278806 14:100609571-100609593 GGAGGGGTGAGGGTGGCGGGGGG + Intergenic
1122294159 14:100695625-100695647 GGAGGGCTCCGGGCGGCAGGAGG - Intergenic
1122538328 14:102481858-102481880 GAAGGGAGGTGGGTGGCTGGGGG - Intronic
1122603266 14:102931630-102931652 GGTGAGCAGTGGGTGGCAGGTGG - Intronic
1122838606 14:104443512-104443534 TGAGGGAAGCCTGAGGCAGGGGG - Intergenic
1122861987 14:104586836-104586858 GGAGGGAAGAGGGTGGAGAGAGG + Intronic
1122880724 14:104689496-104689518 GGGGGGAGGTGGGTGGCTGGGGG - Intergenic
1123037566 14:105477719-105477741 GGGGGGAAGCGGGTGTGTGGAGG + Intronic
1123104893 14:105836791-105836813 GGAGGCCAGCGGGCTGCAGGTGG + Intergenic
1123176490 14:106423880-106423902 GGTGGGAGCTGGGTGGCAGGGGG - Intergenic
1202947187 14_KI270726v1_random:39687-39709 GGTGGGAGCTGGGTGGCAGGGGG + Intergenic
1123419236 15:20118055-20118077 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1123446629 15:20335444-20335466 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1123528458 15:21124598-21124620 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1123644356 15:22428299-22428321 GGAGGCCAGGGCGTGGCAGGGGG - Intergenic
1123889436 15:24761446-24761468 TGAGGGTAGAGGGTGGGAGGCGG + Intergenic
1124201403 15:27681462-27681484 GCAGTGCAGCGGGTGGGAGGAGG - Intergenic
1124501504 15:30231465-30231487 GTAGGGAAGTGGGGGGCAAGGGG - Intergenic
1124591460 15:31057384-31057406 GGAGGGAGGAGAGTGGGAGGAGG + Intronic
1124640448 15:31393151-31393173 GGAGAGACGCAGGTGCCAGGTGG - Intronic
1124681567 15:31736059-31736081 GGAGGGCAGAGGGTGGGAGGAGG + Intronic
1124742062 15:32307202-32307224 GTAGGGAAGTGGGGGGCAAGGGG + Intergenic
1125178686 15:36856690-36856712 GGAGGGAAGGGGGGGACGGGAGG - Intergenic
1125408703 15:39382235-39382257 TGAGGGTGGAGGGTGGCAGGAGG + Intergenic
1125443609 15:39729885-39729907 TGAGGGCAGAGGGTGGTAGGAGG + Intronic
1125685072 15:41559164-41559186 GGAAGGGAGCGGGAGGGAGGAGG - Exonic
1126110471 15:45172081-45172103 GTAGGGAAGCCAGTGCCAGGAGG + Intronic
1126142721 15:45450941-45450963 GAAGGGTAGAGGGTGGCAGTGGG + Intergenic
1126283402 15:46983863-46983885 TGAGGGCAGAGGGTGGAAGGAGG - Intergenic
1126442968 15:48711756-48711778 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1126750129 15:51868435-51868457 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1127003003 15:54532167-54532189 GGAGGGCAGAGGGTGGGAAGAGG - Intronic
1127167165 15:56256930-56256952 GGAGAGCAGAGGGTGGGAGGAGG - Intronic
1127259644 15:57318863-57318885 GGAAGGAAGAGGGAGGAAGGAGG + Intergenic
1127415680 15:58755089-58755111 GTGGGGAAGCGGTGGGCAGGAGG - Intergenic
1127449600 15:59103914-59103936 GGAGGGGGGCGGGGGGCGGGGGG - Intergenic
1127507391 15:59610397-59610419 GGAGGGAGGAGGGAGGGAGGAGG - Intronic
1127507396 15:59610408-59610430 GGAGGGAGGAGGGAGGGAGGAGG - Intronic
1127579851 15:60328214-60328236 GGAGGGAAGAGGGGGGAGGGAGG + Intergenic
1127584332 15:60366793-60366815 GGAGGGAGGCGGGGGGGGGGGGG + Intronic
1127606556 15:60592630-60592652 GGCGGGAGGCGGGAGGCGGGAGG + Intronic
1127606559 15:60592637-60592659 GGCGGGAGGCGGGAGGCGGGAGG + Intronic
1127812155 15:62573667-62573689 GGAGGGAAGGGGGTTCCTGGGGG - Intronic
1128401329 15:67284605-67284627 GGAGGGAGGAGGGTGGAAGAAGG - Intronic
1128470531 15:67948222-67948244 GGAGGATGGAGGGTGGCAGGAGG - Intergenic
1128885772 15:71286303-71286325 GAAGGGCAGAGGGTGGGAGGAGG - Intronic
1129409283 15:75339938-75339960 AGAGGGAAGAGGTGGGCAGGTGG - Intronic
1129660080 15:77548545-77548567 GGAGGTGAGTGGGGGGCAGGAGG - Intergenic
1129832741 15:78681412-78681434 GGATGGAGGCAGGAGGCAGGGGG - Intronic
1129851332 15:78795574-78795596 GGAGGTGAGGGGCTGGCAGGGGG + Intronic
1129875346 15:78971788-78971810 GGAGGGGACAGGGTGGAAGGTGG + Intronic
1130119608 15:81036338-81036360 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1130361070 15:83186728-83186750 GAAGGGAAGAGGGTGGGAGGGGG + Intronic
1130531066 15:84748373-84748395 GGCGGGAGGCGGGAGGCGGGAGG + Intergenic
1130680949 15:85996240-85996262 AGAGGGAATTGGGTGCCAGGGGG - Intergenic
1131077028 15:89501823-89501845 GGAGGAAAGCGGGAGAGAGGAGG + Intergenic
1131314808 15:91326004-91326026 TGAGGGTGGAGGGTGGCAGGAGG - Intergenic
1131357290 15:91757091-91757113 GGAGGGAAGAGGGAGAGAGGAGG - Intergenic
1131531280 15:93194813-93194835 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1131535920 15:93237942-93237964 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1131686839 15:94777419-94777441 GGAAGGAAACTGGGGGCAGGGGG - Intergenic
1131976295 15:97949178-97949200 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1132233382 15:100200987-100201009 GGAGGGAAGGAGTTGGCAGAGGG + Intronic
1132540129 16:504655-504677 GGAGGTAAGGGGGGTGCAGGAGG - Intronic
1132550700 16:552790-552812 GGAGGGTGGCGTGGGGCAGGGGG + Intronic
1132691458 16:1183544-1183566 GGAGGGAACTGGGTGGGAAGGGG - Intronic
1132750181 16:1453991-1454013 AGAGGGAAGGGGACGGCAGGGGG + Intronic
1132843640 16:1990280-1990302 GGCGAGAAGCAGGGGGCAGGGGG - Intronic
1132907213 16:2288881-2288903 GGAGGGCAGGGGATGGCAGCTGG - Intronic
1133345324 16:5065984-5066006 GGTGGGAAGGAGGTGGGAGGAGG - Exonic
1133497008 16:6328273-6328295 GGAGGGGAAAGGGTGGGAGGGGG + Intronic
1133774056 16:8884293-8884315 AGTGGGAAGCGGGAAGCAGGTGG - Intergenic
1133911305 16:10068981-10069003 GGTGGGGAGCAGGTGGCAAGAGG + Intronic
1134130481 16:11646308-11646330 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1134189713 16:12111703-12111725 TGTGGGTAGCAGGTGGCAGGAGG + Intronic
1134285822 16:12861339-12861361 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1134348639 16:13415433-13415455 GGAGGGAGGAAGGTGGGAGGAGG + Intergenic
1134351824 16:13444786-13444808 GGAGGGAAGAGGGAGGGAAGAGG - Intergenic
1134373679 16:13649719-13649741 TGAGGGAAGAGGTTGGGAGGAGG - Intergenic
1134429411 16:14187929-14187951 GGAGGCAAGGGGGTGGCTGCTGG - Intronic
1134544555 16:15097750-15097772 GGAGGAAAGCAGGTAGAAGGTGG - Intronic
1134773751 16:16833893-16833915 GGAGGGCGGAGGGTGGGAGGAGG - Intergenic
1135012468 16:18894126-18894148 GGAGGGTAGGGGGTGGGAGAAGG + Intronic
1135354673 16:21759185-21759207 GGAGGGAACAGGGTGGCTGGGGG - Intronic
1135362179 16:21824458-21824480 GGAGGAAAGCAGGTAGAAGGTGG - Intergenic
1135453160 16:22575326-22575348 GGAGGGAACAGGGTGGCTGGGGG - Intergenic
1135658476 16:24272988-24273010 GGAGGGTAGAGGGTGGGAGAAGG - Intronic
1135740783 16:24973580-24973602 GGAGGGAAATTAGTGGCAGGTGG - Intronic
1136234192 16:28904340-28904362 AGAGGGAGGCGGGTGGCCGAGGG - Exonic
1136260461 16:29071689-29071711 GGAGGAAAGCAGGTAGAAGGTGG + Intergenic
1136329635 16:29563440-29563462 GGAGGGTGGGGGGTGGGAGGAGG + Intergenic
1136398298 16:30004838-30004860 GAGAGGAAGCTGGTGGCAGGTGG + Intronic
1136444264 16:30303147-30303169 GGAGGGTGGGGGGTGGGAGGAGG + Intergenic
1136550644 16:30980682-30980704 GCAGGGAAGTGAGTGGCAGGAGG - Intronic
1136619225 16:31416996-31417018 GGAGGGAGGGGGGAGGGAGGGGG - Intronic
1136702228 16:32154757-32154779 GGAGGTGGGCGGGTGGGAGGTGG - Intergenic
1137055929 16:35746707-35746729 TGTGGGAAGCGGGTGGCGGGGGG - Intergenic
1137588246 16:49677355-49677377 GGAGGGAAGGGGAGGGTAGGAGG + Intronic
1137610217 16:49812905-49812927 GGAGGACAGTGGGTGGCTGGGGG + Intronic
1137774024 16:51040907-51040929 GGAGGGATGGGGGAGGAAGGAGG + Intergenic
1137832752 16:51559756-51559778 GGAGGGAGGCTGGTGGAGGGAGG + Intergenic
1137896210 16:52215810-52215832 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1138328231 16:56192403-56192425 GTGGGGGAGCTGGTGGCAGGGGG - Intronic
1138339691 16:56280580-56280602 GCAGGGAGGGGGATGGCAGGGGG + Intronic
1138387821 16:56648180-56648202 GCAGGCAAGCCGGTGGGAGGGGG - Intronic
1138506250 16:57479782-57479804 GGAGGGAAGAGGGAGAGAGGAGG - Intronic
1138638597 16:58364298-58364320 GCATGGATGCTGGTGGCAGGAGG + Intronic
1138667738 16:58586341-58586363 GGAGGGGAGGGGGAGGGAGGGGG + Intronic
1139161667 16:64517462-64517484 TGAGGGAAGTGGGTGGATGGAGG + Intergenic
1139247794 16:65463429-65463451 GGAGGGAGGAGAGTAGCAGGAGG - Intergenic
1139276471 16:65732482-65732504 GGAAGGTAGAGGGTGGGAGGAGG - Intergenic
1139659668 16:68412024-68412046 GGAAGGAAGAAGGAGGCAGGAGG + Intronic
1139824017 16:69742758-69742780 GGTGGGAATCAGGTGGGAGGCGG - Intronic
1140134688 16:72195502-72195524 GGATGGATGGGGGAGGCAGGAGG - Intergenic
1140152035 16:72377341-72377363 GGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1140224928 16:73069328-73069350 GATGTTAAGCGGGTGGCAGGGGG + Intergenic
1140458193 16:75116590-75116612 GGTGGGGAGCGGGGAGCAGGGGG - Intronic
1140581848 16:76240261-76240283 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1140775248 16:78243506-78243528 GGAGGGTAGAGGGTGGAAGGAGG - Intronic
1141205240 16:81928353-81928375 GGCGGGGAGAGGGTGCCAGGAGG - Intronic
1141343347 16:83223640-83223662 GGATGGAAGTGAGTGGCGGGAGG - Intronic
1141517846 16:84558383-84558405 GGTGGGAGGAGGGTGGGAGGAGG - Intergenic
1141540216 16:84714207-84714229 GGCGGGAGGTGGGTGGCTGGCGG + Intronic
1141624051 16:85252214-85252236 CGAGGGAATCTGGCGGCAGGAGG + Intergenic
1141624067 16:85252283-85252305 TGAGGGAATCTGGTGGCAGGAGG + Intergenic
1141665304 16:85462704-85462726 GGAGGGAGGCGGGAGGCGGGAGG + Intergenic
1141694642 16:85613710-85613732 GGGGGGATGGGGGTGGCGGGGGG + Intronic
1141762703 16:86039072-86039094 GGAGGGAAGGGGGTGGTGGGTGG + Intergenic
1141924530 16:87159217-87159239 GGAGGGGAGTGGGAGGCAGCTGG + Intronic
1141988073 16:87592980-87593002 GGAGGGAAGGGGAGGGGAGGGGG - Intergenic
1142008215 16:87700489-87700511 GGAGGGCAGAGGGTGGAGGGAGG + Intronic
1142008224 16:87700514-87700536 GGAGGAAAGAGGGTGGAGGGAGG + Intronic
1142030663 16:87836842-87836864 GGAGGGAAGAGGCGGGGAGGAGG + Intronic
1142079554 16:88141709-88141731 GGAGGGAGGCGGGAGGCCAGGGG + Intergenic
1142251405 16:88993653-88993675 GGAGGGAAGAGGGAGGGAGGAGG - Intergenic
1142251448 16:88993776-88993798 GGAGGGAAGAGGGAGGAGGGAGG - Intergenic
1142261998 16:89047415-89047437 GGAAGGAAGCAGGTGGGAGGCGG - Intergenic
1142284368 16:89165729-89165751 GGAGGGAGGAGGGTGGAAGAGGG - Intergenic
1203067827 16_KI270728v1_random:1034950-1034972 GGAGGTGGGCGGGTGGGAGGTGG + Intergenic
1142818869 17:2448067-2448089 GGAGGGAGGCGGGGGGGTGGGGG + Intronic
1143092225 17:4455664-4455686 GGAGGGGAGAGGGCGGCAGTGGG - Intronic
1143101210 17:4505816-4505838 AGAGGAAAGCGGGAGGCAGGAGG - Intronic
1143183269 17:4997147-4997169 GGAGGGAAGCGCCGGGCCGGAGG + Intronic
1143348459 17:6268118-6268140 TGAGGGTAGAGGGTGGGAGGCGG - Intergenic
1143473684 17:7191524-7191546 GGGCGGTTGCGGGTGGCAGGGGG - Intronic
1143480523 17:7225294-7225316 GGAGGGAGGCAGGCAGCAGGGGG - Intergenic
1143513048 17:7406295-7406317 GGAGCGGAGCTGGTGGGAGGAGG + Intronic
1143763818 17:9124373-9124395 GGAGAGAAGCCGGAGGGAGGAGG - Intronic
1143801524 17:9386556-9386578 GGAGGGAGGGAGCTGGCAGGCGG + Intronic
1144134412 17:12279605-12279627 TGAGGGTAGCGGTTGGGAGGAGG - Intergenic
1144231698 17:13211829-13211851 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1144255906 17:13466861-13466883 TGAGGGAAGCGAGTTCCAGGAGG - Intergenic
1144363641 17:14520909-14520931 GGAGGGCAGAAGGTGGGAGGAGG - Intergenic
1144371575 17:14596340-14596362 GGAGTCAAGCTGGTGGGAGGAGG + Intergenic
1144474304 17:15571972-15571994 GGAGGGGTGCGGGGGACAGGAGG + Exonic
1144805629 17:17965081-17965103 GGAGGGAAGGTGGGGGAAGGAGG - Intronic
1145110652 17:20158458-20158480 AAAGGGAAGCGGGAGGCAGCAGG + Intronic
1145193718 17:20868919-20868941 GGGGAAAAGAGGGTGGCAGGTGG + Intronic
1145298250 17:21611922-21611944 GGAGGAAAGAGGGTGGCGAGAGG - Intergenic
1145351944 17:22091143-22091165 GGGGAAAAGAGGGTGGCAGGTGG + Intergenic
1145722698 17:27088532-27088554 GGAGGAAAGAGGGTGGCCAGAGG - Intergenic
1145826389 17:27880136-27880158 GGAGGGAAGCAGCTGGCTGGTGG + Intronic
1145984112 17:29032843-29032865 GGTGGGAAGTGGGTCGCAGTTGG + Intronic
1146183138 17:30709694-30709716 GGGGGGAAGCTGGTAGGAGGTGG - Intergenic
1146283234 17:31558842-31558864 GGAGCGGAGCGGCCGGCAGGGGG + Intergenic
1146285049 17:31568659-31568681 GAAGGCAAGAGGGTGGCTGGTGG - Intergenic
1146422219 17:32698296-32698318 GGAGGGAAGGGGGAGGGAGAGGG - Intronic
1146444432 17:32922872-32922894 GGAGGGAGGCGGGGGGGTGGGGG - Intergenic
1146459787 17:33036951-33036973 GGAGGGAGAAGGGTGGGAGGAGG + Intronic
1146505052 17:33397566-33397588 GGAGAGAAGCTGGTGGCAGCAGG + Intronic
1146593030 17:34145154-34145176 TGTGGGAAGTGGGTGGCTGGTGG - Intronic
1146605795 17:34256602-34256624 GGAGGAACGCAGGTGGAAGGAGG - Intronic
1146651554 17:34609971-34609993 GGAGGGAACAGAGTGGCAAGTGG - Intronic
1146771247 17:35570464-35570486 GGAGAGAAACTGGAGGCAGGAGG + Intergenic
1146923559 17:36729343-36729365 GGAGGGAGGAGGATGGCTGGGGG - Intergenic
1147324385 17:39663344-39663366 GTTGGGGAGTGGGTGGCAGGTGG + Exonic
1147364460 17:39951241-39951263 GGAGGGAAGGGGAGGGGAGGCGG + Intergenic
1147400560 17:40178044-40178066 GGAGGAAAGCGGGGAGCAGCAGG - Intronic
1147425812 17:40345400-40345422 GGAGGGGAGCCGCTGGCCGGGGG + Intronic
1147542654 17:41373681-41373703 GGAGGGTAGAGGGTGGGAGGAGG - Intronic
1147845951 17:43403972-43403994 AGAGGGAAGAGGGAGGGAGGGGG - Intergenic
1147924522 17:43938436-43938458 GGAGGAAAGCGGGGGGTGGGGGG + Intronic
1147971675 17:44221562-44221584 GGAGAGAAGCAGGAGGCAGGAGG - Exonic
1148081168 17:44968321-44968343 GGCGGGAGGCGGGAGGCGGGAGG - Intergenic
1148146903 17:45371786-45371808 GGCGGGGAGCGGGTGGGCGGCGG - Intergenic
1148157611 17:45432641-45432663 GAAGGGAAGGGTGCGGCAGGTGG - Intronic
1148255201 17:46125040-46125062 GGAGGGAGGAGGGAGGGAGGAGG + Intronic
1148255206 17:46125051-46125073 GGAGGGAGGAGGGAGGGAGGAGG + Intronic
1148323007 17:46768872-46768894 GGAGGGAAGGGGGTGGGCAGTGG - Intronic
1148442148 17:47716950-47716972 GGTGGGGAGTGGGTGGCAGAAGG + Intergenic
1148685117 17:49496558-49496580 GGCGGGAGGCGGCAGGCAGGGGG + Intronic
1148865126 17:50624329-50624351 GGAGGGAAGCGGGGGAGGGGTGG - Intronic
1148942648 17:51228218-51228240 GGAGGGTAGAGGGTGGGAGGAGG + Intronic
1148958122 17:51370590-51370612 GGTGGCATGCTGGTGGCAGGGGG + Intergenic
1149172840 17:53833567-53833589 GGAGGGTGGAGGGTGGCAGGAGG - Intergenic
1149297493 17:55273773-55273795 GAAGGGAAGCGAGGGGGAGGAGG - Intronic
1149314006 17:55421919-55421941 GGCGGGAGGCGGGAGGCGGGAGG - Exonic
1149362118 17:55906352-55906374 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1149537325 17:57442980-57443002 GCAGGGAAGGTGCTGGCAGGTGG - Intronic
1149683536 17:58521712-58521734 TGAGGGAAGCTGGTGGTGGGAGG - Intronic
1149738682 17:59021625-59021647 GGAGTGTAGTGGGTGGCTGGGGG + Intronic
1149868056 17:60161557-60161579 GGAGGGGAGCTGGTGGGAGAAGG + Intronic
1150389293 17:64781332-64781354 GGAGGGAAGGGTGCGGCAGGTGG - Intergenic
1150519904 17:65855393-65855415 GGAGGGAAGCCTTTGGAAGGGGG - Intronic
1150645726 17:66976446-66976468 GGAGGGAAGTTGGAGGGAGGAGG - Intronic
1150790152 17:68196577-68196599 GGAGGAAAGGGTGCGGCAGGTGG + Intergenic
1151031628 17:70746921-70746943 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1151050976 17:70978475-70978497 GGAGGGAAGAAGGTGGAGGGAGG + Intergenic
1151103368 17:71581787-71581809 GGAGGGTAGAAGGTGGGAGGAGG + Intergenic
1151169747 17:72236598-72236620 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
1151276535 17:73038743-73038765 GGAGGGAGGAGGGAGGGAGGAGG + Intronic
1151337386 17:73447872-73447894 GTTGGGGAGGGGGTGGCAGGAGG - Intronic
1151625167 17:75271562-75271584 GGTGGGGACCTGGTGGCAGGAGG + Intergenic
1151768052 17:76142140-76142162 GCAGGAAAGCTGGTGACAGGAGG - Intergenic
1151801925 17:76384041-76384063 AGAGGGAAGCTGGTGGGCGGCGG + Intronic
1151885588 17:76921563-76921585 GCAGGGAAGTGGGTGGAAGGTGG - Intronic
1152079174 17:78175832-78175854 GGAGGGAAGCTGGCTGCAGGGGG - Intronic
1152134376 17:78495250-78495272 GGAGGGAAGTAGGGAGCAGGCGG - Intronic
1152368223 17:79869649-79869671 AGAGGGAAAAGGATGGCAGGGGG - Intergenic
1152408854 17:80112022-80112044 GGAGAGAAACTGGTGGCTGGAGG - Intergenic
1152574318 17:81133473-81133495 GGAGGGAGGAGGGTGGGAGGAGG - Intronic
1152597012 17:81242648-81242670 GGGGGGAGGCGGGGGGGAGGGGG + Intergenic
1152697857 17:81805434-81805456 GGGAGGAAGGGGGTGGCATGCGG + Intronic
1152713978 17:81889464-81889486 TGAGGGAAGGGCGGGGCAGGAGG + Intronic
1152736458 17:81999787-81999809 GGAGGCAAGAGGGAGGCATGAGG - Intronic
1152739102 17:82011311-82011333 GGGGGGCAGCGGGTGGCAGTGGG + Intronic
1152755105 17:82083939-82083961 GGAGGGCAGCGGGAGGCACCGGG + Intronic
1152793223 17:82293216-82293238 GGAGGGAAGAGGAGGGCAAGGGG + Intergenic
1152866480 17:82726706-82726728 GGTGGGAAGCGGGTGCCTGGTGG + Intronic
1152913127 17:83016771-83016793 GGAGGGAGGAGGGAGGAAGGAGG + Intronic
1153560696 18:6369351-6369373 GGAGGGATGCTGGGGGCATGTGG + Intronic
1153589365 18:6657149-6657171 GGAGGGTAGAGAGTGGGAGGAGG + Intergenic
1153696981 18:7653459-7653481 AGAGGGCAGAGGGTGGGAGGAGG - Intronic
1153760379 18:8325307-8325329 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
1153997398 18:10454422-10454444 GGAGGGAAGCGGGAGGGGAGCGG + Intergenic
1154072071 18:11161717-11161739 AGAGGGATGAGGGAGGCAGGTGG + Intergenic
1154484795 18:14865098-14865120 GGGGAGAAGAGGGTGGCAAGTGG - Intergenic
1155392444 18:25350873-25350895 GGGGGAAAGCGGGGAGCAGGGGG + Intronic
1155508272 18:26551085-26551107 GGAGGGGAGCTGGTGGGAGGGGG - Intronic
1155671428 18:28376629-28376651 GGTGGGGAGCTAGTGGCAGGAGG - Intergenic
1156076733 18:33288226-33288248 GGAGGGGAGCGGAGGGGAGGAGG - Intronic
1156824266 18:41411351-41411373 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1157054717 18:44212937-44212959 CGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1157153760 18:45244647-45244669 GTGGGGGAGCAGGTGGCAGGTGG + Intronic
1157384331 18:47248410-47248432 AGAGCTGAGCGGGTGGCAGGCGG + Exonic
1157558817 18:48632025-48632047 GAAGGCAAACGGGAGGCAGGAGG + Intronic
1157574636 18:48735493-48735515 GGCAGGAAGCACGTGGCAGGTGG + Intronic
1157610464 18:48952072-48952094 GGAGGGAAGGGGGAGGAAGGGGG - Intergenic
1157739133 18:50076421-50076443 GGAAGGAAAGGCGTGGCAGGAGG + Intronic
1157827829 18:50828496-50828518 GGAGGGAGGCAGGAGGCAGGTGG + Intergenic
1157907385 18:51581676-51581698 GGTGGGAGGAGGGTGGGAGGAGG - Intergenic
1157907390 18:51581687-51581709 GGTGGGAGGAGGGTGGGAGGAGG - Intergenic
1157907395 18:51581698-51581720 GGTGGGAGGAGGGTGGGAGGAGG - Intergenic
1157907400 18:51581709-51581731 GGTGGGAGGAGGGTGGGAGGAGG - Intergenic
1157907405 18:51581720-51581742 GGTGGGAGGAGGGTGGGAGGAGG - Intergenic
1157988919 18:52472226-52472248 GAAGGGGAGAGGGTGGTAGGAGG - Intronic
1158274893 18:55756654-55756676 GGTGGGGTGGGGGTGGCAGGGGG - Intergenic
1158411381 18:57208772-57208794 GGCAGGAAGGGGTTGGCAGGAGG + Intergenic
1158553627 18:58458029-58458051 GCAGGGATGAGGGTGGCATGGGG - Intergenic
1159040757 18:63320609-63320631 GGAGGGGGGCGGCTGGCGGGAGG + Intergenic
1159102623 18:63972175-63972197 GGAGGGAAGCGGATGTGATGAGG - Intronic
1159301876 18:66583484-66583506 TGAGGGCAGAGGGTGGGAGGTGG - Intronic
1159457299 18:68676535-68676557 TGAGGGAAACGGATGGCAGCAGG + Exonic
1159481316 18:68994508-68994530 GGGGAGGAGGGGGTGGCAGGAGG - Intronic
1159548367 18:69869502-69869524 GGAGGGCAGAGGGTGGGAGAAGG + Intronic
1159717330 18:71841911-71841933 GATGGGAGGCGGGAGGCAGGCGG - Intergenic
1160138886 18:76301007-76301029 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1160186279 18:76678943-76678965 GGTGGGAAGGGAGTGGAAGGGGG + Intergenic
1160280911 18:77489775-77489797 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1160319651 18:77878403-77878425 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1160428206 18:78792839-78792861 TGAGGACAGCGGGTGGCATGTGG + Intergenic
1160507643 18:79436441-79436463 GGAGGGTGGCGGGGGGCCGGGGG + Intronic
1160783881 19:890934-890956 GAGGGGAAGCAGGTGGGAGGGGG + Intronic
1160791329 19:925112-925134 GGAGGGAGGCGCGGGGCACGTGG + Intergenic
1160798475 19:956450-956472 GGAGGGGAGGGGGCGGCAGCCGG + Intronic
1160809883 19:1008782-1008804 GGTGGGGAGCGGGTGGGCGGCGG + Exonic
1160818133 19:1045653-1045675 GGAGGGGGGCGGGGGGGAGGCGG - Intronic
1160862101 19:1241815-1241837 GGCAGGAAGCGGGTAGCTGGCGG - Exonic
1160865132 19:1252950-1252972 GGGGGGCTGCGGTTGGCAGGGGG + Intronic
1160881407 19:1322349-1322371 GGTGGGAGGCAAGTGGCAGGAGG + Intergenic
1160887072 19:1355038-1355060 GGACGGCAGCGGTTGGCGGGCGG + Intronic
1160975507 19:1790482-1790504 GGAGGGAAGGTGAGGGCAGGGGG - Intronic
1161014936 19:1978801-1978823 GGAGGGGAGCGCGTGGGACGGGG + Intronic
1161055964 19:2190752-2190774 GGAGAGAGGCCCGTGGCAGGAGG + Intronic
1161186428 19:2924439-2924461 GGAGGGAAGCTGGGAACAGGAGG - Intergenic
1161197067 19:2992795-2992817 GGGGGGAGGCGGGTGGGGGGGGG + Intronic
1161207230 19:3047359-3047381 GCTGGGGGGCGGGTGGCAGGAGG - Intronic
1161315315 19:3614766-3614788 GGAGGGGAGGGGGTGGGCGGAGG + Intronic
1161591604 19:5131565-5131587 GCAGGGAGGAGGGGGGCAGGTGG + Intronic
1161851394 19:6739692-6739714 GGAGGGCGGCGGGCGGCGGGCGG + Exonic
1161926409 19:7303558-7303580 GGAGGGGAGGGGGAGGGAGGGGG + Intergenic
1162181156 19:8869846-8869868 GGAGGGTGGCGGGTGGCGGGTGG + Intronic
1162195898 19:8984428-8984450 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1162237705 19:9321726-9321748 TGGGGGAGGAGGGTGGCAGGGGG - Intergenic
1162326150 19:10000937-10000959 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1162385216 19:10356950-10356972 GGAGGGAAGCTTGGGGCAGGAGG - Intronic
1162403923 19:10462221-10462243 GGCGGGAGGCGGGAGGCGGGAGG - Intronic
1162432594 19:10637951-10637973 GGGAAGAGGCGGGTGGCAGGAGG - Intronic
1162550235 19:11354716-11354738 GGAGGGAAATGGGTGGAGGGGGG - Intronic
1162561288 19:11419329-11419351 GGCGGGTGGCGGGTGGCGGGCGG + Intronic
1162975657 19:14206080-14206102 GGGGGGAAGCGGGTAGGAGGTGG + Exonic
1163061264 19:14763897-14763919 GGAGGAAAGAGGATGGGAGGAGG - Intronic
1163073951 19:14871491-14871513 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1163223878 19:15940975-15940997 GGAGGGATGGGGGAGGAAGGTGG + Intergenic
1163608993 19:18291640-18291662 GGGGGGAGGCGGGAGGCGGGAGG - Intergenic
1163718095 19:18884060-18884082 GGACAGGATCGGGTGGCAGGGGG - Intronic
1163770163 19:19186215-19186237 TGAGGGAAGGGAGTTGCAGGAGG - Intronic
1164066523 19:21721333-21721355 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
1164432809 19:28202614-28202636 GGAGGGTAGAGGGTTGGAGGAGG + Intergenic
1164630791 19:29760284-29760306 GGAGGGCAGCAGGAGGCAGGCGG + Intergenic
1164774105 19:30837669-30837691 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1165290248 19:34878010-34878032 GGAAGGTGGAGGGTGGCAGGAGG - Intergenic
1165329222 19:35132047-35132069 GGAGGGAAGCTGGGGTCAGGGGG + Intronic
1165353908 19:35292108-35292130 GGAGGGGAGGGGCTGGCAAGTGG + Exonic
1165755520 19:38290595-38290617 GGAGGCAGGCTGATGGCAGGAGG - Intronic
1165924922 19:39320890-39320912 GGCGGGAGGCGGGAGGGAGGCGG - Intergenic
1165926024 19:39326744-39326766 GGAGGGGAGCGGGGAGGAGGAGG + Intergenic
1165936019 19:39389549-39389571 AGAGGAGAGCGGGGGGCAGGAGG + Intronic
1166130887 19:40744842-40744864 GGAGGGCTGGGGGTGGAAGGCGG + Intronic
1166694406 19:44844647-44844669 GGCGCGAAGCGGGAGGCCGGGGG - Intergenic
1166749300 19:45157152-45157174 GGACGGAAGCAGGTGGCCGAGGG - Intronic
1166763155 19:45237035-45237057 AGAGGGAAATGGGTGGAAGGTGG + Intronic
1166798911 19:45444127-45444149 GGAGGGAAGCGGGTGAGTCGGGG - Intronic
1166798952 19:45444273-45444295 GGGGCGAAGCGGCTGGCTGGGGG - Intronic
1166853402 19:45770895-45770917 GCAGCTAAGCGGGTGGCAAGGGG + Intronic
1166975787 19:46604263-46604285 GGTGGGAGGTGGGGGGCAGGTGG + Intronic
1167148057 19:47694451-47694473 GGAGGGAGGTGGGGGGCTGGGGG - Exonic
1167381792 19:49142582-49142604 GGAGAGAAACGGGGGGCGGGGGG - Intronic
1167512079 19:49900697-49900719 GGAGGGAGGGGAGGGGCAGGTGG + Intronic
1167636996 19:50661046-50661068 GGAGGTAAGAGTGTGTCAGGAGG + Intronic
1167790079 19:51670302-51670324 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1167915263 19:52735082-52735104 GGCGGGAAGTGGGAGGTAGGCGG + Intergenic
1167970668 19:53186923-53186945 GGAGGGAGGCGGGGGGGGGGGGG - Intronic
1168316838 19:55488332-55488354 GGGGGGAGGGGGGTGGCGGGCGG - Intergenic
1168342514 19:55633445-55633467 GGTGGGAAGAGGGTGACAGATGG + Intergenic
1168362661 19:55755431-55755453 CGAGGGTAGAGGGTGGGAGGAGG - Intergenic
925028313 2:626996-627018 ACAGGGATGCAGGTGGCAGGAGG - Intergenic
925169827 2:1743877-1743899 AGGGGGAAGCGGGAGGCCGGCGG + Intronic
925276774 2:2655654-2655676 CGAGGGATGCAGGTGGCAGACGG + Intergenic
925339736 2:3127801-3127823 GGAGGGTGGAGGGTGGGAGGTGG + Intergenic
925385925 2:3461720-3461742 GGAAGGGGGCGGGTGGGAGGAGG - Intronic
925659146 2:6184078-6184100 GGAGGGAGGAGGATGGAAGGGGG + Intergenic
925907096 2:8546063-8546085 GGAGGGAAGGGGGTGACAGGAGG + Intergenic
926093575 2:10065809-10065831 GGAGGAAAGTGGGGGACAGGAGG + Intronic
926222816 2:10947496-10947518 CATGGGAAGCGGGTGGCAGGGGG + Intergenic
926349431 2:11981931-11981953 AGAAGGAAGCAGGTGGGAGGAGG + Intergenic
926395244 2:12434657-12434679 GGAGAGGAGAGGCTGGCAGGGGG + Intergenic
926531305 2:14049662-14049684 TGAGGGCAGAGGGTGGGAGGAGG - Intergenic
927165617 2:20317698-20317720 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
927489550 2:23511811-23511833 GGAGGGAGGTGTGTGGCTGGTGG + Intronic
927652365 2:24920250-24920272 GGCGGGAGGCGGGAGGCGGGAGG + Intergenic
927652368 2:24920257-24920279 GGCGGGAGGCGGGAGGCGGGCGG + Intergenic
927881391 2:26692554-26692576 GGAGGGAGGAGGGGGGCTGGCGG - Intergenic
927971022 2:27306496-27306518 GGAGGGCAGCGCGGGGCCGGAGG + Exonic
928005230 2:27557637-27557659 GGAGGGAGGCGGGGGGGGGGGGG - Intronic
928503404 2:31922623-31922645 GGAGGGTAGAAGGTGGGAGGAGG - Intronic
928735644 2:34285123-34285145 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
929070923 2:38029714-38029736 GGAGGGGAGGGTGGGGCAGGAGG + Intronic
929171168 2:38934580-38934602 GGAGAGAAGCGGGAGAGAGGGGG - Intronic
929171179 2:38934610-38934632 GGAGAGAAGCGGGAGAGAGGGGG - Intronic
929171190 2:38934640-38934662 GGAGAGAAGCGGGAGAGAGGGGG - Intronic
929218069 2:39436996-39437018 GGAGGGAGGCGGGGGGCACCTGG - Exonic
929242346 2:39665854-39665876 GGAGGGAGGTGGGGGGCAGGTGG + Intronic
929526373 2:42706985-42707007 AGAGGGAAGCGGGGAGGAGGAGG - Intronic
929764596 2:44833506-44833528 GGAGGGGAGAGGGTGGCCAGAGG + Intergenic
929862694 2:45693119-45693141 GGAGTGAAGTAGGTGGGAGGTGG + Intronic
929948587 2:46389102-46389124 GGAGGGAAGTGAGGAGCAGGAGG - Intergenic
930106211 2:47642005-47642027 GGAGGGGAGGGGAAGGCAGGAGG - Intergenic
930157279 2:48118624-48118646 TCAGGGAAGCCGGAGGCAGGGGG - Intergenic
930632862 2:53772858-53772880 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
930639468 2:53840426-53840448 GGAGGGAAGGGGAGGGGAGGGGG + Intergenic
931348898 2:61470972-61470994 GGAGGGGAGAGGGGGGGAGGGGG + Intergenic
931796181 2:65712229-65712251 GGAGGGAAGGGGAGGGGAGGGGG - Intergenic
932094463 2:68835330-68835352 AGAGGGAAGCTGGAGGCAGAGGG + Intergenic
932137710 2:69245336-69245358 GGAGGGCAGTGGGGCGCAGGAGG - Exonic
932355956 2:71068617-71068639 GGAGGGAAGGAGGTGTCAGGCGG + Exonic
932434679 2:71695964-71695986 GGTGGGATGCAGGAGGCAGGTGG + Intergenic
932492689 2:72132019-72132041 GGAGGGAAGCTGGAGCCAGAAGG + Exonic
932687011 2:73879888-73879910 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
932688797 2:73895063-73895085 GGAGGGAAGAGGGCGGCACCAGG + Intronic
932731778 2:74226860-74226882 GGAAGGCAGAAGGTGGCAGGAGG + Intronic
932795509 2:74692028-74692050 GGAGGGAAGCTGGTGGGGTGTGG + Intergenic
932867325 2:75357877-75357899 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
933083981 2:78031459-78031481 GGAGGGAAGGGGAGGGGAGGGGG + Intergenic
933477385 2:82808336-82808358 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
933593073 2:84254528-84254550 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
933728165 2:85437953-85437975 GGATGCAAGCGGGAGGCTGGGGG + Intergenic
933858564 2:86441851-86441873 GGAGGGCGGCGGGGGGCGGGAGG + Intronic
934019257 2:87928190-87928212 GGAGGGTGGAAGGTGGCAGGAGG - Intergenic
934514689 2:94979190-94979212 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
934556543 2:95289671-95289693 AGAGGGAAGTGGGGGCCAGGGGG - Exonic
934654015 2:96108020-96108042 TGGGGGGAGCGGGGGGCAGGAGG + Intergenic
934728062 2:96638027-96638049 GGCGGGAGGCGGGGGCCAGGCGG - Intronic
934853747 2:97716701-97716723 GGAGGGGAGTGAGTGGCGGGGGG + Intronic
934954714 2:98608224-98608246 GGAGGGCAGCGGGTCGCCCGCGG - Intronic
935292559 2:101622523-101622545 GGGGGGCGGTGGGTGGCAGGGGG - Intergenic
935491263 2:103723126-103723148 TGAGGGTGGAGGGTGGCAGGAGG + Intergenic
936519200 2:113201246-113201268 GGAGGGAAGCTGGAGGCACTCGG + Exonic
937206510 2:120240074-120240096 GCGGGAGAGCGGGTGGCAGGAGG + Intronic
937238084 2:120442580-120442602 GGAGGGCTGGGGGTGGCAGCAGG + Intergenic
937240311 2:120456603-120456625 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
937297842 2:120820469-120820491 GCAAAGAAGCTGGTGGCAGGAGG + Intronic
937495030 2:122409421-122409443 AGAGGGCAGAGGGTGGGAGGAGG + Intergenic
937587127 2:123566442-123566464 AGAGGGTGGAGGGTGGCAGGAGG + Intergenic
937649051 2:124299332-124299354 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
937987291 2:127643809-127643831 AGAGAGATTCGGGTGGCAGGTGG - Intronic
938475838 2:131612089-131612111 TGAGGGAGGAGCGTGGCAGGAGG - Intergenic
939147912 2:138438560-138438582 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
939779216 2:146423780-146423802 GGAGGGCTGTGGGTGGGAGGCGG + Intergenic
940527042 2:154829272-154829294 TGAGGGTAGCGGCTGGGAGGAGG - Intronic
940586505 2:155658507-155658529 GGGGGGAAGGGGGGGGGAGGAGG + Intergenic
941141743 2:161791465-161791487 GGAGGGTAGGAGGTGGGAGGAGG + Intronic
941278612 2:163522067-163522089 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
941493157 2:166167411-166167433 GGAGGGAAGTGGGAAGCAGCAGG + Intergenic
941506859 2:166357105-166357127 GGAGGGTGGAGGGTGGCAGGAGG - Intronic
941827602 2:169917295-169917317 GGAGGGAAGCAGGTTGGAAGTGG - Intronic
941933574 2:170965845-170965867 GGAGGAACTCGGATGGCAGGGGG - Exonic
941980857 2:171455124-171455146 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
942279017 2:174342522-174342544 GGAGGGAAAGGGGCGGCAGGGGG - Intergenic
942818505 2:180081624-180081646 GGAGGGTTGAGGGTGGGAGGAGG - Intergenic
942947209 2:181683867-181683889 GGTGGGAAGCGTGTGGCTGGAGG + Intergenic
943422229 2:187680445-187680467 AGAGGGTAGTGGGTGGAAGGAGG + Intergenic
943497597 2:188642791-188642813 GGAGGGTAGAGGGTGGCAGGAGG - Intergenic
943507907 2:188785132-188785154 GGAGGGTTGGGGGTGGGAGGAGG + Intronic
943611471 2:190039664-190039686 TGAGGGGAGAGGGTGGGAGGAGG - Intronic
943692426 2:190881665-190881687 GAAGGGAAGTGGGTGCCTGGCGG - Intronic
944060072 2:195563160-195563182 GGTGGGGAGCGGGTGGGGGGTGG - Intergenic
944404004 2:199361508-199361530 GAAGGGAGGTGGGTGGGAGGGGG - Intronic
944501068 2:200360634-200360656 GAGGGGAAGCAGGTGGCAGGTGG + Intronic
944677039 2:202042235-202042257 GGAGGGTTGGGGGTGGCAGCTGG + Intergenic
945139824 2:206673074-206673096 GGAGGGCAGAGGGTGGGAGGAGG - Intronic
945148015 2:206759126-206759148 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
945157338 2:206853224-206853246 GGAGGTGAGCGGGGAGCAGGGGG + Intergenic
945191457 2:207192252-207192274 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
945223071 2:207504332-207504354 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
945233162 2:207611085-207611107 GGAGGGAGGCGGGGGGGGGGGGG + Exonic
945265759 2:207889767-207889789 GAAGGGCTGGGGGTGGCAGGAGG - Intronic
945290355 2:208120665-208120687 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
945334771 2:208579308-208579330 GGAGGGTAGAGGATGGGAGGAGG + Intronic
945396449 2:209324609-209324631 GGAGGGTAGAGGGTAGGAGGAGG + Intergenic
945604113 2:211906696-211906718 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
945711349 2:213300225-213300247 GGAGGAAAAGGGGTAGCAGGAGG - Intronic
945747101 2:213731628-213731650 GGAGGGCAGGGGGTGGGAAGAGG - Intronic
945970358 2:216226566-216226588 GGAGGGAGGCGGGGGGGGGGGGG - Intergenic
946041969 2:216790530-216790552 GGCGGGAGGCGGGGGGCAGGAGG - Intergenic
946041971 2:216790537-216790559 GGTGGGAGGCGGGAGGCGGGGGG - Intergenic
946302550 2:218832676-218832698 GGATGGAAGAGGCTGGAAGGAGG - Intergenic
946884846 2:224212823-224212845 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
947009544 2:225550578-225550600 GTAGGGAAATGGGTGGCAGCTGG + Intronic
947152655 2:227130909-227130931 GTAGGGAAGTGGATGGGAGGTGG - Intronic
947254104 2:228142697-228142719 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
947393120 2:229660267-229660289 GGAGGGTAGAGGGTGGGAGGAGG - Intronic
947511404 2:230757817-230757839 GCAGGGGAGTGGGCGGCAGGGGG - Intronic
947612328 2:231531797-231531819 GCAGGAAAGCGGGGGGAAGGAGG - Intergenic
947634453 2:231673044-231673066 GGAGGGAAGCAGCTTGCGGGTGG - Intergenic
948134943 2:235629413-235629435 GGAGGAAAGTGGGTGGTGGGAGG + Intronic
948140516 2:235669632-235669654 GAAGGGTGGCGGGTGGCGGGCGG - Intronic
948279551 2:236736356-236736378 GCAGGGCAGGGGGTGGCTGGGGG + Intergenic
948420986 2:237859794-237859816 GGAGGGGAGCGGGTGGGAGCGGG + Intronic
948458543 2:238118392-238118414 GGATGGAAGAGGGTGGACGGAGG + Intronic
948458596 2:238118596-238118618 GGATGGAAGAGGGTGGATGGAGG + Intronic
948571913 2:238923004-238923026 GGAGGGAAGCAGGTGGCAGGAGG - Intergenic
948580287 2:238982718-238982740 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
948695712 2:239732164-239732186 GGAGGAAGGAAGGTGGCAGGTGG - Intergenic
948738880 2:240030034-240030056 GTAGCGCAGCGGGTGGCAGATGG + Exonic
948740954 2:240045677-240045699 GTAGCGCAGCGGGTGGCAGATGG + Exonic
948865448 2:240772604-240772626 GGAGGGAAGCGTGGGGGAGGGGG + Intronic
948871970 2:240805148-240805170 GGAGGGAGGCGGGAGGGAGAGGG + Intronic
1168760691 20:347785-347807 GGAGGGGAGCGGGAGGCGGAGGG - Intronic
1168790370 20:572151-572173 GGAGGGAAGCTGTTGGCAGCAGG + Intergenic
1168818067 20:754480-754502 AGAGTGAAGCCTGTGGCAGGGGG - Intergenic
1168842214 20:916823-916845 GGAGAGAAGGGGATGGCAGCGGG - Intergenic
1168876347 20:1174772-1174794 GTGGGGAGGGGGGTGGCAGGGGG - Intronic
1168965669 20:1896438-1896460 GGAGGGCACCGGGTGGGGGGCGG + Intronic
1168970931 20:1930167-1930189 GGAGGTGAGCAGGTGACAGGAGG - Intronic
1169138083 20:3209686-3209708 GGAGGGAAGCACGTGGGAGGAGG + Intronic
1169213862 20:3782844-3782866 GGAGGGAAGGTGGTGGCAAGGGG + Intergenic
1169469475 20:5871726-5871748 GGAGGGAAGGGGGAAGAAGGGGG + Intergenic
1169499276 20:6143583-6143605 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
1170005232 20:11661504-11661526 AGAGGGCAGAGGGTGGGAGGAGG - Intergenic
1170017869 20:11802250-11802272 GGGGGGGGGCGGGAGGCAGGGGG - Intergenic
1170131533 20:13025874-13025896 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1170143248 20:13146274-13146296 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
1170282288 20:14663327-14663349 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1170353351 20:15466086-15466108 GGAGTGAGGGTGGTGGCAGGGGG + Intronic
1170562958 20:17572915-17572937 GGAGGGAAGGGAGTGGGATGAGG - Intronic
1170567151 20:17613806-17613828 GGCGGGAAGCGGGTGGGACCGGG - Exonic
1170569367 20:17624189-17624211 GCAGGGAAGGAGGTGGGAGGGGG + Intronic
1170896560 20:20420188-20420210 GGTAGTAAGAGGGTGGCAGGAGG + Intronic
1170897724 20:20431139-20431161 GGAGTGATGGGGGAGGCAGGAGG + Intronic
1171052316 20:21871474-21871496 GGAAGGAGGCAGGGGGCAGGAGG - Intergenic
1171263608 20:23752833-23752855 GGAGAGGAGAGGGTGGAAGGAGG + Intergenic
1171370915 20:24661470-24661492 GGAGGGAAGAGGGAGGAAGAAGG + Intronic
1171370925 20:24661496-24661518 GGAGGGAAGAGGGAGGAAGGAGG + Intronic
1171562334 20:26136728-26136750 GGAAGAAAGAGGGTGGCAAGAGG + Intergenic
1172027888 20:31961676-31961698 GAAGGGGAGCTGGTGGCTGGAGG + Intergenic
1172116984 20:32578905-32578927 GGCGGGTAGGGGGTGGCAGTGGG + Intronic
1172189755 20:33054820-33054842 AAAGGGAATGGGGTGGCAGGTGG - Intergenic
1172276960 20:33685256-33685278 GGAGGGTGGAGGGTGGCAGATGG + Intronic
1172393505 20:34582587-34582609 GGAGGGTTGCTGGTGCCAGGAGG + Intronic
1172705912 20:36881730-36881752 GGAGAGAAGCGGGGGGCACTGGG + Intronic
1172790030 20:37496813-37496835 GAAGGGAATAGGGTGGCAGTGGG + Intronic
1172841059 20:37903055-37903077 GGAGGGAGGCGGGAGGAGGGAGG + Intergenic
1172858736 20:38030225-38030247 GGAGGGAGGAGGGAGGAAGGAGG + Intronic
1172945844 20:38688629-38688651 GGTGAGATGTGGGTGGCAGGAGG - Intergenic
1172950856 20:38722816-38722838 GGATGGGAGGAGGTGGCAGGAGG + Intergenic
1173018195 20:39245695-39245717 TGAGGGAAGAGGGAGGAAGGAGG + Intergenic
1173060090 20:39652216-39652238 GGAGGAAGGAGGGTGGCAGGGGG + Intergenic
1173454145 20:43189927-43189949 GGCGGGACGCGGGGGGCGGGGGG + Exonic
1173517639 20:43676245-43676267 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1173697563 20:45032415-45032437 TGAGGGCAGAGGGTGGGAGGAGG - Intronic
1173800298 20:45890909-45890931 CGATGGAAGCGGGTGGGAGGGGG + Exonic
1173837974 20:46138285-46138307 GCAGGGGATGGGGTGGCAGGAGG - Intergenic
1173870136 20:46336443-46336465 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1173974213 20:47174964-47174986 GGAGGGAGGAGGGGAGCAGGAGG + Intronic
1174109654 20:48189876-48189898 GGCGGGAAGTGGGTGGGAAGAGG + Intergenic
1174130587 20:48341261-48341283 GCAGGGAAGAGGGCTGCAGGGGG - Intergenic
1174216831 20:48922091-48922113 GGGGGGAAGCGGAGGCCAGGAGG - Intronic
1174512598 20:51065620-51065642 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1174568370 20:51483591-51483613 GGGGGGGAGAGGGTGGAAGGTGG - Intronic
1174623442 20:51894821-51894843 GGCAGGAAGGGAGTGGCAGGTGG - Intergenic
1175011060 20:55736530-55736552 GGAGGGTGGAGGGAGGCAGGAGG + Intergenic
1175113034 20:56662413-56662435 CCAGGGAAGCGGGTGGCCTGGGG - Intergenic
1175228794 20:57460736-57460758 GTGGGGAGGCGGGTGGCAAGAGG - Intergenic
1175339993 20:58222545-58222567 GGTGGGCAGTGGGGGGCAGGAGG - Intronic
1175601573 20:60278395-60278417 GGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1175657816 20:60787067-60787089 GGAGGGAAGAGGGTGGTGGAAGG - Intergenic
1175661792 20:60819819-60819841 GGAGGGAGGCAGGAGGCAGGAGG - Intergenic
1175807897 20:61840849-61840871 GGCGGGCAGCGGGTGGCTGCGGG - Intronic
1175828825 20:61951105-61951127 GGAGGGGAGAGGGTGGGAAGAGG - Intergenic
1175828841 20:61951140-61951162 GGAGGGGAGAGGGTGGGAGGGGG - Intergenic
1175832726 20:61975649-61975671 GGAGGGGAGGGGAGGGCAGGGGG + Exonic
1175889376 20:62309601-62309623 GGTGGGAGGAGGGTGGGAGGGGG + Intronic
1175947230 20:62564610-62564632 GGAGGGTCGGGGGTGCCAGGCGG - Intronic
1175978468 20:62725386-62725408 AGTGGGAAGCGGGAGGCGGGAGG + Intronic
1176005802 20:62861720-62861742 GGCGGGAGGCGGGAGGCGGGAGG + Exonic
1176005805 20:62861727-62861749 GGCGGGAGGCGGGAGGCGGGAGG + Exonic
1176057179 20:63154938-63154960 GGAGGGAGGAGGGAGGAAGGAGG - Intergenic
1176257663 20:64160565-64160587 GGAGGGACGCGAGGGGCTGGGGG - Intronic
1176408996 21:6437588-6437610 GCAGGGAGGCAGGTGGGAGGAGG - Intergenic
1176649001 21:9528945-9528967 GGAGGAAAGAGGGTGGCGAGAGG - Intergenic
1176796530 21:13374377-13374399 GGAGAAAAGAGGGTGGCAAGTGG + Intergenic
1176902898 21:14465097-14465119 GGAGGGTGGAGGGTGGAAGGTGG - Intergenic
1177285038 21:19038990-19039012 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
1177967814 21:27750351-27750373 GGAGGGCAGAGGATGGGAGGAGG - Intergenic
1178050483 21:28741542-28741564 GGAGGGTTGTGGGTGGCAGGAGG - Intergenic
1178678330 21:34649689-34649711 GGAGCGAAGAGAGTAGCAGGTGG + Intergenic
1178824562 21:36004828-36004850 GGGGGGAGGCGGGGGGGAGGAGG + Intergenic
1178824596 21:36004891-36004913 GGGGGGGAGGGGGAGGCAGGGGG + Intergenic
1178914546 21:36699258-36699280 GGAGGGGAGCGAGTCGCAGGCGG - Exonic
1178935911 21:36861536-36861558 GGAGGGTAGAGGGTGAAAGGAGG - Intronic
1179042331 21:37815115-37815137 GGAGGGTAGTGGGAGGCTGGGGG + Intronic
1179065888 21:38024625-38024647 GGATGGATGCAGGTGGCAGATGG - Intronic
1179150599 21:38805721-38805743 AGAGGGAAGGGGGCAGCAGGAGG - Intronic
1179380279 21:40892230-40892252 GGAGGGTGGAGGGTGGGAGGTGG + Intergenic
1179411542 21:41167380-41167402 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
1179608802 21:42535655-42535677 GCAGGGAAGCCAGTGGCAAGCGG - Intronic
1179684489 21:43045910-43045932 GCAGGGAGGCAGGTGGGAGGAGG - Intergenic
1179837717 21:44048312-44048334 GGAGGGCAGGGGGTGACAGAGGG - Intronic
1180037694 21:45258170-45258192 GGAGGGAGCCGTGAGGCAGGCGG + Intergenic
1180107921 21:45631977-45631999 TGAGGGAAGAGGCAGGCAGGTGG - Intergenic
1180252309 21:46597580-46597602 GGAGGAATGCAGGTGGGAGGCGG + Intergenic
1180738211 22:18034609-18034631 GGCGGGAGGCGGGTGGAGGGGGG + Intergenic
1180984760 22:19897842-19897864 CGAGGGAGGAGGGTGGCAGTGGG - Intronic
1181082106 22:20422906-20422928 GGGGAGAAGCGGGTGGTGGGAGG + Intergenic
1181094411 22:20495796-20495818 GGAGGGAGGCGGGAGGCGGGAGG + Exonic
1181094414 22:20495803-20495825 GGCGGGAGGCGGGAGGCGGGAGG + Exonic
1181119674 22:20657581-20657603 GGAGAAAAGAGAGTGGCAGGTGG + Intergenic
1181167140 22:20989787-20989809 GGAGGGAGGTGGGAGGCAGGGGG + Intronic
1181425612 22:22835935-22835957 GGAGGGAACTGGGTGGGAGGAGG - Intronic
1181531288 22:23518951-23518973 GGACGGGAGCGGGGGGCTGGAGG + Intergenic
1181737798 22:24895312-24895334 GGAGAGGAGTGGGTGGGAGGGGG - Intronic
1182109919 22:27715658-27715680 GGAGGGAAGAGGCAGGGAGGAGG + Intergenic
1182401287 22:30080012-30080034 GGAGGGAAGCGAGAGCCTGGGGG - Intergenic
1182421591 22:30251088-30251110 GGAAGGAAGCGGGGGGCCAGAGG + Intergenic
1182858811 22:33541066-33541088 GGCGGGGGGCGGGTTGCAGGGGG + Intronic
1183057347 22:35315120-35315142 GGTGGGAGGAGGGAGGCAGGAGG + Intronic
1183208407 22:36434788-36434810 GGAGGGAAGGGGGTGCCTGTGGG + Intergenic
1183225688 22:36548536-36548558 GGTGGGATGAGGATGGCAGGGGG + Intergenic
1183378109 22:37476844-37476866 GGCGGGGAGGGGGTGGCAGCTGG - Intronic
1183701304 22:39452732-39452754 GGAGGGTAGAGGGTGGAGGGTGG + Intergenic
1183722750 22:39571975-39571997 AGAGGGTAGTGGGAGGCAGGAGG + Intronic
1183934703 22:41255529-41255551 GGAGTGATGGGGGTGGGAGGTGG - Intronic
1184037848 22:41926835-41926857 GGGAGGAAGCGGGGGGCGGGGGG + Intergenic
1184230791 22:43157300-43157322 GGAGGGAGGGGCGGGGCAGGAGG + Intronic
1184581790 22:45422902-45422924 GGAGGGGAGTGTGTGGGAGGAGG - Intronic
1184650732 22:45918454-45918476 GGAGGGGACCCGGTGGCAGCAGG + Intergenic
1184655823 22:45941666-45941688 GGAGAGAGGCGAGGGGCAGGTGG + Intronic
1184656857 22:45946288-45946310 GCAGGGAAGGGGGTGCCAGGTGG - Intronic
1184680506 22:46070379-46070401 GGAGGGAACCGTGTGGCCCGGGG + Intronic
1184721596 22:46317729-46317751 GGAAGGACGCCGGTGGCGGGAGG - Intronic
1184758269 22:46529450-46529472 GCTGGGAAGGGGGTAGCAGGAGG + Intronic
1184760004 22:46538445-46538467 GGAGGACAGCGGGGGGCGGGGGG + Intergenic
1184946980 22:47810781-47810803 GGAGGGAAAAGGGAAGCAGGAGG - Intergenic
1185055411 22:48576272-48576294 GGAGGGGAGCGGGCGGGGGGAGG - Intronic
1185059211 22:48597343-48597365 GTGGTGAAGAGGGTGGCAGGTGG - Intronic
1185059236 22:48597446-48597468 GTGGTGAAGAGGGTGGCAGGTGG - Intronic
1185397500 22:50600518-50600540 GGAGGGAAGGGGCGGGCGGGTGG - Intronic
1203275889 22_KI270734v1_random:85532-85554 GGAGGGAACAGGGAGGCAGTAGG + Intergenic
949895843 3:8767218-8767240 GGAGGGAGCCTGGTGGCTGGGGG - Intronic
950106360 3:10391569-10391591 GGAGGCAGGGAGGTGGCAGGAGG + Intronic
950153848 3:10708057-10708079 GGAGGGAGGCGGGCGGGCGGCGG - Intergenic
950263659 3:11559769-11559791 GGAGGACAGAGGGTTGCAGGAGG + Intronic
950527942 3:13535599-13535621 GGAGGGATGCAGGTGGTAGGGGG + Intergenic
950709661 3:14805255-14805277 GGATGGAAGAGGAAGGCAGGTGG - Intergenic
950763672 3:15257292-15257314 GAAGGGAAGCAGCTGGCAGCAGG + Intronic
951217835 3:20040873-20040895 GGCGGGAGGCGAGAGGCAGGAGG - Intronic
951433594 3:22636689-22636711 GGAGGATAGAGGGTGGGAGGAGG - Intergenic
951720548 3:25693217-25693239 GGAGGGTAGAAGGTGGGAGGAGG - Intergenic
952004930 3:28832565-28832587 GGAGGGTTGGGGGTGGGAGGAGG + Intergenic
952085525 3:29815782-29815804 GGAGGGAGAAGGGTGGGAGGGGG + Intronic
952307287 3:32157481-32157503 AGGGGCTAGCGGGTGGCAGGGGG - Intronic
953013469 3:39051268-39051290 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
953030695 3:39177956-39177978 GGTGGGAAGGGGGTGGGAAGGGG + Intergenic
953030700 3:39177967-39177989 GGTGGGAAGGGGGTGGTGGGCGG + Intergenic
953230567 3:41061540-41061562 TGAGGGTAGGGGGTGGGAGGAGG - Intergenic
953448222 3:42985595-42985617 GCAGGGGAGCAGGTGGTAGGTGG + Intronic
953991814 3:47489752-47489774 GGGGGGAAGAGGAGGGCAGGGGG - Intergenic
954053184 3:47999694-47999716 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
954121857 3:48504263-48504285 GGAGGGAGGAGGGAGGAAGGTGG + Exonic
954121859 3:48504270-48504292 GGAGGGAGGAAGGTGGAAGGAGG + Exonic
954368291 3:50157353-50157375 GGAGGCAGGCGGGAGGGAGGAGG - Intronic
954380529 3:50216594-50216616 GGATGGAGGTGGGTGGGAGGAGG - Intronic
954424390 3:50435753-50435775 GGAGGGATGGGGGTGGCGGGAGG - Intronic
954717477 3:52533784-52533806 GGAGGGCGGCGGGCGGCGGGCGG - Intronic
954812409 3:53256147-53256169 GGAGGGGAGCGGGCAGGAGGCGG - Intergenic
954998405 3:54903198-54903220 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
955034131 3:55249839-55249861 GGAGAGCAGAGGGTGGGAGGAGG - Intergenic
955287290 3:57654498-57654520 GGAGAGAAGCAGGTGGCAGGAGG + Intronic
955349300 3:58182191-58182213 GGAGGGAGGAGGGTGGAAGGAGG + Intergenic
955493169 3:59503439-59503461 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
955663476 3:61326102-61326124 GGAGGGAAGGTGGTGGCAGTAGG - Intergenic
955839238 3:63094552-63094574 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
956003274 3:64751620-64751642 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
956212633 3:66817330-66817352 AGAGGGAAGAGGAGGGCAGGAGG + Intergenic
956577451 3:70768959-70768981 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
956790808 3:72678667-72678689 AGAGGGAAGAGGGTGGATGGAGG + Intergenic
958843273 3:99234624-99234646 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
959085681 3:101849219-101849241 GGCGGGAGGCGGGAGGCGGGAGG + Intronic
959098324 3:101981813-101981835 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
959314546 3:104786263-104786285 GGAGGGAGGTGGGTAGCACGTGG + Intergenic
959451386 3:106507390-106507412 TGAGGGCAGAGGGTGGGAGGAGG - Intergenic
959637788 3:108594586-108594608 GGAGGGCAGAGGGTGGGAGGAGG - Intronic
960098167 3:113708205-113708227 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
960272515 3:115690218-115690240 GGTGGGCAGGGGGTGGCGGGGGG - Intronic
960400202 3:117187995-117188017 TGAGGGAAGAGGGTTGGAGGAGG + Intergenic
960953982 3:123018458-123018480 GGAGGGCATCTGGTGTCAGGAGG - Intronic
961212091 3:125133479-125133501 GGTGGGAGGTGGGTGACAGGAGG - Intronic
961358132 3:126351712-126351734 GGAGGGGAGGGAGGGGCAGGCGG - Intronic
961550599 3:127668628-127668650 GGAGGGCAGTGGGAGGCGGGCGG + Intronic
961737349 3:129010502-129010524 GGAGGAAAGGGGGTGGGAGAGGG + Intronic
961799257 3:129432353-129432375 GCGGGGAAGCGGGTGGCATGTGG - Intronic
962714716 3:138116013-138116035 GGAGGGTAGGGGGTGGTGGGTGG - Intergenic
963123317 3:141794124-141794146 GGAGGCAAGCAGGTGGCAGGAGG + Intronic
963407351 3:144882949-144882971 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
963509656 3:146231011-146231033 GGAGGGCAGAAGGTGGGAGGAGG - Intronic
963611297 3:147472126-147472148 GGAGGGTAGAGGGTGGGAGGAGG + Intronic
963677415 3:148329983-148330005 GGAGGGAAGAGGATGTCAGGTGG - Intergenic
963700582 3:148620084-148620106 GGAGGGAAGGGGAGGGAAGGGGG + Intergenic
963963122 3:151332887-151332909 TGAGGGTAGTGGGTGGGAGGAGG - Intronic
963971008 3:151429447-151429469 GGAGAGAAGAGGGTTGGAGGAGG + Intronic
964158838 3:153621284-153621306 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
964256694 3:154782668-154782690 GGAGTGGAGTGGGTGGGAGGTGG - Intergenic
964756959 3:160097217-160097239 AGGGGGAAGTGGGTGGGAGGAGG - Intergenic
965046661 3:163586396-163586418 AAAGGGTAGTGGGTGGCAGGGGG + Intergenic
965123093 3:164589039-164589061 AGAGGGTAGAGGGTGGGAGGAGG - Intergenic
965457299 3:168918759-168918781 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
965563227 3:170081717-170081739 TGAGGGAGGAGGGTGGGAGGAGG - Intronic
965744973 3:171915631-171915653 GGATGGAACTGGGAGGCAGGTGG - Intronic
966270281 3:178096610-178096632 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
966475091 3:180335680-180335702 AGAGGGAGGAGGGTGGGAGGAGG - Intergenic
966563465 3:181349332-181349354 AGAGGGAGGAGGGTGGGAGGAGG + Intergenic
966647785 3:182266100-182266122 GGAGGGTAGAGGGTGGGAGGAGG + Intergenic
966743187 3:183253144-183253166 GGAGGGTGGCGGCTGGCGGGCGG + Intronic
966774130 3:183529146-183529168 GGAGGGTAGAGGGTGGGAAGAGG + Intronic
967033628 3:185631443-185631465 GGAGGGGAGAGGGAGGGAGGGGG - Exonic
967234936 3:187374878-187374900 AGAGGGCAGAGGGTGGGAGGAGG - Intergenic
967593538 3:191304816-191304838 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
967604101 3:191423884-191423906 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
967685380 3:192410266-192410288 GGAGGGAGAGGGGTGGCGGGAGG - Intronic
967782554 3:193456018-193456040 GTAGGGTGGAGGGTGGCAGGAGG + Intronic
968382667 4:109113-109135 GGAGGGAAGCAAGTGAGAGGAGG - Intergenic
968593113 4:1469467-1469489 GGAGGGGAGGTGGTGGGAGGTGG + Intergenic
968652981 4:1767371-1767393 GGAGGGGAGGGAGGGGCAGGAGG - Intergenic
968652990 4:1767389-1767411 GGAGGGGAGGGAGGGGCAGGAGG - Intergenic
968652999 4:1767407-1767429 GGAGGGGAGGGAGGGGCAGGAGG - Intergenic
968659614 4:1793643-1793665 GGAGGGAAGGGGGAGGAGGGAGG + Intronic
968818305 4:2832962-2832984 GGACGGAAGCGGGAGGCTGACGG - Intronic
968862117 4:3180806-3180828 GGAGGGAGGCGGGGGGTGGGGGG + Intronic
968883002 4:3310682-3310704 GGTGGGAGGGGGGTGCCAGGTGG + Intronic
968890360 4:3365402-3365424 GGAGGGAGGAGGGAGGGAGGTGG + Intronic
968941371 4:3640465-3640487 GGAGGGAAGAGGGGCTCAGGCGG + Intergenic
969082597 4:4630826-4630848 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
969143552 4:5100746-5100768 GGAGGGAGGAGGGAGGGAGGAGG - Intronic
969315925 4:6381272-6381294 AGAGGGAAGAGGAGGGCAGGAGG - Intronic
969343461 4:6556867-6556889 GGAGGGAAGGGGGAAGGAGGCGG + Intronic
969488288 4:7484780-7484802 GGAGGGAGGCTGGGTGCAGGAGG - Intronic
969500143 4:7547641-7547663 GGAGGGAGGTGGGTGGAAGGAGG - Intronic
969685559 4:8672158-8672180 TGAGGGCAGCAGGTGGGAGGAGG + Intergenic
969867355 4:10084579-10084601 GGTGGAAAGCGGGTGGCAGAGGG - Intronic
970063022 4:12056625-12056647 GGACAGAAGCTGGAGGCAGGGGG + Intergenic
970218346 4:13782447-13782469 GGTGGGAAGGGAGTGACAGGTGG + Intergenic
970531978 4:16994183-16994205 GGAGGCAAGCTGCTGGCAGTGGG - Intergenic
970624712 4:17863995-17864017 TGAGGGCAGAGGGTGGGAGGAGG + Intronic
970911215 4:21278344-21278366 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
970945303 4:21683974-21683996 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
971012962 4:22459316-22459338 GGAGGGAGGAGGGTGGAAGGAGG + Intronic
971373286 4:26035302-26035324 GGAGGTATGCTGGTGGAAGGTGG - Intergenic
972127732 4:35790171-35790193 GGAGGGAAGGGGGAGGGAAGGGG + Intergenic
972445391 4:39138601-39138623 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
972814049 4:42623694-42623716 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
972833684 4:42843080-42843102 TGTGGGAAGCTGGTGGAAGGTGG + Intergenic
973566043 4:52188647-52188669 TGAGGGCAGAGGGTGGGAGGAGG - Intergenic
973575331 4:52282170-52282192 GGAGGGTATAGGGTGGGAGGAGG + Intergenic
973761039 4:54116075-54116097 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
973986451 4:56359326-56359348 GGCGGGAGGCAGGAGGCAGGAGG - Intronic
974482978 4:62470282-62470304 GGAGGGAAGGGGAGGGGAGGGGG - Intergenic
974482999 4:62470318-62470340 GGAGGGAAGGGGAGGGGAGGGGG - Intergenic
974539172 4:63211241-63211263 TGAGGGAAAAGGGTGGGAGGAGG + Intergenic
974945635 4:68525107-68525129 GGAGGGTAGAAGGTGGGAGGGGG + Intergenic
974955551 4:68636605-68636627 GGAGGGTAGAAGGTGGGAGGGGG + Intronic
975329603 4:73099260-73099282 GGAAGGATGGGGGTGGCAGCCGG - Intronic
975400328 4:73929963-73929985 GGAGGGTGGAGGGTGGGAGGGGG + Intergenic
975622843 4:76310964-76310986 AGAGGGAAGAGGGTGACAGATGG - Exonic
975905349 4:79204705-79204727 GAAGGGGAGTGGGTGGGAGGAGG - Intergenic
976040569 4:80880127-80880149 GGAGGGAAGCGGGGAGAAAGGGG + Intronic
976068398 4:81215254-81215276 GGAGGGAAGGAGGAGGGAGGGGG + Intergenic
976277557 4:83292856-83292878 GAAGGGAAGAGGGCGGAAGGAGG + Exonic
976299066 4:83500948-83500970 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
976443494 4:85104042-85104064 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
976753769 4:88477310-88477332 GGAGGGAAGGGGAAGGGAGGGGG + Intronic
977027353 4:91835285-91835307 AGAGGGGAGAGGGTGGGAGGAGG + Intergenic
977566214 4:98583403-98583425 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
977636644 4:99305781-99305803 GGAGGAAGGCGGGTGGGAGCTGG + Exonic
978092779 4:104738313-104738335 GGAGGGTAGTGGGTCGGAGGTGG + Intergenic
978155372 4:105484051-105484073 GGATGTCAGCGGGTGGCAGGGGG - Intergenic
978293256 4:107171950-107171972 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
978352029 4:107830022-107830044 TGAGGGCAGAGGGTGGGAGGAGG - Intronic
978400904 4:108329655-108329677 GGAGGGAGGAGGGAGGGAGGAGG + Intergenic
978430957 4:108633056-108633078 GCAGGGTAGAGGGTGGGAGGAGG - Intergenic
978621372 4:110637235-110637257 GGAGGGAAGCAGATGCCAGCGGG + Intronic
978647310 4:110951499-110951521 GGTGGGTAGAGGGTGGGAGGAGG - Intergenic
978705086 4:111698436-111698458 GGGGGGAAGTGGGAGGGAGGGGG + Intergenic
978705090 4:111698447-111698469 GGAGGGAGGGGGGAGGAAGGAGG + Intergenic
978968107 4:114767818-114767840 GCAGGGCAGAGGGTGGGAGGAGG + Intergenic
978990131 4:115070401-115070423 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
979842428 4:125460427-125460449 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
979991087 4:127376326-127376348 GGAGGGTAGAGGGTGAGAGGAGG + Intergenic
980144652 4:128967003-128967025 GGAGGGTAGGGGATGGGAGGAGG - Intronic
980670414 4:135997215-135997237 GGAGGGGAGAGGGTAGGAGGAGG + Intergenic
980878653 4:138687364-138687386 GGAGGGATGCGGTTGGCTGGTGG - Intergenic
980894971 4:138853307-138853329 GCAGGCAAGTGGGTGGGAGGAGG + Intergenic
981198369 4:141946985-141947007 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
981627156 4:146771403-146771425 GGAGGGCAGAGGGTGGTAGGAGG - Intronic
982017362 4:151168260-151168282 GAAGGGAAGCAGGTTGCAGAAGG + Intronic
982525183 4:156468506-156468528 GAAGGGTAGAGGGTGGAAGGAGG + Intergenic
982600044 4:157437667-157437689 GGAGGGGAGAGGTTGGGAGGAGG - Intergenic
982646662 4:158032345-158032367 GGAGGGTGGAGGGTGGGAGGTGG + Intergenic
982979636 4:162116501-162116523 GGTGGGAGTTGGGTGGCAGGGGG - Intronic
983508413 4:168580969-168580991 GGAGGGAAGAAGGTTGGAGGTGG + Intronic
983584292 4:169338998-169339020 GGAGGGTAGAGGGTGGGAGGTGG - Intergenic
983683497 4:170380196-170380218 TGAGGGTAGAGGGTGGAAGGAGG - Intergenic
983696913 4:170543613-170543635 GGGGGGTAGAGGGTGGGAGGAGG + Intergenic
983728427 4:170961035-170961057 GGAGGGTAGAGGGTGGGAGGAGG + Intergenic
983903893 4:173165576-173165598 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
983922850 4:173365857-173365879 GGAGGAAGGGAGGTGGCAGGAGG + Intergenic
983938438 4:173518849-173518871 GGCGGGAAGCGGGGAGCAGGGGG - Intergenic
984027901 4:174567093-174567115 TGAGGGTGGAGGGTGGCAGGAGG + Intergenic
984374510 4:178910611-178910633 GGAGGGTTGAGGGTGGAAGGAGG - Intergenic
984439762 4:179751832-179751854 GGAGGAGAGAGGGTGGGAGGAGG - Intergenic
984516628 4:180749484-180749506 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
984589121 4:181596931-181596953 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
985058980 4:186057855-186057877 GGCGGGAGGTGGGTGGCGGGAGG - Intergenic
985058986 4:186057869-186057891 GGCGGGAGGTGGGTGGCGGGAGG - Intergenic
985058997 4:186057897-186057919 GGCGGGAGGTGGGTGGCTGGAGG - Intergenic
985059007 4:186057925-186057947 GGCGGGAGGTGGGTGGCTGGAGG - Intergenic
985059012 4:186057939-186057961 GGTGGGAGGTGGGTGGCGGGAGG - Intergenic
985692291 5:1319976-1319998 GGAGGGAAGCGGGAGGCCCAGGG + Intronic
985891351 5:2717572-2717594 AGAGGGAAAGGGGAGGCAGGAGG - Intergenic
986217435 5:5732656-5732678 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
986228469 5:5839265-5839287 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
986296244 5:6441122-6441144 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
986342481 5:6802658-6802680 GGAGGGCAGAGGGTGGGAGGAGG + Intergenic
986435266 5:7723144-7723166 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
986517683 5:8581063-8581085 AGAGGGAGGCAGGTGGGAGGAGG - Intergenic
986935577 5:12881447-12881469 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
986992386 5:13569543-13569565 GGATTGAAGCGGGTAGCAGTGGG + Intergenic
987361510 5:17111531-17111553 GGAGGGAAGGAGGGGGGAGGGGG - Intronic
987373772 5:17216946-17216968 GAAGGGTAGCTGGTGCCAGGGGG + Intronic
987629664 5:20452605-20452627 TGAGGGTGGAGGGTGGCAGGAGG + Intronic
988004064 5:25385067-25385089 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
988154371 5:27431037-27431059 GGAGGGTAGAGAGTGGCAAGAGG + Intergenic
988314749 5:29610362-29610384 GGAGTGAAGCTGTTGGCAGCTGG - Intergenic
988619382 5:32807208-32807230 GGAGGGCGGAGGGTGGGAGGAGG - Intergenic
988862651 5:35300605-35300627 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
989043189 5:37249543-37249565 GGAGGGGAGCGCGCGGGAGGAGG - Intergenic
989261557 5:39424697-39424719 GAAGGGTAGCGGGGGGCGGGGGG + Intronic
990169181 5:53028907-53028929 GAAGGGAAGCTGAAGGCAGGTGG - Intronic
990475958 5:56162086-56162108 GGAGGGAAGGGCAAGGCAGGAGG + Intronic
991342895 5:65631518-65631540 TGAGGGTAGAAGGTGGCAGGGGG - Intronic
991539790 5:67714733-67714755 GGAGGGCAGGTGGTGGGAGGAGG - Intergenic
991972027 5:72150644-72150666 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
992014787 5:72564934-72564956 GGTGGGAAGAGGGTGGGAAGTGG - Intergenic
992115121 5:73532213-73532235 GGAGGGGTGAGGGTGGGAGGAGG + Intergenic
992240770 5:74767149-74767171 GGACGGAAGTTGCTGGCAGGCGG - Exonic
992248580 5:74854595-74854617 GGAGGGTAGTGGGTGGTGGGAGG - Intronic
992276395 5:75124814-75124836 GAAGGGTAGGGGGTGGGAGGGGG + Intronic
992390559 5:76327133-76327155 GAAGGGGAGGGGGAGGCAGGGGG - Exonic
992520158 5:77542272-77542294 GGAGGGTAAAGGGTGGGAGGAGG + Intronic
992819878 5:80485767-80485789 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
993275900 5:85858222-85858244 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
993467791 5:88269162-88269184 GGAGGGGGGCGGGTGGGGGGCGG + Intronic
993633861 5:90320350-90320372 TGAGGGCAGAGGGTGGAAGGAGG - Intergenic
993638076 5:90369985-90370007 GGAGGCAGGAGGGTGCCAGGAGG + Intergenic
993697348 5:91077577-91077599 GGAGGGAAGGGGTTGACAGTGGG - Intronic
993921101 5:93803559-93803581 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
993972372 5:94435278-94435300 GGAGGGTGGGGGGTGGGAGGAGG - Intronic
994058770 5:95449699-95449721 GGAGGGAGGAGGGCAGCAGGGGG + Intronic
994190437 5:96863145-96863167 GGAGTGAAGGTGGGGGCAGGGGG - Intronic
994272238 5:97792260-97792282 GGAGGGTAGAGGGTGGGAGGAGG + Intergenic
994403923 5:99319199-99319221 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
994457195 5:100025705-100025727 GGGGGGGGGCGGGGGGCAGGGGG + Intergenic
994645698 5:102466171-102466193 GGAGGGCAGAGGGTGGGGGGAGG - Intronic
994653924 5:102565289-102565311 GAAGGGAAGTGAGTGGCTGGGGG - Intergenic
994718332 5:103350521-103350543 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
994908345 5:105868924-105868946 GGGGATAAGGGGGTGGCAGGTGG + Intergenic
995021124 5:107368451-107368473 GGATGGGAGGGGGTGGCAGTGGG - Intergenic
995124298 5:108564751-108564773 GGAGAGAAGTGGGAGGCAGTTGG + Intergenic
995158529 5:108945562-108945584 GGAGAAAGGCGGGTGGGAGGAGG - Intronic
995211516 5:109544902-109544924 GGAGGGTAGTGGGTGGGAGGAGG - Intergenic
995300722 5:110577870-110577892 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
995450677 5:112296752-112296774 GGAGGGAAGGGGTAGGAAGGGGG - Intronic
995483886 5:112619598-112619620 GGATGGCAGTGGGGGGCAGGAGG + Intergenic
995555002 5:113318679-113318701 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
996046522 5:118879801-118879823 GGAGGGTAGAGAGTGGGAGGAGG + Intronic
996218765 5:120902717-120902739 AAAGGGAAGAGGGTGGGAGGGGG - Intergenic
996539612 5:124615974-124615996 GGAGGGAGGAGGTTGGAAGGAGG - Intergenic
996698930 5:126429382-126429404 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
996788852 5:127270712-127270734 AGAGGGCAGGGGGTGGGAGGAGG - Intergenic
996928556 5:128858601-128858623 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
997926199 5:138033066-138033088 GGAGGAGAGCGGCTGGCGGGCGG + Intronic
998007136 5:138664566-138664588 GGAGAGAAGCAGGTTGTAGGAGG + Intronic
998029484 5:138852735-138852757 GGAGAGAGGCGGGTAGAAGGAGG - Intronic
998201200 5:140123853-140123875 GAAGTGAAGTGGGTGGCAAGTGG + Exonic
998264802 5:140659893-140659915 GGAGGGAGCAGGGAGGCAGGGGG - Intronic
998406736 5:141878488-141878510 GGAGGGAGGGGGGAGGGAGGGGG - Intronic
998595668 5:143527327-143527349 GGAGGGTAGAAGGTGGGAGGAGG + Intergenic
998729597 5:145059861-145059883 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
998962007 5:147498079-147498101 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
999279322 5:150354656-150354678 GGAGGGATGAGGGAGGCAGTGGG - Intergenic
999279451 5:150355465-150355487 GGGGGGGGGCGGGTGGTAGGTGG - Intergenic
999300234 5:150486217-150486239 GGAGGAGAGCGGGCGGGAGGAGG + Intronic
1000786970 5:165556760-165556782 GGAGGGTAGCGGGTGGGAGGAGG + Intergenic
1000823054 5:166009307-166009329 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1000992552 5:167925952-167925974 TGAGGGAATAGGGTGGGAGGAGG + Intronic
1001152607 5:169245322-169245344 TGAGTGAAGCGTGTGGCTGGAGG - Intronic
1001178869 5:169499615-169499637 GGAGGGTAAAGGGTGGAAGGAGG - Intergenic
1001182869 5:169537387-169537409 GGTGGGGGGCGGGTGGCAAGAGG - Intergenic
1001206275 5:169766214-169766236 TGAGGGTAGAGGGTGGGAGGAGG - Intronic
1001223471 5:169924063-169924085 GGGAGGAAGAGGGTGGCAGGAGG - Intronic
1001245623 5:170104259-170104281 GGAGGCAAGCGGGAGCGAGGTGG + Intergenic
1001566118 5:172700596-172700618 GGAGTAAGGCGGGAGGCAGGAGG - Intergenic
1001824324 5:174733284-174733306 GGAGGGAGCAGGGCGGCAGGAGG + Intergenic
1001824401 5:174733748-174733770 GGAGGTGAGAGGGTGGCTGGGGG - Intergenic
1001829559 5:174774109-174774131 GTGGGGAAGGGTGTGGCAGGAGG - Intergenic
1002368974 5:178734706-178734728 GGAGGGAGAAGGGTGGGAGGAGG - Intergenic
1002482620 5:179513305-179513327 GGAGGGAGGGGGGAGGGAGGAGG - Intergenic
1002620633 5:180485732-180485754 CGAAGGAAGCAGCTGGCAGGAGG + Intergenic
1002689090 5:181037829-181037851 TGAGAGCAGCAGGTGGCAGGAGG + Intergenic
1002888762 6:1316979-1317001 GGCGGGAAGGGGGTGGGCGGGGG - Intergenic
1003137351 6:3443969-3443991 GCAGGGCAGCAGGTGGAAGGTGG - Intronic
1003636113 6:7832938-7832960 TGAGGGACGAGGGTGGGAGGTGG + Intronic
1003737185 6:8889901-8889923 GGAGGGTGGTGGGTGGGAGGAGG + Intergenic
1003823291 6:9924469-9924491 TGAGGGAGGAGGGTGGGAGGAGG + Intronic
1003891655 6:10569212-10569234 CGGGGGGAGTGGGTGGCAGGGGG - Intronic
1004409063 6:15363499-15363521 ACAGGGAAACAGGTGGCAGGTGG - Intronic
1004465427 6:15880814-15880836 TGAGGGAGGAGGGTAGCAGGAGG - Intergenic
1004750192 6:18554670-18554692 GTAGGGAAGTGAGTGGCAAGAGG + Intergenic
1005102072 6:22182091-22182113 TGAGGGTAGAGGGTGGAAGGAGG - Intergenic
1005244914 6:23872647-23872669 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1005358769 6:25010310-25010332 GGAGGAAAGGGGGAGGAAGGAGG - Intronic
1005837288 6:29718882-29718904 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
1006113564 6:31763260-31763282 GGAGGGCAAGGGGAGGCAGGCGG - Intronic
1006213161 6:32414531-32414553 GGAGGGAGGGGGGAGGAAGGAGG + Intergenic
1006420562 6:33931291-33931313 GGAGGGTAGCGGGTGAGAGATGG + Intergenic
1006428807 6:33982686-33982708 AAAGGAAAGTGGGTGGCAGGGGG + Intergenic
1006457962 6:34142815-34142837 GGAGGGAGGAGGGGGGGAGGAGG + Intronic
1006502132 6:34465905-34465927 GGCGGGTGGCGGGTGGCGGGTGG - Intergenic
1006826100 6:36937491-36937513 TGAGGGAACCAGATGGCAGGAGG - Intergenic
1006933476 6:37701386-37701408 GGAGGCGAGCTAGTGGCAGGAGG - Intergenic
1007184365 6:39955647-39955669 AGAGGGAAGAGGGTGGGAGGAGG + Intergenic
1007257362 6:40538345-40538367 GGAAGGTAGTGGGTGGCAGGGGG - Intronic
1007286727 6:40753250-40753272 GGTGGGGAGAGGGTGGCTGGTGG - Intergenic
1007336576 6:41159023-41159045 GGATGGAAGTGGGTGGGAAGGGG + Exonic
1007397647 6:41586727-41586749 GGAGGGAGGCGGGAGGAGGGAGG + Intronic
1007473860 6:42106698-42106720 GGAGGGAGGGGGGGTGCAGGAGG + Exonic
1007692936 6:43714629-43714651 GGAGGGAAGAGAGCGGGAGGAGG - Intergenic
1007751714 6:44075346-44075368 GGAGGATACCTGGTGGCAGGAGG - Intergenic
1007874836 6:45084959-45084981 GGAGGTAAGAGGGAGGGAGGGGG + Intronic
1007973019 6:46072083-46072105 GGAGGGTAGAGGGTGGGAGGAGG + Intronic
1008026372 6:46640761-46640783 GGAGGGGGGTGGGCGGCAGGGGG - Intronic
1008191120 6:48459394-48459416 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
1008379224 6:50823540-50823562 GTAGGGGAGCGGCTGGTAGGGGG - Exonic
1008501936 6:52191719-52191741 GGAGGGCAGCGTGTGACTGGAGG - Intergenic
1008764291 6:54892414-54892436 GGAGAGTAGAGGGTGGGAGGAGG - Intronic
1008920935 6:56843699-56843721 GGAGGGAGGAGGGTGGAGGGTGG + Intronic
1009288946 6:61860363-61860385 GGGGGGCAGAGGGTGGGAGGAGG - Intronic
1009423082 6:63485178-63485200 GGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1009465480 6:63963115-63963137 GGGGGGAAGGGGGAGGCGGGAGG + Intronic
1009492557 6:64310584-64310606 GGAGGGTAGAGGGTGGAAGAAGG + Intronic
1009734476 6:67659217-67659239 GGAGGGTAGAGGGTGAGAGGAGG - Intergenic
1009842177 6:69091638-69091660 GGAGGCTGGCGGGTGGGAGGAGG + Intronic
1009893320 6:69715766-69715788 GGAGGGCAGAGGGTGGAAGGAGG - Intronic
1009957341 6:70471560-70471582 GGAGGATAGGGGGTGGGAGGAGG + Intronic
1010252611 6:73723740-73723762 GGAGGGTAGAGGGAGGGAGGAGG + Intronic
1010659026 6:78547314-78547336 GGAGGGTAGAGAGTGGGAGGAGG - Intergenic
1011153886 6:84307253-84307275 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1011406709 6:87022877-87022899 GGAGGGAAGGGGAGGGGAGGGGG + Intergenic
1011833571 6:91403560-91403582 GGAGGGAAGAGGGTAGGAGGAGG - Intergenic
1011879441 6:92006513-92006535 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1011921576 6:92583490-92583512 GAAGAGAACTGGGTGGCAGGAGG + Intergenic
1012161875 6:95895356-95895378 GGAGGGTAGACGGTGGGAGGTGG - Intergenic
1012359456 6:98359358-98359380 AGAGGGCAGAGGGTGGGAGGAGG - Intergenic
1012435818 6:99214324-99214346 AGAGGGAAGAGGGAGGAAGGGGG + Intergenic
1013254040 6:108365875-108365897 TGTGGGAAGCGGGTGGGAAGAGG + Intronic
1013620149 6:111879948-111879970 GGAGGGAGTTGGGGGGCAGGAGG + Intergenic
1013659096 6:112276435-112276457 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1013766582 6:113581019-113581041 TGAGGGTTGAGGGTGGCAGGAGG + Intergenic
1014019846 6:116574743-116574765 GGAGGGAAGGGGAGGGGAGGTGG - Intronic
1014192458 6:118513243-118513265 GGAGGTAAGAAGGTGGCAGGGGG + Intronic
1014535788 6:122611142-122611164 GGAGGGACACGAGTGCCAGGTGG + Intronic
1014594384 6:123314841-123314863 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1014613763 6:123577290-123577312 TGAGGGTGGAGGGTGGCAGGAGG - Intronic
1014777009 6:125522785-125522807 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1014795631 6:125721040-125721062 GGAGGGTAGTGAGTGGGAGGAGG - Intergenic
1015322257 6:131889376-131889398 GGAGGGCAGGGGGTGGGAGGAGG - Intronic
1015380365 6:132560469-132560491 CGAGGGAGGAGGGTGGAAGGAGG + Intergenic
1015449924 6:133355234-133355256 GAAGGGTGGAGGGTGGCAGGAGG - Intronic
1015481615 6:133717434-133717456 GGAGGGTAGAGGATGGGAGGAGG + Intergenic
1015838808 6:137453722-137453744 GGAGGGTGGCTGGTGGGAGGAGG - Intergenic
1015849001 6:137552407-137552429 GGAAGGAAGGGGGAGGAAGGGGG - Intergenic
1015910122 6:138161680-138161702 GGCGGGCGGCGGGAGGCAGGCGG - Intergenic
1016287931 6:142493966-142493988 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1016454248 6:144215085-144215107 GGCGGGTGGCAGGTGGCAGGTGG + Intergenic
1016546735 6:145232483-145232505 TGAGGGCAGAGGGTGGGAGGAGG - Intergenic
1016662304 6:146596036-146596058 GGAGGGAACTGGGTGGGAGATGG - Intergenic
1016733905 6:147455242-147455264 GGAGGGTGGAGGGTGGCAGGAGG + Intergenic
1017164190 6:151391712-151391734 GGAGGGGAGCGGCTGGGGGGGGG - Intergenic
1017223087 6:151988569-151988591 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1017444452 6:154494696-154494718 TGAAGGAAGAGGGTGGCAGAGGG - Intronic
1017555854 6:155567449-155567471 TCAGGGAAAAGGGTGGCAGGGGG - Intergenic
1017611635 6:156193039-156193061 TGAGGGAGGAGGGTGGGAGGAGG - Intergenic
1017945209 6:159091040-159091062 GGAGGTCAGCAGGTGGCGGGCGG - Intergenic
1018001450 6:159582017-159582039 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1018017744 6:159727375-159727397 GGCGGGAGGCGGGAGGCGGGAGG + Intronic
1018017747 6:159727382-159727404 GGCGGGAGGCGGGAGGCGGGAGG + Intronic
1018149222 6:160923073-160923095 GGCGGGCAGAGTGTGGCAGGAGG - Intergenic
1018316010 6:162557329-162557351 TCAGGGAAGCTGGTGGCATGAGG - Intronic
1018323411 6:162637260-162637282 GGGGGGGGGCGGGTGGGAGGAGG - Intronic
1018429777 6:163713686-163713708 GGAGGGAAGTGGGAGGTAAGGGG - Intergenic
1018433345 6:163740661-163740683 GCAGGGAAGAGGCTGGGAGGAGG + Intergenic
1018469517 6:164083276-164083298 GGGGTGATGCGGGGGGCAGGGGG + Intergenic
1018985855 6:168636844-168636866 GGCGGGAGGAGGGAGGCAGGAGG - Intronic
1018985857 6:168636851-168636873 GGAGGGAGGCGGGAGGAGGGAGG - Intronic
1018985863 6:168636865-168636887 GGAGGGAGGCGGGAGGAGGGAGG - Intronic
1018985903 6:168636962-168636984 GGAGGAAAGCAGGAGGGAGGAGG - Intronic
1019151744 6:170010989-170011011 GGAGGGAGGGAGGAGGCAGGCGG + Intergenic
1019160738 6:170065945-170065967 GGAGGGATGGGGGTGGATGGAGG - Intergenic
1019160942 6:170066541-170066563 GGAGGGATGGGGGTGGATGGAGG - Intergenic
1019160950 6:170066559-170066581 GGAGGGATGGGGGTGGATGGAGG - Intergenic
1019279130 7:191575-191597 GGAGGTAAGTGTGTGGGAGGAGG - Intergenic
1019404740 7:877458-877480 GGAGAGAGGCGGGGGGCAGAGGG - Intronic
1019421749 7:954131-954153 GGAGGGGAGGCGGCGGCAGGGGG + Intronic
1019438575 7:1034756-1034778 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1019458824 7:1146455-1146477 GGAGGGAGGCGGGGGGGGGGGGG - Intergenic
1019576394 7:1739680-1739702 GGAGTGGAGAGGGCGGCAGGAGG + Intronic
1019705488 7:2495434-2495456 GGAGAGAGGCTGGTGGCTGGAGG + Intergenic
1019853529 7:3582529-3582551 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1019994823 7:4717299-4717321 GGATGGAAGGTGGTGGCGGGAGG + Intronic
1020093065 7:5352244-5352266 GGAGGGGAGCTGGTGACATGGGG - Intronic
1020433751 7:8140305-8140327 GAGGGGGAGCGAGTGGCAGGAGG - Intronic
1020657007 7:10940194-10940216 GGAGGGCAGCTTGCGGCAGGAGG + Exonic
1021004890 7:15382021-15382043 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1021572494 7:22080616-22080638 TGAGGGAAGAGGGTGGGAGGAGG + Intergenic
1021574425 7:22094272-22094294 AGAGGGAAGGCAGTGGCAGGAGG + Intergenic
1021608832 7:22436537-22436559 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1021929122 7:25562139-25562161 GCAGGGACGGGGGTGGGAGGTGG - Intergenic
1022042868 7:26597069-26597091 GAAGGGAGGCAGGAGGCAGGAGG - Intergenic
1022083713 7:27046580-27046602 AGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1022177637 7:27887123-27887145 GGAGGGTAAAGGGTGGGAGGAGG + Intronic
1022183192 7:27941868-27941890 GGAGGGAAGCTGCTGGAAAGTGG + Intronic
1022396368 7:29990674-29990696 GGCGGGAGGCGGGAGGCAGGAGG - Intergenic
1022396370 7:29990681-29990703 GGCGGGAGGCGGGAGGCGGGAGG - Intergenic
1022503716 7:30897769-30897791 GAAGGAAAGTGGGTGGGAGGAGG + Intergenic
1022626795 7:32045053-32045075 GGAAGGGAGGGGGTGGGAGGGGG - Intronic
1022737311 7:33088413-33088435 GGAGAGAGGAGGGTGGGAGGAGG - Intergenic
1022776959 7:33536682-33536704 GGGGGGAGGCGGGGGGCGGGGGG - Intronic
1022865327 7:34412307-34412329 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1023822185 7:43986434-43986456 TGGGGGAAGGGGGTGGCTGGGGG + Intergenic
1023876497 7:44289118-44289140 GGAGGGAAGAGGCAGGCACGAGG - Intronic
1023917034 7:44597147-44597169 AGAGGGGAGGGGGAGGCAGGGGG + Intergenic
1024054286 7:45649691-45649713 GGAAGGAGGCGGTTGGGAGGAGG + Intronic
1024462715 7:49675352-49675374 GGTGGGTGGAGGGTGGCAGGAGG - Intergenic
1024615620 7:51109120-51109142 GGAGGGAAGAGGCTGCCTGGTGG - Intronic
1024965274 7:55018784-55018806 GGAGGGGAGCGGGTGCCCTGAGG - Intergenic
1025016274 7:55441237-55441259 GGAGGGAAGGGGGAGGAAGTGGG + Intronic
1025275530 7:57578995-57579017 GGAAGGAAGAGGGTGGCAAGAGG - Intergenic
1025853343 7:65259310-65259332 GGAGGGAGGCGGGGGGGGGGGGG + Intergenic
1026115496 7:67492293-67492315 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1026209590 7:68292094-68292116 TGAGGGTAGCAGGTGGGAGGAGG + Intergenic
1026576227 7:71573820-71573842 TGAGGGCAGAGGGTGGGAGGAGG - Intronic
1026579467 7:71601836-71601858 AGAGGGAAGAAGGAGGCAGGGGG + Intronic
1026590764 7:71693645-71693667 GGAGGGTAGGGGGTGGAGGGTGG + Intronic
1027190984 7:75995280-75995302 GGAGGGATGGGGGTGGGAGGGGG - Intergenic
1027302189 7:76851459-76851481 GAAGGCAACCAGGTGGCAGGTGG - Intergenic
1027346082 7:77261264-77261286 GGAGGGTAGAGGATGGGAGGAGG - Intronic
1028040330 7:86044517-86044539 GGAGGGTGGAGGGTGGAAGGAGG - Intergenic
1028498060 7:91484446-91484468 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1028913399 7:96232440-96232462 GGAGGGTAGAAGGTGGGAGGAGG + Intronic
1029004319 7:97191684-97191706 GGAGGGTGGGGAGTGGCAGGAGG + Intergenic
1029164210 7:98575158-98575180 AGAGGGCAGGGGGTGGGAGGAGG - Intergenic
1029177394 7:98674723-98674745 GGATGGAAGCTGGAGGCTGGAGG + Intergenic
1029238567 7:99143302-99143324 GAAGGGAAGCGAGAGGCAAGGGG + Intronic
1029490994 7:100869811-100869833 GGATGGGAGGGGGTGGGAGGGGG + Intronic
1029537959 7:101166809-101166831 GGAGAGGAGAGGGTGGCAAGGGG + Intergenic
1029647490 7:101867407-101867429 GGTGAGAACAGGGTGGCAGGTGG - Intronic
1029750451 7:102539848-102539870 TGGGGGAAGGGGGTGGCTGGGGG + Intronic
1029768403 7:102638956-102638978 TGGGGGAAGGGGGTGGCTGGGGG + Intronic
1029944451 7:104517141-104517163 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1030099199 7:105930207-105930229 GGAGGAGATGGGGTGGCAGGTGG - Intronic
1030380362 7:108803962-108803984 GGAGGAGAGAGGGAGGCAGGGGG - Intergenic
1030982771 7:116206272-116206294 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1031016217 7:116579565-116579587 GGAGGGCAGGAGGTGGGAGGAGG - Intergenic
1031586345 7:123535147-123535169 GGAGGGAAGCGGCAGGGAGAAGG + Intergenic
1032012313 7:128354677-128354699 GGAGTGAGGGGGCTGGCAGGTGG + Intronic
1032019907 7:128401540-128401562 GGAGGGAAGGGAGAGGCAGGAGG + Intronic
1032130655 7:129224992-129225014 GGAGGGAAGAGGAAGGGAGGTGG + Intergenic
1032339114 7:131054526-131054548 GGAGGGAGGAGGGAGGGAGGAGG + Intergenic
1032432321 7:131872129-131872151 GGAGGGATGAGGGTGGCAGATGG - Intergenic
1032461871 7:132117853-132117875 GGAGGGCAGGGGGTGCCTGGGGG + Intergenic
1032604472 7:133334700-133334722 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1033064288 7:138138694-138138716 GAAGGGAAGAGGGTGAGAGGGGG + Intergenic
1033769046 7:144527934-144527956 TGAGGGCAGAGGGTGGGAGGCGG + Intronic
1033769051 7:144527945-144527967 GGTGGGAGGCGGGTGGGAGGCGG + Intronic
1033769056 7:144527956-144527978 GGTGGGAGGCGGGTGGGAGGAGG + Intronic
1033928396 7:146492207-146492229 TGAGAGAAGAGGGGGGCAGGAGG + Intronic
1033943221 7:146681466-146681488 AGAGGGTAGAGGGTGGAAGGTGG + Intronic
1034278452 7:149834954-149834976 GGAGTGACCAGGGTGGCAGGTGG - Intergenic
1034359196 7:150479161-150479183 TGAGGGTGGAGGGTGGCAGGAGG + Exonic
1034463309 7:151210413-151210435 GGAGGGGGGGGGGGGGCAGGTGG + Intronic
1034467758 7:151239804-151239826 GAAAGGAAGCGGGTGGGAAGGGG + Intronic
1034638467 7:152585578-152585600 GGAGGGAGGCGGGGGGGGGGGGG - Intergenic
1034723298 7:153314805-153314827 GGAGGGAGGTGGGTGGGGGGGGG - Intergenic
1034738476 7:153451559-153451581 GGAGTGAGTAGGGTGGCAGGAGG + Intergenic
1034757394 7:153635539-153635561 GGAGGGAGGGGGGAGGGAGGGGG - Intergenic
1035167605 7:157000604-157000626 GGAGGGAAGGGGGAGGCCGCGGG + Intronic
1035252888 7:157608675-157608697 GAAGGGAAGCAGGTGGCCTGGGG + Intronic
1035331690 7:158100028-158100050 TCAGGGAAAAGGGTGGCAGGAGG - Intronic
1035417035 7:158697934-158697956 GGAGGGTAGAGGGTGGGAGGAGG + Intronic
1035437735 7:158871647-158871669 GGAGGGAAGCGGGGGAGAGAGGG - Intronic
1035587211 8:785682-785704 GGAGGGAAGCCGGTCTCAGAGGG - Intergenic
1035774508 8:2177938-2177960 GGAGGGTAGAGGGTGGAAGGAGG - Intergenic
1035910700 8:3562767-3562789 GGAGGGTGGAGGGTGGGAGGGGG + Intronic
1036171446 8:6489307-6489329 AGGGGGAAGGGGGAGGCAGGGGG + Intronic
1036338712 8:7895785-7895807 GGAGGCAGGCTGGTGGGAGGGGG + Intronic
1036440439 8:8777146-8777168 GGAGGGGTGGGGGTGGCATGGGG - Intergenic
1036460348 8:8947107-8947129 CAGGGGAAGCGGGTGGGAGGAGG - Intergenic
1036569766 8:9969965-9969987 GGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1036663787 8:10726023-10726045 GGAGTGGAGTGGGTGGTAGGTGG + Exonic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1037081707 8:14795817-14795839 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1037278267 8:17204657-17204679 GGAGGGAGGAGGGTGGGAGGAGG + Intronic
1037501936 8:19494884-19494906 GGCGGGGGGCGGGGGGCAGGAGG + Intronic
1037559428 8:20059398-20059420 GGAGGGAATGGGGTGGCCAGAGG - Intergenic
1037637519 8:20712853-20712875 GAAGGGGATTGGGTGGCAGGTGG + Intergenic
1037643747 8:20771718-20771740 GGAGAGAATCGGGTGGGAGTGGG + Intergenic
1038116775 8:24564763-24564785 TGAGGGTAGAGGGTGGAAGGAGG + Intergenic
1038540229 8:28385522-28385544 GGAGGGACGCGGGTCGCCCGCGG + Intronic
1038663420 8:29516856-29516878 GGAAGGAAGGAGGTAGCAGGAGG + Intergenic
1039029238 8:33291889-33291911 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1039245746 8:35606568-35606590 CGAGGGGAGAGGGTGGGAGGAGG - Intronic
1039382640 8:37100314-37100336 GGAGGGTGGAGGCTGGCAGGAGG - Intergenic
1039475470 8:37837354-37837376 GGAGGGAGGAGGGAGGCGGGCGG - Intronic
1040466185 8:47697556-47697578 GGCGGGAGGAGGGAGGCAGGAGG - Intronic
1040864227 8:52032076-52032098 AGAGGGAAGCGGGGCCCAGGTGG - Intergenic
1041552939 8:59120136-59120158 GGAGGGGTGCGGGCTGCAGGCGG - Intergenic
1041914033 8:63121684-63121706 TGAGGGAGGAGGGTGGGAGGAGG - Intergenic
1042189492 8:66171229-66171251 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1042591763 8:70403644-70403666 GGCGGGGGGCGGGCGGCAGGCGG - Intronic
1042887131 8:73564499-73564521 GGAGGGTGGAGGGTGGAAGGTGG + Intronic
1042892437 8:73627216-73627238 GGGGGGGAGGGGGGGGCAGGAGG + Intronic
1042926872 8:73976050-73976072 GGCGGCAGGCGGGCGGCAGGCGG + Intronic
1042926876 8:73976061-73976083 GGCGGCAGGCGGGCGGCAGGCGG + Intronic
1042926880 8:73976072-73976094 GGCGGCAGGCGGGCGGCAGGCGG + Intronic
1042926884 8:73976083-73976105 GGCGGCAGGCGGGCGGCAGGCGG + Intronic
1042926888 8:73976094-73976116 GGCGGCAGGCGGGCGGCAGGCGG + Intronic
1042926892 8:73976105-73976127 GGCGGCAGGCGGGCGGCAGGCGG + Intronic
1042958916 8:74281836-74281858 GGAAGGAAGAGGCTGGCAGTGGG - Intronic
1043230886 8:77799749-77799771 TGAGGGTGGAGGGTGGCAGGAGG + Intergenic
1043541191 8:81264541-81264563 GGAGGGTAGAGGTTGGGAGGAGG + Intergenic
1043992025 8:86766696-86766718 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1044058742 8:87605736-87605758 GCAGGGGGGAGGGTGGCAGGGGG + Intronic
1044493496 8:92848640-92848662 GGAGGACAGTGGGTGGTAGGAGG - Intergenic
1044857924 8:96494653-96494675 GGAGGGGAAAGGGTGGCAGGAGG + Intronic
1045055430 8:98364265-98364287 GGAAGGAAGCGGGCGGCTGATGG - Intergenic
1045328757 8:101137299-101137321 GGAGGGAGGAGGGTTGCTGGGGG + Intergenic
1045382074 8:101637083-101637105 GGAGGGAGGCTGGGGGCTGGAGG + Intronic
1045535238 8:103021298-103021320 GGAGGGACGCGGGTGGGTGCGGG + Intronic
1045545407 8:103123776-103123798 GGAGGGAAGCTGGGGGCCTGGGG + Intergenic
1045618202 8:103942136-103942158 GGAGGGTAGAGGGTAGGAGGAGG - Intronic
1045632131 8:104136796-104136818 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1045636879 8:104201123-104201145 TGAGGGGAGAGGGTGGGAGGAGG - Intronic
1045691754 8:104766473-104766495 GGAGGGTAGAGGGTGAAAGGAGG + Intronic
1045813256 8:106249342-106249364 TGAGGGGAGAGGGTGGGAGGAGG + Intergenic
1046027949 8:108747706-108747728 GGAGGGCAGGGGGTGGGAGGTGG - Intronic
1046028699 8:108756764-108756786 GGAGGGGAGGGGAGGGCAGGAGG + Intronic
1046259465 8:111747724-111747746 GGAGGGAGGAGGGGGGAAGGGGG - Intergenic
1046323229 8:112605627-112605649 GGAGGGCAGAGGGTGGGAGTAGG + Intronic
1046719979 8:117608436-117608458 GGAGGGAAGAGGGAGGGAGGGGG - Intergenic
1046783195 8:118237630-118237652 GGTGGGAAGCTGGAGGCAGAAGG + Intronic
1046890351 8:119415840-119415862 GGGGGGAGGGGAGTGGCAGGGGG - Intergenic
1047277972 8:123420058-123420080 TGAGGGTAGAGGGTGACAGGAGG - Intronic
1047692474 8:127370423-127370445 GGTGGGAAACAGGTGTCAGGGGG + Intergenic
1047961249 8:130013671-130013693 CGAGGGACGCGGGTGCCAGGAGG - Intronic
1048106222 8:131413201-131413223 AAAGGGAAGCAGGAGGCAGGAGG + Intergenic
1048236579 8:132696887-132696909 TGAGGGTAGAGGGTGGGAGGAGG + Intronic
1048263324 8:132964252-132964274 GGAAGAAAGCAGGGGGCAGGGGG - Intronic
1048294588 8:133205074-133205096 GGAGGGAGGGGTATGGCAGGAGG + Intronic
1048375483 8:133818942-133818964 GGTGGGGGGCGGGGGGCAGGGGG + Intergenic
1048484059 8:134831699-134831721 GGCGGGCGGCGGGAGGCAGGTGG - Intergenic
1048925140 8:139264869-139264891 GGAGGGAGGAGGGAGGCGGGAGG - Intergenic
1048972770 8:139654540-139654562 TGAGGGAAGAGCCTGGCAGGGGG - Intronic
1048990184 8:139756283-139756305 TGAGGACAGCAGGTGGCAGGAGG + Intronic
1049027842 8:140008681-140008703 GGAGGCCAGGAGGTGGCAGGTGG - Intronic
1049218572 8:141418631-141418653 GGAGGGAAGGAGGTAGCAGGAGG + Intronic
1049319738 8:141989733-141989755 GGAGGGGAGAGGGTGGTGGGTGG - Intergenic
1049355617 8:142186746-142186768 GTAGGGAGCCAGGTGGCAGGAGG - Intergenic
1049440502 8:142607323-142607345 GGAGGGGAGTGGAGGGCAGGGGG + Intergenic
1049498271 8:142946990-142947012 GGTGGGAAGTGACTGGCAGGTGG + Intergenic
1049579700 8:143405697-143405719 GGAGGGAGGCGGAGGGCAGCAGG - Intergenic
1049598289 8:143494607-143494629 GGAGGGAAGCGGCAGGTCGGGGG + Intronic
1049707409 8:144049269-144049291 GGAGGGCGGCGGGCGGCGGGCGG + Intergenic
1050216125 9:3326477-3326499 GGAGGGTAGAGGGTGGCAGGAGG - Intronic
1050230994 9:3525996-3526018 GGAGGGAAGAGGGGAGGAGGCGG + Intronic
1050266240 9:3893087-3893109 GGAAGGTAGAGGGTGGGAGGAGG - Intronic
1050333774 9:4571230-4571252 AGAGGGTAGAGGGTGGGAGGAGG + Intronic
1051498612 9:17752852-17752874 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1051726179 9:20089682-20089704 GGTGGGCAGGGGGTGGCGGGGGG - Intergenic
1052024664 9:23561224-23561246 GCAGGGAAGAGGGAGGCTGGGGG + Intergenic
1052626823 9:30986037-30986059 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1052664946 9:31483987-31484009 GAAGGCAAGAAGGTGGCAGGAGG + Intergenic
1053314605 9:37040939-37040961 GGAGGGGAGAGGGTGGCAAGGGG + Intergenic
1053358291 9:37465337-37465359 GGAGGGGGGCGGGTGGAAGGGGG - Exonic
1053367745 9:37535694-37535716 GGAGGGTAAAGGCTGGCAGGAGG - Intronic
1053408044 9:37894763-37894785 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1053417059 9:37953492-37953514 GGAAGGAAGAGGGGTGCAGGTGG + Intronic
1053429118 9:38030342-38030364 GGAGGAAAGAGGTGGGCAGGTGG - Intronic
1053835481 9:42130115-42130137 GGCGGGAGGTGGGAGGCAGGGGG + Intergenic
1054112562 9:61123636-61123658 GGCGGGAGGCGGGAGGCAGGGGG + Intergenic
1054460074 9:65458086-65458108 GGTGTGAGGCGGGTGGGAGGGGG - Intergenic
1054595147 9:67058495-67058517 GGCGGGAGGCGGGAGGCAGGGGG - Intergenic
1054714571 9:68544612-68544634 GGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1054865874 9:70000307-70000329 GGTGGGCAGAGGGTGGGAGGTGG + Intergenic
1055208783 9:73763996-73764018 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1055350179 9:75378554-75378576 GGATGGGGGAGGGTGGCAGGAGG + Intergenic
1055356466 9:75442670-75442692 GGAAGGCAGAGGGTGGGAGGAGG - Intergenic
1055677764 9:78682764-78682786 GGAGGGAAGCGGGGGCAGGGAGG - Intergenic
1056010249 9:82321697-82321719 GGAGGGCAGGGGGTGGGAGGAGG - Intergenic
1056436848 9:86582911-86582933 GGAGGGCAGAGGGTAGGAGGAGG + Intergenic
1056552138 9:87660615-87660637 GGAGGGAAGCGCGTGGAGGATGG - Intronic
1056896821 9:90559085-90559107 TGAGTGAAGAGGGTGGCTGGGGG + Intergenic
1056959505 9:91110357-91110379 TGAAGGAAGAGGGTGGGAGGAGG + Intergenic
1057307895 9:93922777-93922799 GGAGGGGAGAGGGTGACAGCAGG + Intergenic
1057466271 9:95317314-95317336 GGCGGGAGGCGGGAGGCGGGAGG - Intronic
1057495444 9:95556738-95556760 GGAGGGCTGCTGGTGGGAGGTGG + Intergenic
1057522618 9:95772136-95772158 GGAGGGGAGGGGCTGGGAGGAGG + Intergenic
1057604433 9:96489088-96489110 CGAGGGAACCGGGCAGCAGGAGG - Intronic
1057605197 9:96494005-96494027 GGGGGAAAGCGGGTAGGAGGAGG - Intronic
1057731396 9:97612006-97612028 GGAGGGTGGAGGGTGGAAGGAGG - Intronic
1057905392 9:98978837-98978859 GGAAGGAAGCTGGTGGCTGGGGG - Intronic
1058169793 9:101666488-101666510 GGAGGGTAGAGGGTGGGAGGAGG + Intronic
1058343474 9:103927241-103927263 GGAGGGAAGAGGAGGGGAGGGGG + Intergenic
1058351656 9:104032460-104032482 GGAGGGTAGGGGGTGGGAGGAGG - Intergenic
1058357011 9:104094526-104094548 GGCGGGAGGCGGGAGGCGGGAGG + Intronic
1058606414 9:106728217-106728239 GGAGGGAGGCTGGTCACAGGCGG + Intergenic
1058617307 9:106845142-106845164 GGATGGAAGGGGGTTGAAGGGGG - Intergenic
1058906840 9:109488913-109488935 GCAGGGAAGCAGGTGGCATTGGG - Intronic
1059070208 9:111127463-111127485 GGTGGCAGGCAGGTGGCAGGTGG + Intergenic
1059082409 9:111264683-111264705 GGAGGGTATTGGGTGGGAGGAGG - Intergenic
1059354310 9:113687355-113687377 GGAGGGAAGAGGGAGGCAGAGGG + Intergenic
1059469620 9:114494930-114494952 GGGGGGGAGCGGGTTTCAGGAGG + Intronic
1059535305 9:115075130-115075152 GGAGGTAAGCTGGGGGCTGGGGG + Intronic
1059601633 9:115784998-115785020 GGAGGGTAGAGGCTGGGAGGAGG + Intergenic
1059678672 9:116565509-116565531 GGAGGGAAGGGTGTGACTGGAGG - Intronic
1060010847 9:120041672-120041694 GGAGGCCAGAGTGTGGCAGGGGG - Intergenic
1060124033 9:121024293-121024315 GGAGGGGAGCGGGAGGGGGGAGG + Intronic
1060124066 9:121024348-121024370 GGAGGGGAGCGGGAGGGGGGAGG + Intronic
1060188567 9:121578348-121578370 GGAGGGAAGAGGGGAGCAGGGGG - Intronic
1060201215 9:121652559-121652581 GGAGGGAAGCCCCTGGGAGGAGG + Intronic
1060224573 9:121783160-121783182 GCAGGGAAGAAGGTAGCAGGTGG - Intronic
1060268647 9:122126615-122126637 CGAGGGAAGGGGTTGCCAGGAGG + Intergenic
1060298178 9:122357108-122357130 GGAGGGAAGACAGTGCCAGGTGG + Intergenic
1060496883 9:124125739-124125761 GGAGGGGAGGGGCTGGCAGAGGG - Intergenic
1060497876 9:124131201-124131223 GGAGGGAAGGGGAGGGCAAGAGG + Intergenic
1060546766 9:124466424-124466446 GGTGGGAGGGGGGTGTCAGGAGG + Intronic
1060550207 9:124481380-124481402 GGCGGGAGGCGGGAGGCAGGAGG + Exonic
1060564950 9:124582414-124582436 AGAGGGCAGAGGGTGGGAGGAGG + Intronic
1060570210 9:124631810-124631832 AGAGGGCAGAGGGTGGGAGGAGG - Intronic
1060725011 9:126000782-126000804 GGAGAGAAGCATGTGCCAGGAGG + Intergenic
1060734574 9:126058907-126058929 GGAGCGAGGCGGGGCGCAGGGGG - Intergenic
1060745140 9:126126242-126126264 GCAGGGAAGAGGGTGGCAGTGGG + Intergenic
1060820407 9:126658431-126658453 AGAGGGAGGGGGCTGGCAGGCGG - Intronic
1060967681 9:127720895-127720917 GGAGGGAGGAGGGAGGAAGGAGG - Intronic
1060975810 9:127764372-127764394 GCAGGGAAGCCAGTGGGAGGTGG - Intronic
1061077375 9:128349902-128349924 GGAGGGGAGGTGGTGCCAGGTGG - Intronic
1061081142 9:128371193-128371215 GGAGGGAAAGGGGTGGCAGAGGG - Intergenic
1061143356 9:128781680-128781702 AGCAGGAAGCAGGTGGCAGGTGG - Intergenic
1061235684 9:129341451-129341473 GTCAGGAAGCGGGTGGGAGGAGG - Intergenic
1061277159 9:129575831-129575853 GGAAGGAGGCGGGTGGCTGGAGG - Intergenic
1061422307 9:130479103-130479125 GGAGGGAAGGGGTTGGGTGGGGG - Intronic
1061496517 9:130977913-130977935 GGAAGGAAGCTGGTGCCAGGAGG + Intergenic
1061859555 9:133460850-133460872 GGAGGAAGGCCGGTGACAGGCGG - Intronic
1061874102 9:133535367-133535389 GGAGGGAGGTGGGGGGCAGGCGG + Intronic
1061887988 9:133602432-133602454 GGAGGGAAGCAGGGGGAGGGAGG - Intergenic
1061926645 9:133809144-133809166 GGAGGGAAGGGGGAGTCAGCAGG + Intronic
1062043856 9:134416246-134416268 GGAGGTAAGCTGGGGGCGGGAGG + Intronic
1062050558 9:134444538-134444560 GGAGGGAGGGGGATGGAAGGAGG - Intergenic
1062051355 9:134448688-134448710 GGAGGGCATGTGGTGGCAGGGGG + Intergenic
1062111360 9:134783747-134783769 GGAAGGAAGGGGGAGGAAGGAGG + Intronic
1062268794 9:135699544-135699566 GGTGGAAAGCACGTGGCAGGTGG - Intergenic
1062328246 9:136023060-136023082 GGAGGGAAGAGGGAGGGAGGAGG + Intronic
1062328258 9:136023090-136023112 GGAGGGAAGAGGGAGGGAGGAGG + Intronic
1062350918 9:136138313-136138335 GGAGGGAAGGGGAAGGGAGGGGG - Intergenic
1062408316 9:136408698-136408720 GGTGGGAAGGCGGTGGCAAGAGG - Intronic
1062578858 9:137221058-137221080 GGCGGGAAGCAGGGGGCAGCCGG + Exonic
1062580655 9:137227924-137227946 GGAGGGAAGGGGAGGGGAGGGGG + Intronic
1062682089 9:137787625-137787647 GGGTGGAAGCGGGAGGGAGGAGG + Intronic
1203769058 EBV:40040-40062 GGAGGGAACCGGGTGGGAGCAGG - Intergenic
1203626737 Un_KI270750v1:32494-32516 GGAGGAAAGAGGGTGGCGAGAGG - Intergenic
1185511677 X:668345-668367 GGAGGGGAGGGGATGGGAGGGGG - Intergenic
1185610887 X:1392971-1392993 GGAGGGAGGAGGGAGGCGGGAGG - Intergenic
1185610897 X:1392993-1393015 GGAGGGAGGAGGGAGGCGGGAGG - Intergenic
1185612161 X:1399131-1399153 GGAGGGAGGAGGGAGGTAGGAGG + Intergenic
1185627604 X:1493431-1493453 GGAGGGAAGGAGGAGGAAGGAGG + Intronic
1185689456 X:2141438-2141460 GGAGGGAAGAAGATGGGAGGAGG + Intergenic
1185770696 X:2763478-2763500 GGTGGGAGGGGGGTGGAAGGGGG + Intronic
1185913773 X:4011600-4011622 GGAGGGAGGAGGGAGGGAGGGGG - Intergenic
1185929256 X:4183951-4183973 GGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1186009609 X:5114887-5114909 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1186135110 X:6511067-6511089 GGAGGGTAGAGAGTGGGAGGAGG + Intergenic
1186146077 X:6625532-6625554 TTTGGGAAGCAGGTGGCAGGTGG - Intergenic
1186473777 X:9841470-9841492 GAAGGGAAGGAGGAGGCAGGAGG + Intronic
1186609635 X:11126384-11126406 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1186645016 X:11497530-11497552 AGGGGGAAGGGGGTGGGAGGAGG - Intronic
1186679665 X:11858549-11858571 AGAGGGCAGAGGGTGGGAGGAGG + Intergenic
1187053640 X:15718830-15718852 TGAGGGTAGAGGGTGGGAGGAGG + Intronic
1187136695 X:16554564-16554586 GGAGGGTGGAGGGTGGAAGGAGG + Intergenic
1187184902 X:16974858-16974880 GGAGGATGGAGGGTGGCAGGAGG - Intronic
1187297910 X:18020191-18020213 GGAGGGTGGAGGGTGGAAGGAGG + Intergenic
1187388738 X:18872086-18872108 GGAGGCCAGCTGGGGGCAGGGGG - Intergenic
1187531201 X:20098560-20098582 GGGGGGGAGCGGGTAGCAAGAGG + Intronic
1187793510 X:22976952-22976974 TGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1187796633 X:23010956-23010978 GGAGGGTGGCGTGTGGGAGGAGG - Intergenic
1188004854 X:25010223-25010245 AGAGGGAAGAGGGAGGGAGGAGG - Intronic
1188145578 X:26608281-26608303 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1188319443 X:28717495-28717517 AGAGGGTAGAGGGTGGGAGGAGG + Intronic
1188414045 X:29910227-29910249 GGAGGGTAGAGGGTGAGAGGAGG + Intronic
1188550397 X:31358102-31358124 TGAGGGAAGAGGGAGGCAGGGGG - Intronic
1188677071 X:32954684-32954706 GGAGGGTGGAGGGTGGGAGGAGG - Intronic
1188697067 X:33207013-33207035 GGAGGGTAGAGGGTTGGAGGAGG - Intronic
1188735193 X:33704311-33704333 GGAGGGTGGAGGGTGGAAGGTGG - Intergenic
1188811066 X:34655439-34655461 GGAGGGAACTGGTTGGCAGCAGG - Intronic
1188850306 X:35123890-35123912 GGAGGGTGGAGGGTGGAAGGAGG + Intergenic
1189148484 X:38679973-38679995 GGAGGGTAGAGGGTGGGAGGAGG + Intronic
1189177558 X:38973119-38973141 AGAGGGAGGAGGGTGGGAGGAGG + Intergenic
1189235091 X:39480848-39480870 GGAGGGGTGCGGCTGGGAGGTGG + Intergenic
1189581148 X:42407846-42407868 GGAGGGTTGGGGGTGGGAGGAGG - Intergenic
1189652491 X:43205128-43205150 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1189657535 X:43261413-43261435 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1189938868 X:46099791-46099813 AGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1190447933 X:50549237-50549259 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1190600133 X:52083371-52083393 GGAGGGCAGAGGGTGGGAGGAGG - Intergenic
1190682639 X:52841320-52841342 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1190918016 X:54824505-54824527 GGAGAGGAGCGTGGGGCAGGTGG + Intergenic
1191738372 X:64411045-64411067 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1191933351 X:66398912-66398934 AGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1192634935 X:72807580-72807602 GGAGGAAAGCGAGTGACAAGTGG + Intronic
1192837837 X:74820862-74820884 TGAGGGCAGAGGGTGGAAGGAGG + Intronic
1193085155 X:77442384-77442406 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1193268460 X:79501272-79501294 GAAGGGTAGTGGGAGGCAGGTGG + Intergenic
1193440301 X:81532650-81532672 GGAGGGAGGAGGTTGGGAGGAGG + Intergenic
1193478140 X:81993047-81993069 GGAAGGTAGAGGGTGGGAGGAGG - Intergenic
1193722191 X:85000271-85000293 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1194287338 X:92026045-92026067 GGAGGGTGGAGGGTGGGAGGAGG + Intronic
1194484209 X:94467078-94467100 TGAGGGTAGAGGGTGGGAGGAGG + Intergenic
1194887918 X:99340873-99340895 GAGGGGAAGAGGGTGGCTGGAGG - Intergenic
1194929933 X:99875456-99875478 GGAGGGCAGGGGGTGGGAGGAGG - Intergenic
1195047051 X:101063721-101063743 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1195108654 X:101623916-101623938 GGAGGGACGGGGGTGGCGGCGGG + Intronic
1195129441 X:101839207-101839229 GGCAGGAAGCGGAAGGCAGGGGG + Intronic
1195176797 X:102320622-102320644 GGCAGGAAGCGGAAGGCAGGGGG - Intronic
1195182067 X:102366471-102366493 GGCAGGAAGCGGAAGGCAGGGGG + Intronic
1195247759 X:103011111-103011133 GGAGGGTGGGGGGTGGGAGGAGG - Intergenic
1196216811 X:113062393-113062415 GGAGGGCAGAGAGTGGGAGGAGG - Intergenic
1196551461 X:117031505-117031527 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1197230551 X:123999418-123999440 GGAGGGAGGAGGGTAGGAGGAGG - Intronic
1197230555 X:123999429-123999451 GGAGAGAAGGGGGAGGGAGGAGG - Intronic
1197394949 X:125915770-125915792 GGAGGGTAGAGGGGGGAAGGAGG - Intergenic
1197424893 X:126283639-126283661 GGAGGGTAGAGGATGGGAGGAGG - Intergenic
1197823282 X:130563140-130563162 AAAGGGAAGCGGGTGGGGGGAGG + Intergenic
1197926150 X:131648518-131648540 TGAGGGAGGAGGGTGGCAGAAGG - Intergenic
1197974515 X:132152446-132152468 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1198243555 X:134807732-134807754 GGAGGCAAGCGGTGGGGAGGAGG + Intronic
1198671917 X:139090587-139090609 GGAGGGCAGAGGGTGGGAGGAGG - Intronic
1198973669 X:142310281-142310303 GGAGGGTATAGGGTGGGAGGAGG + Intergenic
1198998319 X:142602707-142602729 GGAGGGTGGAGGGTGGGAGGAGG - Intergenic
1199125270 X:144110949-144110971 GGAGGGTGGAAGGTGGCAGGAGG + Intergenic
1199156711 X:144557713-144557735 GGAGGGTAGAGGGTGGTAGAAGG - Intergenic
1199264744 X:145817707-145817729 GGAGGGAGGAGGGAGGGAGGAGG - Intergenic
1199264758 X:145817743-145817765 GGAGGGAGGAGGGAGGGAGGAGG - Intergenic
1199264781 X:145817806-145817828 GGAGGGAGGCGAGAGGGAGGAGG - Intergenic
1199310768 X:146317575-146317597 GGAGGGTGGTGGGTGGGAGGAGG - Intergenic
1199338466 X:146647202-146647224 TGAGGGTAGAGGGTGGGAGGAGG - Intergenic
1199766425 X:150944940-150944962 ATAGGGAAGAGGGAGGCAGGAGG - Intergenic
1199976440 X:152897587-152897609 GGAGGGGGGCGGGGGGCTGGCGG - Intergenic
1200058194 X:153472443-153472465 GGCGGGTGGTGGGTGGCAGGTGG - Intronic
1200070746 X:153527839-153527861 GGAGGGGAGCGTGTGGCGGGAGG + Intronic
1200176743 X:154122327-154122349 GGAGGGAAGCGAGTGAGTGGTGG + Intergenic
1200213111 X:154355632-154355654 GCGGGGAAGCGGGAGGCAGCGGG + Intronic
1200256585 X:154585813-154585835 AGATGGGAGCGGGTGGCGGGAGG + Intronic
1200261184 X:154618590-154618612 AGATGGGAGCGGGTGGCGGGAGG - Intronic
1200289977 X:154862549-154862571 GGAGGGGAGAGGTTGGGAGGGGG - Intronic
1201145391 Y:11062317-11062339 GCTGGGGAGTGGGTGGCAGGAGG - Intergenic
1201229675 Y:11852139-11852161 GGAGGGTGGAGGGTGGGAGGAGG + Intergenic
1201304819 Y:12541545-12541567 GAGGGGAAGCGGGAGGAAGGGGG - Intergenic
1202272601 Y:23085764-23085786 GGACTGAGGGGGGTGGCAGGAGG + Intergenic
1202293425 Y:23334918-23334940 GGACTGAGGGGGGTGGCAGGAGG - Intergenic
1202425598 Y:24719508-24719530 GGACTGAGGGGGGTGGCAGGAGG + Intergenic
1202445191 Y:24950577-24950599 GGACTGAGGGGGGTGGCAGGAGG - Intergenic