ID: 912698893

View in Genome Browser
Species Human (GRCh38)
Location 1:111861567-111861589
Sequence GAGGGAAGCGGGTGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2577
Summary {0: 1, 1: 0, 2: 16, 3: 294, 4: 2266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698881_912698893 8 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698880_912698893 13 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698884_912698893 -4 Left 912698884 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698882_912698893 7 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266
912698879_912698893 14 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698893 1:111861567-111861589 GAGGGAAGCGGGTGGCAGGAGGG 0: 1
1: 0
2: 16
3: 294
4: 2266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698893 Original CRISPR GAGGGAAGCGGGTGGCAGGA GGG Intronic
Too many off-targets to display for this crispr