ID: 912698894

View in Genome Browser
Species Human (GRCh38)
Location 1:111861568-111861590
Sequence AGGGAAGCGGGTGGCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1064
Summary {0: 1, 1: 1, 2: 12, 3: 91, 4: 959}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698884_912698894 -3 Left 912698884 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698882_912698894 8 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698887_912698894 -10 Left 912698887 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698879_912698894 15 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698881_912698894 9 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959
912698880_912698894 14 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG 0: 1
1: 1
2: 12
3: 91
4: 959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698894 Original CRISPR AGGGAAGCGGGTGGCAGGAG GGG Intronic
900143091 1:1146658-1146680 CGGGAAGCGGGTGCAGGGAGTGG + Intergenic
900395241 1:2450705-2450727 CGGGGAGCGGGGGGCAGGCGGGG - Intronic
900423158 1:2564430-2564452 AGGACAAGGGGTGGCAGGAGAGG - Intronic
900598139 1:3491702-3491724 AGGGAAGTGGGAGGCAGGCTTGG - Intronic
900647952 1:3717529-3717551 AGGGAAGGAGAAGGCAGGAGGGG + Intronic
900703129 1:4060319-4060341 AGGAAAGGGGGAGGCGGGAGAGG + Intergenic
900830134 1:4959916-4959938 AGGGAAGAGGAGGGGAGGAGAGG + Intergenic
900857720 1:5199377-5199399 AGGGAATCTGTTGGAAGGAGAGG + Intergenic
900889969 1:5442458-5442480 GGAGAAGAGGGAGGCAGGAGAGG + Intergenic
900892677 1:5460926-5460948 AGGGAAGATGGAGGCCGGAGTGG + Intergenic
901077617 1:6565163-6565185 ACGGGAGTGGGTGGGAGGAGAGG + Intronic
901078688 1:6571480-6571502 AGGGAAGTGGAGGGCAGCAGGGG - Intronic
901279087 1:8018359-8018381 ATGGAAGCGGGGGGCGGGGGGGG + Intronic
901486714 1:9568500-9568522 AGGGAACTGGGTGGCAGGGCAGG + Intronic
901528840 1:9841297-9841319 AAGGAGGCTGGTGGCTGGAGTGG + Intergenic
901621124 1:10588392-10588414 ATGTAACAGGGTGGCAGGAGTGG + Intronic
901648477 1:10729108-10729130 AGGGAAGGGGTGGGGAGGAGGGG + Intronic
901753890 1:11429280-11429302 AGGGGAGAAGGTGGCAGGATAGG + Intergenic
901758598 1:11456198-11456220 AGGGAAGGCAGAGGCAGGAGTGG + Intergenic
901817605 1:11803684-11803706 GGGGAGGCGGATGGAAGGAGGGG + Intronic
902238707 1:15074240-15074262 AGGGAGGCGGATGGCAGGGAGGG - Intronic
902393402 1:16119144-16119166 TGGGGAGAGGGTGCCAGGAGTGG + Intergenic
902652967 1:17848684-17848706 AGGGGGGTGGGTGGCGGGAGGGG - Intergenic
902959949 1:19956231-19956253 AGGAAAGGGAGTTGCAGGAGGGG - Intergenic
903020441 1:20390079-20390101 GTGGAAAGGGGTGGCAGGAGGGG - Intergenic
903260660 1:22130075-22130097 AGCAAAGCAGGTGGCAGCAGTGG + Intronic
903534668 1:24059013-24059035 TGGGAAGCGGCTGGCAGAAAAGG - Intronic
903569475 1:24293787-24293809 AGGGCCAGGGGTGGCAGGAGGGG + Intergenic
903579706 1:24361622-24361644 GGGGAGGCAGGAGGCAGGAGTGG + Intronic
903680611 1:25094037-25094059 AGCAAAGAGGGTGGCAAGAGAGG + Intergenic
903792835 1:25906319-25906341 AGGGACGCGGTCGGCGGGAGGGG - Intronic
904306755 1:29594846-29594868 AGGGTAGTGGGGGGCAGGGGAGG + Intergenic
904402543 1:30266217-30266239 AGGGAAGTGGGTGGAGAGAGAGG + Intergenic
904497242 1:30893816-30893838 AGGCTAGGGGGTAGCAGGAGAGG - Intronic
904872996 1:33633567-33633589 AGGCACGCTGGGGGCAGGAGAGG + Intronic
905244911 1:36606054-36606076 AGAGAAGCAGATGGAAGGAGGGG + Intergenic
905817205 1:40960851-40960873 TGGGAGGCGGGTGGCGGGGGGGG + Intergenic
905904075 1:41605144-41605166 AGGGAAGCGGAGGGGTGGAGAGG + Intronic
906117832 1:43367630-43367652 AGGGTAGCGGGGGGAGGGAGGGG + Exonic
907275361 1:53313956-53313978 ATGGCAGTGGGTGGCAGGGGCGG + Intronic
908551866 1:65216459-65216481 GGGGAAGCGGGAGGCAGGGAGGG - Intronic
908683442 1:66688102-66688124 TGGTAAGGGGGTGGCAGGTGTGG + Intronic
908751473 1:67428854-67428876 AGAGAAGCACGTGGCAGGAAGGG + Intronic
908908542 1:69045679-69045701 AGGGTGGAGGGTGGCAGGAAGGG - Intergenic
909375548 1:74937485-74937507 AAGAAAGCGGGTGAAAGGAGAGG + Intergenic
910425846 1:87119508-87119530 AGGGAGGTGGGTGGTAGCAGGGG + Intronic
911041751 1:93596795-93596817 GGGGAAGGAGGTGGCAGCAGAGG + Intronic
911057455 1:93720921-93720943 AGGGCAGGAGGTGGCTGGAGTGG + Intronic
911064934 1:93779824-93779846 AGGGAAGAGGTGGGCATGAGAGG - Intronic
912698894 1:111861568-111861590 AGGGAAGCGGGTGGCAGGAGGGG + Intronic
912714664 1:111974484-111974506 AGGATAGCGGGTGGGAGGTGAGG + Intronic
912734207 1:112135565-112135587 AGGGAAGGGGGTTGGAAGAGGGG + Intergenic
912753942 1:112308833-112308855 AGGGAAGCAGGGCCCAGGAGTGG + Intergenic
912813865 1:112813607-112813629 AGGGAAGCGGGGGGCAGGGGCGG - Intergenic
913179123 1:116302460-116302482 AGGAAAGAGGGTGGCAGGGCTGG - Intergenic
914338262 1:146736705-146736727 AGGGAATGGGGTAACAGGAGAGG - Intergenic
915107421 1:153543109-153543131 CTGGAAGTGGGTGGCAGGACAGG + Intergenic
915117388 1:153609296-153609318 CGGAAAGCAGGTGGCAGGACAGG - Exonic
915145596 1:153794316-153794338 AGGGATGGAGGTGGCCGGAGTGG + Intergenic
915225000 1:154405557-154405579 TGGGAACCGGGCGGCAGGGGTGG - Exonic
915455951 1:156040922-156040944 AGGCCAGGGGCTGGCAGGAGGGG - Intronic
915524712 1:156468545-156468567 AGGGTAGGGGGTGGGAGGTGGGG - Intronic
915836621 1:159181814-159181836 TGGGAAGTGGGTGGCAGGGAAGG - Intronic
915943690 1:160135072-160135094 AGAGAGGCAGGGGGCAGGAGGGG + Intronic
916491591 1:165306921-165306943 AGTGAAGCGGTCAGCAGGAGAGG + Intronic
916696497 1:167242935-167242957 AGAGAGGCAGGTGGAAGGAGGGG - Intronic
917881567 1:179342236-179342258 AGGGAATGGGGTGGGGGGAGAGG - Intronic
918124046 1:181566911-181566933 TGGGAGGGGGTTGGCAGGAGGGG + Intronic
918331406 1:183464267-183464289 AGGGAAGGGGAGGGGAGGAGAGG + Intergenic
918376951 1:183918726-183918748 CAGGAAGGGGTTGGCAGGAGAGG - Intronic
918407641 1:184226343-184226365 AGGGAAGTGGGTGGCAGGGGCGG - Intergenic
918511296 1:185316849-185316871 TGGGAAGAGGGTGGGAGGCGCGG - Intronic
919075620 1:192809200-192809222 GGGGCAGGGGGTGGCGGGAGAGG - Intronic
919518483 1:198556859-198556881 TGGGAAGATGGAGGCAGGAGAGG + Intergenic
919860631 1:201737545-201737567 AGGGAGGAGGGTGGAAGGAAGGG + Intronic
919903762 1:202063239-202063261 AGGGGAGGGGGTGGAAGTAGAGG + Intergenic
920653070 1:207853035-207853057 AGTGCAGCTGGTGGAAGGAGAGG + Intergenic
920886961 1:209938426-209938448 CGGGAGGCGGGTGGGCGGAGCGG + Intronic
921275298 1:213513101-213513123 ATGGAAGAGGGAGGCAGAAGAGG + Intergenic
922203390 1:223425987-223426009 GGGAAGGTGGGTGGCAGGAGTGG - Intergenic
922665950 1:227469273-227469295 AGAGAAGCTGGAGACAGGAGAGG + Intergenic
922696404 1:227733173-227733195 AGGGAAGTGGGTGGCGGGCTCGG + Intronic
922723310 1:227909861-227909883 AGGGGAGGAGGAGGCAGGAGGGG + Intergenic
923080722 1:230651923-230651945 TGTGAAGGGGGAGGCAGGAGGGG - Intronic
924365609 1:243290197-243290219 AGGGGATCGGGGGGCGGGAGCGG - Intronic
924465145 1:244292718-244292740 GTGGAAGGGGGAGGCAGGAGAGG + Intergenic
924563589 1:245177518-245177540 AGTGAAGCAGAGGGCAGGAGAGG + Intronic
1063018754 10:2104926-2104948 AGGGCAGCCGGAGGCGGGAGGGG + Intergenic
1063708561 10:8454687-8454709 ATGGAAAGGAGTGGCAGGAGAGG - Intergenic
1063730699 10:8694006-8694028 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1064114711 10:12568213-12568235 AGGGAAGGGAGGGGCAGGAAGGG - Intronic
1065550367 10:26863472-26863494 AGGGGAGCAGGAGGCAGGCGGGG - Intergenic
1065674922 10:28164220-28164242 AGGGAAGCAGGGTGGAGGAGAGG + Intronic
1065765505 10:29025912-29025934 AGGGAAGCTGGTGGGACGACGGG + Intergenic
1065824437 10:29557058-29557080 AGGGAAGGGGAAGGCAGGGGAGG - Intronic
1066183725 10:32988603-32988625 AAGGAAGCTGGTGTCCGGAGGGG - Intronic
1066306085 10:34142575-34142597 AAGGAAGCGGGGGGCAGGGAGGG + Intronic
1066637698 10:37523029-37523051 AGGAAAGCTGGTAGCAGAAGTGG + Intergenic
1066753416 10:38683866-38683888 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1067145184 10:43689231-43689253 AGTGGAGCGGGTGGGAGGTGCGG + Intergenic
1067156013 10:43781969-43781991 AGGGATCCGGGTGGGAGCAGAGG + Intergenic
1067693768 10:48520871-48520893 AGGGCAGCGAGGGGCAGGAGCGG - Intronic
1068002031 10:51347084-51347106 AGGGAAGCATGTGGCCGCAGTGG - Intronic
1068099413 10:52533025-52533047 AGGGAAGGGGATGGAAGGGGAGG - Intergenic
1069023451 10:63515120-63515142 ATGGAACAGGGTGGCTGGAGAGG + Intergenic
1069722588 10:70559327-70559349 AGGGAACTGGAGGGCAGGAGAGG + Intronic
1069990077 10:72309758-72309780 AGGGAAGCGGGAGGCACTGGGGG - Intergenic
1070390650 10:75967758-75967780 AGGGAGGCGGCGGGCAGGGGTGG + Intronic
1070648129 10:78215623-78215645 AGGGAAGGAGGTGGGAGGAAAGG + Intergenic
1070745495 10:78931316-78931338 AGGGAGGTGGGGGCCAGGAGGGG + Intergenic
1070811178 10:79298822-79298844 AAGGAGGCGGGTGGAAGAAGAGG + Intronic
1071371084 10:84952458-84952480 TGGAAAGCGGGTGGGAGGACTGG + Intergenic
1071492409 10:86144706-86144728 AGGGGAGCGGGTGGGAGCAGAGG - Intronic
1071695246 10:87863408-87863430 AGGGCAGGGGGCGGTAGGAGGGG - Exonic
1072219575 10:93316235-93316257 AGGGAGGAGTGTGCCAGGAGAGG + Intronic
1072411775 10:95209318-95209340 GGGGAAGAGAGTAGCAGGAGAGG + Intronic
1072622812 10:97091248-97091270 AGGGGAGAAGATGGCAGGAGTGG - Intronic
1072681986 10:97514345-97514367 AGGGATGAGGGTGGCAGGTGGGG - Intronic
1072757162 10:98029322-98029344 AGGGAAGAGGGTCCCAGGACAGG - Intronic
1073113940 10:101080335-101080357 AGGGATAAGGGTGGGAGGAGAGG + Intergenic
1073179300 10:101574291-101574313 AGCAAAGCGGGAGGGAGGAGGGG - Intronic
1073181691 10:101587502-101587524 GGGGAAGCGGGTCGGGGGAGGGG + Intronic
1073465820 10:103694015-103694037 ATGGAGGGGGGTGGGAGGAGTGG - Intronic
1073493539 10:103871520-103871542 AGGGAATCGGGGAGCAGGAATGG - Intergenic
1073597788 10:104817587-104817609 AGGGAAGGGGATAGGAGGAGGGG - Intronic
1074301275 10:112235168-112235190 AGGCAAGCGGGGCTCAGGAGGGG + Intergenic
1074502957 10:114043424-114043446 AGGCAAACGGGGCGCAGGAGCGG + Intergenic
1074502966 10:114043454-114043476 AGGCAAACGGGGCGCAGGAGCGG + Intergenic
1074502975 10:114043484-114043506 AGGCAAACGGGGCGCAGGAGTGG + Intergenic
1074532099 10:114305106-114305128 AGGGGACCGGGCTGCAGGAGGGG + Intronic
1074681083 10:115908474-115908496 GGGGAAGAGGGAGGCAGAAGAGG - Intronic
1074722442 10:116274173-116274195 AGGGGAGCGTGTGTCAGGCGTGG - Intergenic
1074785139 10:116832481-116832503 AGGGAAGTCAGTGGCAGAAGAGG + Intergenic
1074785588 10:116836317-116836339 AGGGGAGGGGGTGGCAGTGGTGG + Intergenic
1075157519 10:119990244-119990266 ACGGAGGCGGGTGTCATGAGAGG + Intergenic
1076187200 10:128459151-128459173 AGGGAACCCGGTGGCAGATGGGG + Intergenic
1076399839 10:130175056-130175078 AGGGGAGCTGGTGGGAGGATTGG + Exonic
1076408117 10:130226821-130226843 TGGGCAGTGTGTGGCAGGAGTGG + Intergenic
1076413868 10:130271171-130271193 AGGGAAGAGTGTGGCAGGCAAGG + Intergenic
1076482126 10:130791917-130791939 AGGACAGCGGAGGGCAGGAGGGG - Intergenic
1076616730 10:131759941-131759963 ACAGAAGAGGGAGGCAGGAGAGG - Intergenic
1076716335 10:132366095-132366117 TGGGAATCTGATGGCAGGAGTGG + Intronic
1077020117 11:413659-413681 AGGGGAGAGGGTGCAAGGAGAGG - Intronic
1077159343 11:1105634-1105656 AGGCAGGAGGGAGGCAGGAGGGG - Intergenic
1077272304 11:1686985-1687007 AGGGAAGAGGGAGGCAGGGAAGG - Intergenic
1077309416 11:1881812-1881834 AGGAAAGGGGGAGACAGGAGGGG + Intronic
1077548699 11:3189395-3189417 AGGGAGGCGGGTGGGGGGTGGGG + Intergenic
1077888844 11:6404812-6404834 AGGGAGGGTGGAGGCAGGAGGGG - Intronic
1078412264 11:11135131-11135153 TGGGGATCGGGTGGCTGGAGTGG + Intergenic
1078491264 11:11771110-11771132 TGGGAAGCGGGAGAAAGGAGAGG - Intergenic
1078716965 11:13849462-13849484 AGGGACGTGGATGGCTGGAGGGG - Intergenic
1078725744 11:13929475-13929497 GGGGATGGGGGTGGCAGCAGAGG + Intergenic
1079245540 11:18749717-18749739 TGGGAGCCGGGTGACAGGAGAGG - Intronic
1079584107 11:22104302-22104324 AGGGAAGTGCTAGGCAGGAGGGG - Intergenic
1080657079 11:34266612-34266634 GAGGAAGGGGGTGGCAGGGGAGG - Intronic
1081073362 11:38638056-38638078 AGGGGAGGGGAAGGCAGGAGAGG - Intergenic
1081323341 11:41717147-41717169 AGGGATGAGTGGGGCAGGAGAGG - Intergenic
1081728851 11:45354381-45354403 TGGGAAGCAGGTGGCGGCAGTGG - Intergenic
1081746219 11:45474214-45474236 AAGGTAGGGGGTGGCAGGGGAGG - Intergenic
1081910554 11:46697287-46697309 TGGGGAGCTTGTGGCAGGAGGGG - Intronic
1081960606 11:47133967-47133989 AGGGAGGCTGATGGCAGGAGGGG - Intronic
1082192713 11:49266798-49266820 AGGCAAGAGCATGGCAGGAGAGG + Intergenic
1082637903 11:55619274-55619296 GGGGTAGGGGGAGGCAGGAGGGG - Intergenic
1082759403 11:57112613-57112635 AGGGGAAGGGGAGGCAGGAGAGG - Intergenic
1082791272 11:57348096-57348118 AGGGAAGAGGGAGGAAGGAAAGG + Intronic
1082913726 11:58407691-58407713 AGGGTAGCGGGTGGGAAAAGAGG - Intergenic
1083291907 11:61695195-61695217 GGGGAACCGGGTGGGAGGAGGGG + Intronic
1083311056 11:61783940-61783962 GGGGAAGTGGGAGGCAGGAGGGG + Intronic
1083369476 11:62166837-62166859 TGGGAAACAGGAGGCAGGAGGGG + Intergenic
1083402114 11:62430746-62430768 ATGGAAGTGGGAGGCAGAAGAGG - Intergenic
1083536931 11:63478183-63478205 AGGGAATGGCGTGGCAGCAGAGG - Intronic
1083669340 11:64291610-64291632 AGGGAAGCGCGGCGCCGGAGGGG + Intronic
1083671181 11:64300606-64300628 AGGGTCGCGGATGGCTGGAGCGG - Exonic
1083694997 11:64436822-64436844 AGGGCAGGGGGAGGGAGGAGAGG - Intergenic
1083804925 11:65067801-65067823 AGGGAAGTGGGTGGGTGGTGTGG + Intronic
1083866854 11:65459816-65459838 AGGGAAGGGGTGGGCAGGACAGG - Intergenic
1084170060 11:67396730-67396752 GGGGAAGCAGGTGGCTGGAAGGG + Intronic
1085270573 11:75267492-75267514 AGGCAAGCGGGTTGCTGAAGAGG + Intronic
1085786285 11:79453916-79453938 AGGGAAGGGGAAGGGAGGAGAGG - Intergenic
1085806727 11:79643275-79643297 AGGGAAGAGGGAGGGAGGAAAGG + Intergenic
1086518825 11:87646243-87646265 AGGGAAGCGGAGGGGAGGAGGGG - Intergenic
1086806434 11:91249072-91249094 AGGGAAGCTGTTGGCATGACTGG - Intergenic
1087245105 11:95826083-95826105 AGTGGAGGGGGAGGCAGGAGAGG - Intronic
1087799653 11:102489660-102489682 AGGGCTGCAGGTGGCAGGGGTGG + Intronic
1088106541 11:106212842-106212864 AGGGAAGCAGGTGGCAGTTGTGG + Intergenic
1089098507 11:115939823-115939845 AGGCAGGCAGGTGGCAGGGGCGG + Intergenic
1089119059 11:116119046-116119068 AGGAAAGGGGGTGGGAAGAGAGG - Intergenic
1089303499 11:117512804-117512826 AGGGAAGTGGGGGGAAGGGGAGG - Intronic
1089668089 11:120032979-120033001 ATGGCAGAGGGTGGAAGGAGGGG - Intergenic
1090056925 11:123431336-123431358 TGGGGAGCGGGTGGCACGCGTGG - Intronic
1090401847 11:126454149-126454171 AGAGAAGAAGGTGGGAGGAGAGG - Intronic
1090624250 11:128592105-128592127 AGGAATGGGGGTGGAAGGAGGGG - Intergenic
1091219063 11:133919876-133919898 AGGGTAGCCGGTGGCCAGAGTGG + Exonic
1091250744 11:134141772-134141794 AGGCAGGCAGGTGGCTGGAGAGG + Intronic
1091280041 11:134376493-134376515 AGGGAAGTCGGGGTCAGGAGGGG - Intronic
1091340774 11:134811669-134811691 GGAGATGAGGGTGGCAGGAGCGG + Intergenic
1091786707 12:3247305-3247327 GGGGACGCGGGTGGCGGGGGGGG - Intronic
1091823298 12:3491970-3491992 GGAGCAGCGGGTGGCAGGAGAGG - Intronic
1091910457 12:4226654-4226676 AAGGAAGAGGGAGGGAGGAGAGG - Intergenic
1091912246 12:4241998-4242020 AGGGATGCCAGTGGAAGGAGGGG + Intergenic
1092065874 12:5589325-5589347 AAGAAAAGGGGTGGCAGGAGAGG + Intronic
1092291174 12:7160236-7160258 TGGGAGGCAGGTGGGAGGAGAGG - Intergenic
1092291194 12:7160293-7160315 TGGGAGGCAGGTGGGAGGAGAGG - Intergenic
1093077075 12:14769823-14769845 AGGGAAACGGGTGGCGGGTTAGG - Intronic
1093118998 12:15244997-15245019 AGGGAAGAGGAGGGGAGGAGAGG + Intronic
1093352335 12:18118786-18118808 AGGGATGGGGCTGGCATGAGGGG + Intronic
1093758496 12:22879306-22879328 AGAGAAGGGAGTGGCAAGAGAGG - Intergenic
1094023584 12:25940251-25940273 ACAGAAGGGGGTGGCAGGAAGGG - Intergenic
1094041651 12:26125803-26125825 GGAGAAGGGGGTGGCACGAGAGG + Intronic
1094324557 12:29222510-29222532 AAGGAAGGGGGTAGGAGGAGAGG + Intronic
1095325662 12:40888933-40888955 AGTGAACCGAGTGGCAGGAGGGG - Intronic
1095953293 12:47793332-47793354 AGGGTGGCGGGTGGAGGGAGGGG - Intronic
1096238439 12:49945484-49945506 CGGGCCGCGGCTGGCAGGAGAGG - Intergenic
1096403113 12:51323860-51323882 AGGGAAACGGGAGCGAGGAGTGG - Intronic
1096424844 12:51492397-51492419 TGGGAAAGGGGTGTCAGGAGAGG - Intronic
1096455332 12:51780332-51780354 AGGGGAGAGGCTGACAGGAGAGG - Intronic
1096798429 12:54093085-54093107 AGGGAGGAGGGAGGCAGGAAGGG + Intergenic
1097332779 12:58350487-58350509 AGGGGAGTGGGTGGCAGGTAGGG - Intergenic
1097843859 12:64346636-64346658 AGAGATGTGGGTGGCAGTAGAGG + Intronic
1098065485 12:66611226-66611248 AGGGAAGATGCTGACAGGAGTGG - Intronic
1099416005 12:82387303-82387325 TGGGAAGAGGGTGGGAAGAGTGG + Intronic
1100431360 12:94534304-94534326 AGGGAAGAGGGAGGCAGGAGAGG + Intergenic
1100479663 12:94965821-94965843 AGGGAAGGGGAGGGGAGGAGAGG + Intronic
1100882047 12:99030051-99030073 AGGGAAGCCAGTGTCAGGACTGG - Intronic
1100885800 12:99068676-99068698 AGGGATGCAGGTGGGAGGGGTGG + Intronic
1101000969 12:100356945-100356967 GGGGACGCGGCTGGCTGGAGGGG + Intergenic
1101657997 12:106740990-106741012 AAGGAAGAGAGTGGCAGGAGAGG + Intronic
1102078385 12:110078204-110078226 TGCGAAGCAGGTGGGAGGAGGGG + Intergenic
1102157507 12:110742833-110742855 AGGGAGCGGGGTGGCAGGGGGGG - Exonic
1102353365 12:112211612-112211634 AGGGAAGATGGTGGCAGGGCCGG + Intronic
1102581359 12:113890318-113890340 AGGAAAGGGGGTGCCAGGGGAGG - Intronic
1102789855 12:115635944-115635966 AGGGAAGGGGGAGGGGGGAGGGG + Intergenic
1102822208 12:115917399-115917421 ATGGAAGCAGGTGGTGGGAGCGG - Intergenic
1102873645 12:116433101-116433123 AGAGAAGCGGCTGGGAGCAGTGG - Intergenic
1102913652 12:116737493-116737515 AGGGAAGGGGGAGGAAGGAAAGG + Intronic
1103074197 12:117969051-117969073 AGGGGAGCGGGTTGGTGGAGAGG + Intergenic
1103192896 12:119017548-119017570 GTGTAAGGGGGTGGCAGGAGTGG + Intronic
1103587358 12:121966188-121966210 AGGGAAGGGGAGGGAAGGAGAGG - Intronic
1103848318 12:123914908-123914930 AGGGAAGCGGCTGGCCCGGGTGG - Exonic
1104092054 12:125525726-125525748 AAGGAAGCAGGAGGCAGGAGTGG - Intronic
1104278438 12:127352122-127352144 AGGGAGGAGAGTGGCAGGTGTGG - Intergenic
1104603410 12:130169149-130169171 GGGGAAGCAGGTGGATGGAGAGG + Intergenic
1104841298 12:131827346-131827368 AGGGAAGCGGGGGGGGGGGGGGG + Intergenic
1105247034 13:18662631-18662653 AGGGTCGCTGGTGGCAGTAGAGG + Intergenic
1106000434 13:25718017-25718039 AGTGAAGCAGATGGCAGGAAGGG + Intronic
1106409678 13:29502679-29502701 AGGGAAGCGGAGAGCTGGAGTGG - Intronic
1106490450 13:30216665-30216687 AGTCAGGCTGGTGGCAGGAGGGG + Intronic
1106621427 13:31374428-31374450 AGGGGAGCTGGTGGCAGCCGGGG - Intergenic
1107628780 13:42320492-42320514 GGGGAAGAGAGTGGGAGGAGGGG - Exonic
1108510468 13:51151245-51151267 ATGGAAGAGGGTGGCAGGAGAGG + Intergenic
1109114261 13:58361034-58361056 AGGGAAGCAGGTCACAGGGGTGG + Intergenic
1109510771 13:63369034-63369056 TGGGGAGTGGGTGGCAGGGGAGG + Intergenic
1110509228 13:76329205-76329227 GTGGAAGAGGGTGGCAGAAGAGG - Intergenic
1111519991 13:89388281-89388303 AGGAAAGCTGGTGGCAGAAAGGG + Intergenic
1111562527 13:89969799-89969821 AGGGAAGAGGATGGCAGCATAGG - Intergenic
1111731263 13:92079824-92079846 AGGCAAGCGAGAGGCAGGTGAGG - Intronic
1112205848 13:97322705-97322727 AGGGAAGGGGTGGGCTGGAGGGG - Intronic
1112769889 13:102783520-102783542 AGGGTATCAGGTGGCAAGAGAGG + Intergenic
1113161046 13:107381527-107381549 AGGGATGCAGGTGGCAGAAAGGG - Intronic
1113292374 13:108921160-108921182 TGGGAAGAGACTGGCAGGAGAGG - Intronic
1113599443 13:111558206-111558228 GGGGAAGCTGGTGGCAGTGGAGG + Intergenic
1113653901 13:112056399-112056421 AGAGGAGCGGGGAGCAGGAGGGG + Intergenic
1113728857 13:112625408-112625430 AGGGAGGCCGGGGGCAGGAGAGG - Intergenic
1113741310 13:112714138-112714160 AGGAAGCCGGGTGGGAGGAGTGG - Intronic
1113778953 13:112965150-112965172 AGGGAGGGGAGGGGCAGGAGAGG - Intronic
1113814468 13:113161738-113161760 GGGGCAGGGGGTGGCAGGAATGG - Intronic
1113892527 13:113743925-113743947 AGGGGTGGGGGTGGGAGGAGAGG + Intergenic
1114429003 14:22644553-22644575 AGGAAAGATGGTAGCAGGAGAGG - Intergenic
1114491006 14:23102016-23102038 GGGGAAGTGGGAGGCTGGAGGGG - Intergenic
1114519156 14:23321888-23321910 GGGCGAGCGGGTGGCAGGCGGGG + Intronic
1114613737 14:24057740-24057762 GGGGTAGGGGGTGGCAGGAAAGG - Intronic
1115037997 14:28884261-28884283 AAGGAAGCTGGTGTCCGGAGGGG - Intergenic
1115106111 14:29763460-29763482 AGGGAAGGGGAGGGGAGGAGAGG + Intronic
1115174566 14:30547603-30547625 CGGGGTGCGGGTGGCAGGGGGGG + Intergenic
1115498338 14:34027562-34027584 AGGGGAGCGGAAGGGAGGAGAGG + Intronic
1115520969 14:34232747-34232769 AGGGAGGGGGATGGCAGGATGGG + Intronic
1117309319 14:54506365-54506387 AGGGAAGCAGGTGGTTGTAGCGG + Intergenic
1117687384 14:58268476-58268498 AGGGGAGGAGGTGGCAAGAGGGG - Intronic
1118392128 14:65304396-65304418 AGGGATGCTGGGGTCAGGAGGGG - Intergenic
1118921944 14:70157382-70157404 GGGGAAGAGGGTGGGAGAAGGGG + Intronic
1119764387 14:77179276-77179298 AGGGGAGGGGAGGGCAGGAGAGG - Intronic
1120300447 14:82699649-82699671 AGGGAAACGCCTGGCAGTAGGGG + Intergenic
1120350891 14:83356825-83356847 ATGGAAGCCAGAGGCAGGAGAGG + Intergenic
1120646160 14:87077004-87077026 AGTGAAGTGGGTGGTAGGAATGG + Intergenic
1120745457 14:88147315-88147337 ATGGAAGCAGGTGCCAGGAGAGG - Intergenic
1121144613 14:91573627-91573649 AAGGAAGAGGCTGGCAGGGGAGG + Intergenic
1121302985 14:92886673-92886695 AGGGAATAGGCAGGCAGGAGAGG - Intergenic
1121447491 14:93988090-93988112 GAGGAAGGGGGTGGAAGGAGGGG + Intergenic
1121487748 14:94331540-94331562 AGGGCAGGGGCTGGCAGGTGGGG - Intergenic
1121641664 14:95488684-95488706 AGGGAAGGGGAAGGGAGGAGAGG + Intergenic
1121780943 14:96622126-96622148 AGGGGAGGGGAGGGCAGGAGAGG + Intergenic
1121794153 14:96721811-96721833 GGGGAAGCGGAATGCAGGAGAGG + Intergenic
1121998864 14:98629449-98629471 AGGAAGGTGGGTGGCTGGAGAGG + Intergenic
1122056467 14:99101663-99101685 CGGGTTGCGGGGGGCAGGAGGGG - Intergenic
1122207464 14:100155138-100155160 TGGGAAGCAGGTGGCGGCAGAGG - Intronic
1122257051 14:100486183-100486205 AGGGACGTGGTTGTCAGGAGTGG - Intronic
1122262620 14:100531836-100531858 AGGGAAGGAGGCTGCAGGAGGGG - Intergenic
1122519571 14:102333975-102333997 AGGGATGTGGGTGGCAGGGGAGG - Intronic
1122583210 14:102784826-102784848 AGGGAAGCTAGCAGCAGGAGTGG + Intronic
1122593544 14:102872552-102872574 AGAGAAGCTGGTGGCAGGCTGGG - Intronic
1122620781 14:103056793-103056815 AGGGACGAGGGTGCAAGGAGCGG + Intronic
1122623014 14:103070492-103070514 AGTGATGAGGGAGGCAGGAGGGG + Intergenic
1122636797 14:103133773-103133795 AGGGTAGCAGGTGGCATAAGTGG - Exonic
1122659727 14:103287307-103287329 AGCGACGGTGGTGGCAGGAGGGG + Intergenic
1122777682 14:104129267-104129289 AGGGAAGGGGAGGGCAGGGGAGG - Intergenic
1122791141 14:104184716-104184738 AGGGAAAAGGGTGTCAGGAAAGG - Intergenic
1122865743 14:104603292-104603314 AGGGGTGTGGGCGGCAGGAGTGG - Intronic
1122940291 14:104978150-104978172 AGGGGAGCGGGCTGCAGGCGGGG + Intronic
1122970442 14:105150062-105150084 GGGGAAGGGGGTGGTAGGGGTGG + Intronic
1124201401 15:27681460-27681482 AGTGCAGCGGGTGGGAGGAGGGG - Intergenic
1124656284 15:31510400-31510422 AGAGGAGCGACTGGCAGGAGTGG + Intronic
1125104794 15:35957866-35957888 AGAAAAGGGGGTGGCAGGAAGGG + Intergenic
1125342200 15:38686042-38686064 AGGGAGGAGGATGGAAGGAGTGG - Intergenic
1125697576 15:41651879-41651901 AGGGGAGAGGGAGACAGGAGCGG - Intronic
1125861447 15:43004733-43004755 AGGCAGGCGGCTGGGAGGAGGGG - Intronic
1126110473 15:45172083-45172105 AGGGAAGCCAGTGCCAGGAGGGG + Intronic
1126315452 15:47364749-47364771 GGGGAGGAGGGTGGCAGTAGGGG - Intronic
1126478549 15:49092773-49092795 AGGGAAGGGGAGGGAAGGAGAGG - Intergenic
1127308864 15:57733567-57733589 GGGGAAGGGGGTGGGAGGGGAGG + Intronic
1127530817 15:59841822-59841844 AGGGAAGCAGTTGGTAGGACAGG - Intergenic
1127576655 15:60298380-60298402 AGGGAATGGGAAGGCAGGAGAGG + Intergenic
1127820356 15:62649456-62649478 AGGGGGTGGGGTGGCAGGAGAGG - Intronic
1128519574 15:68366560-68366582 AGGGGAGAGGGAGGAAGGAGAGG - Intronic
1128768244 15:70264142-70264164 CTGGAAGCGGGTAGCAGGAGTGG - Intergenic
1129263547 15:74382159-74382181 AGGGAAGTGGAGGGCAGGTGGGG + Intergenic
1129388488 15:75208611-75208633 ACAGAAGCGGGTGGCAGCCGAGG - Exonic
1129636693 15:77326164-77326186 GGGGAAGGGAGTAGCAGGAGGGG - Intronic
1130304090 15:82701181-82701203 AGGGAAGAGGGCAGGAGGAGAGG - Intronic
1130648475 15:85748644-85748666 AGGGAGGCGGGGGGGAGGAAGGG + Intronic
1131035461 15:89219036-89219058 AGGGAAGGGGCCGGCTGGAGAGG - Exonic
1131466560 15:92660292-92660314 AAGGAAGCGCCTGGGAGGAGAGG + Intronic
1131552880 15:93373066-93373088 AGAGAAGCGGGTGGAGGGAAGGG + Intergenic
1131553975 15:93380710-93380732 AGGCAATTGGGTGGGAGGAGTGG + Intergenic
1131581489 15:93647711-93647733 TGGGAAGTGGCTGGCAGTAGAGG - Intergenic
1131686029 15:94768498-94768520 TGGGACGAGGGTGGAAGGAGAGG + Intergenic
1131933005 15:97466756-97466778 AGGGAAGAGGAGGGCAGGGGAGG + Intergenic
1132055434 15:98648134-98648156 AGGGGAGGGGTGGGCAGGAGAGG - Intergenic
1132202314 15:99963438-99963460 AAGGCAGCTGGTGCCAGGAGTGG + Intergenic
1132300593 15:100773215-100773237 AGGGAAGCCGGGGGATGGAGGGG + Intergenic
1132580567 16:682932-682954 AGGTCAGTGGCTGGCAGGAGAGG - Exonic
1132622062 16:872550-872572 AGGGGAGCTGGTGGCAGAGGTGG - Intronic
1132804240 16:1768390-1768412 GGGGATGTGGATGGCAGGAGGGG - Intronic
1132925720 16:2428377-2428399 AGGGAAGCGTGAGGGAGGGGTGG + Intergenic
1133024311 16:2981001-2981023 AGGGAAGCTGCAGGCAGGCGAGG - Intergenic
1133141579 16:3748559-3748581 AGGGAAGCCAGTGGCTAGAGTGG - Intronic
1133212886 16:4272893-4272915 AGGGAGGCGGGCGGGAGGGGCGG + Exonic
1133472426 16:6088499-6088521 AGGGAAGGGGGAGGAAGGAAGGG - Intronic
1133593910 16:7272472-7272494 AGGGAAACGGGTGCCAGGCATGG - Intronic
1133610843 16:7432011-7432033 AGGAAAGCAAGTGGAAGGAGCGG - Intronic
1133857007 16:9559169-9559191 AGGGCAGAGGGTGGCATCAGTGG - Intergenic
1133865436 16:9637627-9637649 GGGGAGGCAGGTGGCAGAAGGGG - Intergenic
1134178796 16:12030920-12030942 AGGCAGGGGCGTGGCAGGAGGGG - Intronic
1134269888 16:12724086-12724108 AGGGAACCTGGGGGCCGGAGTGG - Intronic
1134776680 16:16859402-16859424 AGGGAGGAGTGAGGCAGGAGTGG + Intergenic
1134799584 16:17071711-17071733 AGGGGAGGGGATGGGAGGAGAGG - Intergenic
1135050007 16:19185121-19185143 AGGGAAGAGGGTAGCAGGGAAGG - Intronic
1135305539 16:21364662-21364684 AGGCAGGGGTGTGGCAGGAGGGG - Intergenic
1135597393 16:23754881-23754903 CGGGTCGCGGGTGGGAGGAGAGG + Exonic
1135603349 16:23801770-23801792 AGGGAAGGGGGGGGGAGGGGAGG - Intergenic
1135607220 16:23835651-23835673 AGGGGAGCGGGTGGAAGGGGTGG - Intergenic
1136111694 16:28067522-28067544 AGGGAAGCGGTTGCAGGGAGAGG + Intergenic
1136173807 16:28504060-28504082 TGGGAAGAGGGTGGCAAGACAGG + Intronic
1136222931 16:28840136-28840158 AGGGAAGTGGGTGAGAGAAGAGG - Intergenic
1136234190 16:28904338-28904360 AGGGAGGCGGGTGGCCGAGGGGG - Exonic
1136275985 16:29179785-29179807 AGGGCAGTGGGTGGCAGATGTGG + Intergenic
1136302280 16:29343815-29343837 AGGCAGGGGTGTGGCAGGAGGGG - Intergenic
1136375235 16:29861466-29861488 AGGGAACAGGGTAGGAGGAGAGG + Intronic
1136729292 16:32393125-32393147 AGGGTGGAGGGTGGAAGGAGGGG - Intergenic
1136994761 16:35182012-35182034 AGGGCAGCAGGTCCCAGGAGAGG - Intergenic
1137556721 16:49474861-49474883 TGGCAAGGGGGTGGCTGGAGGGG + Intergenic
1137588248 16:49677357-49677379 AGGGAAGGGGAGGGTAGGAGGGG + Intronic
1137767830 16:50991506-50991528 CGGGAAGAGGGGGGCAGGAGAGG + Intergenic
1137783072 16:51114088-51114110 AAGGAAGGGGGCCGCAGGAGGGG + Intergenic
1138638599 16:58364300-58364322 ATGGATGCTGGTGGCAGGAGGGG + Intronic
1138789205 16:59882568-59882590 ATGGAAGAGGGTGGGAAGAGTGG + Intergenic
1139045772 16:63057702-63057724 AGAAAAGTGGGTGGAAGGAGAGG + Intergenic
1139402974 16:66696744-66696766 AGGGAGGTGGGAGCCAGGAGAGG + Intergenic
1139475480 16:67200567-67200589 AGGGCAGCGGGTGGGGGCAGTGG + Intronic
1139505471 16:67396224-67396246 AGGCCAGGGGGTTGCAGGAGTGG + Intronic
1139884118 16:70196805-70196827 AGGGAAGCAGAGGGCAGGGGAGG - Intergenic
1140134686 16:72195500-72195522 ATGGATGGGGGAGGCAGGAGGGG - Intergenic
1140163253 16:72521862-72521884 AGGAAATATGGTGGCAGGAGTGG - Intergenic
1140210177 16:72963274-72963296 AGAGAAGCGGGCTGCAGGAAGGG - Intronic
1140368400 16:74398691-74398713 AGGGAAGCAGAGGGCAGGGGAGG + Intergenic
1140452794 16:75084671-75084693 AGGGCAGCGGGTGACAGCTGGGG - Intronic
1141137061 16:81473309-81473331 AGGGCAGGGGGTGTCAGCAGGGG + Intronic
1141577047 16:84970781-84970803 TGGGAAGTGGGTGCCAGGTGAGG - Intergenic
1141624053 16:85252216-85252238 AGGGAATCTGGCGGCAGGAGGGG + Intergenic
1141624069 16:85252285-85252307 AGGGAATCTGGTGGCAGGAGGGG + Intergenic
1141662685 16:85449899-85449921 AGGGCAGCGGCAGGCAGAAGAGG - Intergenic
1141989707 16:87602843-87602865 AGGGAGGGAGGGGGCAGGAGCGG - Intronic
1142080356 16:88145847-88145869 AGGGCAGTGGGTGGCAGATGTGG + Intergenic
1142145487 16:88491242-88491264 AGGGTAGCGGGTAGCAGGGAGGG + Intronic
1142174834 16:88640330-88640352 AGGGAAGCCGGGAGCAGGACAGG - Exonic
1202997104 16_KI270728v1_random:124396-124418 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1203023791 16_KI270728v1_random:436738-436760 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1142513278 17:411080-411102 ACGCAAGAGGGTGGGAGGAGGGG - Intronic
1142616246 17:1137443-1137465 AGGGAATAGGGAGGCTGGAGCGG + Intronic
1142808434 17:2383989-2384011 AGGGAAGCATGTGGCAGGAGCGG - Intergenic
1142994211 17:3751343-3751365 AGGCAGGTGGGTGGAAGGAGGGG + Intronic
1143588785 17:7867176-7867198 AGGAAAGCGGGAGGCGGGGGAGG + Intronic
1143631643 17:8143476-8143498 AGGGGAGTGCGAGGCAGGAGTGG + Exonic
1144371577 17:14596342-14596364 AGTCAAGCTGGTGGGAGGAGGGG + Intergenic
1144408608 17:14976839-14976861 AGGGGAGGGGGTGACAGTAGGGG - Intergenic
1144805627 17:17965079-17965101 AGGGAAGGTGGGGGAAGGAGGGG - Intronic
1145057470 17:19712901-19712923 TGGTAAGCAGGTGCCAGGAGGGG + Intronic
1145398874 17:22515501-22515523 AGGGAAGGGGAGGGCAGGGGAGG + Intergenic
1146268290 17:31467724-31467746 AGAGCGGTGGGTGGCAGGAGTGG - Intronic
1146272207 17:31491863-31491885 AGGGAAGTCTGTGGCAGCAGTGG - Intronic
1146376534 17:32298398-32298420 AGGGAGGTGTGTGGCAGGACGGG + Intronic
1146576147 17:33993415-33993437 AGGGAGGCGCATGGCAGTAGAGG - Intronic
1146916250 17:36680200-36680222 AGGGAAGCGGGTGGTGGGGAAGG + Intergenic
1147043924 17:37739156-37739178 AGAGAAGGAGGTGGAAGGAGGGG + Intronic
1147132112 17:38415650-38415672 AGAGAAGTGGGTGTCAGGGGCGG - Intergenic
1147183694 17:38702509-38702531 CGGGAAGCGGGAAGCAGGAGCGG + Intergenic
1147324387 17:39663346-39663368 TGGGGAGTGGGTGGCAGGTGGGG + Exonic
1147786071 17:42979797-42979819 AGGGAAGGGAATGACAGGAGTGG + Intronic
1147886580 17:43688363-43688385 AGGACAGAGGGAGGCAGGAGAGG - Intergenic
1147962999 17:44179020-44179042 AGGTATAAGGGTGGCAGGAGAGG - Exonic
1148138264 17:45309736-45309758 AGGAAAGGGGATGGCAGGAGAGG - Intronic
1148349385 17:46928733-46928755 AGGGAATCGGGTTGGGGGAGAGG - Intronic
1148356625 17:46979450-46979472 CGGACAGCGGGTGCCAGGAGGGG - Intronic
1148472972 17:47906996-47907018 AGGGGAAGAGGTGGCAGGAGAGG + Intronic
1148781668 17:50125666-50125688 AGGGAAGGGGGAGGCAGGATTGG - Intronic
1149660292 17:58331193-58331215 CGGGCAGCGGGCGGCAGCAGTGG + Intergenic
1149661459 17:58336244-58336266 AGGGAAGCAGGTGCCAAGAGAGG + Intergenic
1149683534 17:58521710-58521732 AGGGAAGCTGGTGGTGGGAGGGG - Intronic
1150154788 17:62843791-62843813 AGGGTGGAGGGTGGGAGGAGGGG + Intergenic
1150644365 17:66968728-66968750 AGGGAAGGGGAGGGGAGGAGAGG - Intronic
1150815578 17:68389722-68389744 CAGGAAGCGAGAGGCAGGAGAGG - Intronic
1151311040 17:73292576-73292598 AGGGAAAGGGGTGGTATGAGTGG + Intronic
1151337384 17:73447870-73447892 TGGGGAGGGGGTGGCAGGAGGGG - Intronic
1151382113 17:73733020-73733042 AGGGAAACTGGTGCAAGGAGTGG - Intergenic
1151445604 17:74161478-74161500 AGGTTAGCGGGTGCAAGGAGCGG - Intergenic
1151677143 17:75604461-75604483 AGGGAGGGGCGTGGCAGGAAGGG - Intergenic
1152077086 17:78166514-78166536 AGGGAAGAGGGGAGCAGGTGGGG - Intergenic
1152139572 17:78528576-78528598 AGGGGAGAGGGCGGGAGGAGGGG + Intronic
1152175026 17:78781950-78781972 AGGGATGTGGGTGGCTGGGGCGG - Intronic
1152293410 17:79453482-79453504 AGGGAAGCTGGTGGGAGGCAGGG + Intronic
1152374942 17:79914184-79914206 ATGGCAGAGGGTGGCAGGGGTGG - Intergenic
1152418097 17:80175908-80175930 AGGGAAGCAGGAGGCAGGGTGGG + Intronic
1152472860 17:80500042-80500064 AGGGCAGGAGGGGGCAGGAGGGG - Intergenic
1152590142 17:81207680-81207702 AGGGAAGAGGGTGGCAGCAGAGG - Intronic
1152649274 17:81484438-81484460 CGGGAACCGGCAGGCAGGAGCGG + Intergenic
1152690561 17:81715981-81716003 ACAGAAGCAGGTGGCGGGAGGGG - Intronic
1153518033 18:5923091-5923113 AGGGAAGCAGGAGAAAGGAGAGG - Intergenic
1154199487 18:12289362-12289384 GGGGAAGGGGCTGGAAGGAGGGG + Intergenic
1154255464 18:12777661-12777683 AGGGAAGCCGGTTCCAGGAAGGG - Intergenic
1154441810 18:14396490-14396512 AGGGTCGCTGGTGGCAGTAGAGG - Intergenic
1154473745 18:14730978-14731000 AGGGGAAAGGGTGGAAGGAGGGG - Intronic
1154486759 18:14878085-14878107 AGGGAATAGGGTGTCAGGAGAGG + Intergenic
1155030471 18:21979382-21979404 AGGGAGGCGGGTGGGTGCAGGGG + Intergenic
1155164897 18:23224248-23224270 AAGGAGGTGGATGGCAGGAGTGG - Intronic
1155392696 18:25352209-25352231 CGGGGAGCGGGAGGGAGGAGGGG + Intergenic
1156932084 18:42657773-42657795 AGGGAAGAGTGTGAAAGGAGAGG + Intergenic
1157160366 18:45308548-45308570 AGGAAAGCGAGTGGCTGGAGAGG - Intronic
1157290424 18:46405974-46405996 AGGGGAGTGGGTGGCATGTGTGG - Intronic
1157308020 18:46531051-46531073 AGGGACAGGGGTTGCAGGAGAGG - Intronic
1157384333 18:47248412-47248434 AGCTGAGCGGGTGGCAGGCGGGG + Exonic
1157421993 18:47555296-47555318 AGTGCTGTGGGTGGCAGGAGAGG - Intergenic
1157599564 18:48885722-48885744 AGGGAAGGTGGTGGCAGGTAAGG - Intergenic
1157619330 18:49007056-49007078 AGAGGAGTGGGTGGAAGGAGGGG - Intergenic
1158746291 18:60203457-60203479 AGGGTAGTTGGTGACAGGAGGGG - Intergenic
1159481314 18:68994506-68994528 GGAGGAGGGGGTGGCAGGAGGGG - Intronic
1160786698 19:903432-903454 TGGGAAGCGGGTGGTTGGACAGG + Intronic
1160797903 19:954204-954226 GGGGAAGGGTCTGGCAGGAGGGG + Intronic
1160980148 19:1812866-1812888 AGGGAAGAGGGTGTCAGGGCAGG + Intergenic
1161169190 19:2804622-2804644 AGGGAGGAGGGTGGCGGGAAGGG - Intronic
1161489246 19:4552778-4552800 AGGGAAGCCGGTGCCCAGAGAGG - Intronic
1161591606 19:5131567-5131589 AGGGAGGAGGGGGGCAGGTGGGG + Intronic
1161591631 19:5131622-5131644 AGGGGAGCTGGTGGCGGGGGAGG + Intronic
1161684830 19:5697554-5697576 AGGGAAGGGGGTAGAGGGAGGGG + Intronic
1162060420 19:8091423-8091445 AGGGAAGAGGGTGGGAAGTGGGG - Intronic
1162302328 19:9850908-9850930 AGGGAAGGGGGTACCTGGAGGGG - Intergenic
1162467150 19:10849112-10849134 AGTGAGGTGGGTGGCAGGAAGGG - Intronic
1162745687 19:12796768-12796790 AAGGAAGGGGGTTGCAGGGGAGG + Intronic
1163174910 19:15557479-15557501 AGGGAGGAGGCTGTCAGGAGAGG - Intergenic
1163351324 19:16777855-16777877 AGGGAAGAGGGGGGAAGGGGAGG + Intronic
1163458382 19:17422190-17422212 GGGGATGGGGGTGGGAGGAGTGG - Intronic
1163521539 19:17794904-17794926 AGGGGCGAGGGTGGCAAGAGCGG + Intronic
1163784533 19:19267938-19267960 AGGGAGACTGGTGGCAGGGGAGG + Intronic
1164828895 19:31305174-31305196 TGTGGAGGGGGTGGCAGGAGAGG - Intronic
1164845513 19:31429328-31429350 AGTGAAGAGGGTGGCAGGACAGG + Intergenic
1164878613 19:31711993-31712015 AGGGCAGAGGGTGGCAGGTCAGG - Intergenic
1165135625 19:33666564-33666586 AGGGAAGAGGGTGCCGGGAGAGG + Intronic
1165247406 19:34505322-34505344 AGGGAAGTGGGTGGAAGGAGAGG - Exonic
1165319561 19:35076886-35076908 GGGGACCCAGGTGGCAGGAGGGG - Intergenic
1165423465 19:35733306-35733328 AGGGGAGGGGGTGGCGGGGGCGG - Exonic
1165657326 19:37545212-37545234 TGGGAAGTGGGTGGCAGGAATGG + Intronic
1165901894 19:39173137-39173159 AGCGAGGCGGGTGGCGGCAGTGG + Exonic
1165905684 19:39193181-39193203 AGGGTAGGGGTAGGCAGGAGGGG + Intergenic
1166987530 19:46670341-46670363 TGGGAAGGGGGTGGTTGGAGTGG + Intergenic
1166994759 19:46714778-46714800 TGGGAAGCTGGTGGCAGTGGGGG - Intronic
1167215154 19:48159625-48159647 GTGGAAGAGGGTGGCAGGAGAGG + Intronic
1167409634 19:49337267-49337289 AGGGAAGGGAGTGGTGGGAGAGG + Intronic
1167448916 19:49556009-49556031 AGGGTAGAGAGTGGCAGGGGAGG + Intronic
1167451217 19:49570712-49570734 TGGGGAGCGGATGGCAGGTGAGG - Intronic
1167502956 19:49857662-49857684 AGGGAACGGGGTGGGAAGAGGGG - Intronic
1167636998 19:50661048-50661070 AGGTAAGAGTGTGTCAGGAGGGG + Intronic
1167666044 19:50823294-50823316 AGGGAACTAGGGGGCAGGAGGGG + Intronic
1167744976 19:51345428-51345450 TGGGAAGGAGGTGGCAGGAAGGG - Intronic
1167799212 19:51729515-51729537 AGGGAAGAAGGAGGAAGGAGAGG + Intergenic
1168080211 19:54004649-54004671 GGGAGAGCAGGTGGCAGGAGAGG - Intronic
1168104876 19:54160568-54160590 ATGGAAGAGCGTGTCAGGAGTGG - Intronic
1168242957 19:55096344-55096366 AGGGAAGGGGGCTGCAGGGGAGG + Intronic
1168312038 19:55465235-55465257 GGGGAAGGGTGTGGCAGGACGGG + Intergenic
1168564382 19:57411344-57411366 AGGGAAGAGCGGGGCGGGAGCGG - Exonic
1168694334 19:58396249-58396271 GGGGAGGCGGGGGGCAGGATAGG - Exonic
1168705854 19:58469937-58469959 AGGGAATCGGGTGGGAGGGAGGG - Intronic
925021768 2:575345-575367 AGGGGCGAGGGTGGCAGGCGTGG - Intergenic
925079644 2:1053917-1053939 AGGGGGGCGGGAGGGAGGAGAGG - Intronic
925291548 2:2751531-2751553 GGGAAAGCGGGTGGCAAGACAGG - Intergenic
925351407 2:3203613-3203635 AGGGAAGCCGGAGGCAGAAGAGG + Intronic
925411440 2:3642063-3642085 AGGGAATCGGTTGGCAGAACTGG + Intronic
925927619 2:8681745-8681767 AGGGAGGCGGGAGGAGGGAGAGG - Intronic
925937924 2:8785242-8785264 AGGGAGGAGGGTGGAGGGAGGGG + Intronic
926010088 2:9400406-9400428 AGGGAGGAGGGTGAGAGGAGGGG - Intronic
926174892 2:10581962-10581984 AGGGAGGTGGGGGACAGGAGAGG + Intronic
926463064 2:13157651-13157673 ACGGAAGTGGGAGGCAGAAGAGG - Intergenic
926880699 2:17540613-17540635 AGGGGAGGGGGTGCCTGGAGAGG + Intronic
927153567 2:20209368-20209390 AGAGAAGGGGATGGCAGGTGAGG - Intronic
927213202 2:20651131-20651153 AGGGCAGCGGGAGGCAGGGCGGG - Intergenic
927467801 2:23350347-23350369 GGGGAGGCGGGAGGCAGAAGGGG - Intergenic
927921836 2:26978432-26978454 AGGGAAGCGGGTGGGGGTGGAGG - Intronic
928370335 2:30735907-30735929 AGGGAGGGGAGAGGCAGGAGGGG + Intronic
928651440 2:33407783-33407805 AGGGAACCTGCAGGCAGGAGTGG - Intergenic
929009274 2:37424931-37424953 AGGCAAGAGTGGGGCAGGAGAGG - Intergenic
929046840 2:37798636-37798658 AAGGCAGAGGGTGGAAGGAGGGG - Intergenic
929116666 2:38450425-38450447 AGAGAAGCAGGTGGCAGGTAAGG - Intergenic
929136253 2:38626585-38626607 AGGCAAGCAGGTGTCAGCAGTGG + Intergenic
929242348 2:39665856-39665878 AGGGAGGTGGGGGGCAGGTGGGG + Intronic
929440905 2:41965291-41965313 AGGGAAGTGGGGGACAGGATTGG - Intergenic
929444515 2:41991986-41992008 GGGGAAGAGGAAGGCAGGAGAGG + Intergenic
929444538 2:41992034-41992056 AGGGAGGAGGTTGGCAGGGGAGG + Intergenic
929526371 2:42706983-42707005 AGGGAAGCGGGGAGGAGGAGGGG - Intronic
929654398 2:43716131-43716153 AGGGAACCTGGAGTCAGGAGAGG + Intronic
929777257 2:44937203-44937225 AGGGGAGCGGGTGGCAGGAGAGG - Intergenic
929811586 2:45193380-45193402 AAGGAAGCAGGAGGGAGGAGTGG + Intergenic
930106209 2:47642003-47642025 AGGGGAGGGGAAGGCAGGAGGGG - Intergenic
932355958 2:71068619-71068641 AGGGAAGGAGGTGTCAGGCGGGG + Exonic
932492691 2:72132021-72132043 AGGGAAGCTGGAGCCAGAAGGGG + Exonic
932494647 2:72140336-72140358 AGGGGGGCGGGTAGCAGGAGCGG - Intronic
932731780 2:74226862-74226884 AAGGCAGAAGGTGGCAGGAGGGG + Intronic
933157258 2:78990155-78990177 AGAGAAGGGGCTGGCAGAAGAGG - Intergenic
933440060 2:82301281-82301303 AGGGATGAGGGTGGAGGGAGAGG - Intergenic
933994346 2:87656804-87656826 AGGGAGGCCGGTGACTGGAGAGG - Intergenic
934033077 2:88065268-88065290 AGGGAAGGGGGGGGGGGGAGGGG - Intergenic
934185592 2:89671036-89671058 AGGGTGGAGGGTGGAAGGAGGGG - Intergenic
934521181 2:95021142-95021164 AGGGAAGCTTGTGGGAGGAAGGG - Intergenic
934762071 2:96861900-96861922 AGAAAAGCGGGGCGCAGGAGGGG + Intronic
934836545 2:97594553-97594575 AGGGAATGGGGAGGCAGTAGAGG - Intergenic
935045611 2:99479373-99479395 GGGGAAGTGGGGGGCAGGACAGG - Intronic
935106158 2:100045607-100045629 AGGGGAAAGGGAGGCAGGAGAGG - Intronic
935751643 2:106240204-106240226 AGGGAAGTGGGTGGGCAGAGGGG + Intergenic
935912062 2:107907752-107907774 AGGGAAGTGGGTGGGCAGAGGGG + Intergenic
936086366 2:109472274-109472296 CAGGAAGACGGTGGCAGGAGAGG + Intronic
936299514 2:111294109-111294131 AGGGAGGCCGGTGACTGGAGAGG + Intergenic
936565049 2:113576580-113576602 TGGGATGGGGGTGCCAGGAGGGG - Intergenic
936933896 2:117819179-117819201 AGGGATGAGGGTGGGAGGAAAGG - Intronic
936936763 2:117846509-117846531 AGGGAAGATGGGGGTAGGAGTGG - Intergenic
937219843 2:120336365-120336387 TGGGAAGCTGGAGGCAGTAGGGG + Intergenic
937231672 2:120401512-120401534 AGGGAGGCTGGTGGCAGGTCTGG + Intergenic
937268175 2:120630282-120630304 AGGGAAGGGGGTGGCAGAGTGGG + Intergenic
937503231 2:122506413-122506435 AGGGTGGAGGGTGGGAGGAGGGG + Intergenic
937980168 2:127610015-127610037 AGGCAAGTGGGGGGCAGCAGCGG + Exonic
938097458 2:128473098-128473120 AGGGAAGCGGGAAGGAGGGGAGG - Intergenic
938124184 2:128659945-128659967 AGGGAAGAGGGTGGCAGCTGTGG - Intergenic
938181607 2:129189748-129189770 AGGGAAGACTGTGGCAGGAAGGG + Intergenic
938725404 2:134104352-134104374 AAGGAAAGGGGTGGCTGGAGAGG + Intergenic
938941947 2:136177300-136177322 AGGGAAGGGGAGGGGAGGAGAGG - Intergenic
939606638 2:144262723-144262745 AGGGGAGGGGATGGGAGGAGAGG + Intronic
939618349 2:144386511-144386533 AGAGAAGGGGGTAACAGGAGGGG + Intergenic
942097907 2:172550795-172550817 TGGGAAACTTGTGGCAGGAGGGG - Intergenic
943013767 2:182485365-182485387 AGGGCAATGGGTGGGAGGAGAGG + Intronic
943422231 2:187680447-187680469 AGGGTAGTGGGTGGAAGGAGGGG + Intergenic
944154858 2:196598204-196598226 AGGGAAGGGGAAGGGAGGAGGGG + Intergenic
944154898 2:196598285-196598307 AGGGAAGGGGAAGGGAGGAGGGG + Intergenic
944154939 2:196598366-196598388 AGGGAAGGGGAGGGGAGGAGGGG + Intergenic
944163351 2:196690226-196690248 GGGGAGGCGGGAGGGAGGAGGGG + Intronic
944384806 2:199152114-199152136 GGCGTAGTGGGTGGCAGGAGAGG + Intergenic
945034421 2:205692088-205692110 AGGGAAGCAGAGAGCAGGAGAGG - Intronic
945747099 2:213731626-213731648 AGGGCAGGGGGTGGGAAGAGGGG - Intronic
945891648 2:215436374-215436396 TGGGAAGCGGCTGGGAGGAAAGG + Intergenic
946031820 2:216711422-216711444 AGGGAAGTGGGTGGGGTGAGAGG - Intergenic
946966503 2:225042539-225042561 AGGGAAGGGGGTGGGAAGAGTGG - Intergenic
947654021 2:231810817-231810839 AGCGAAGGGGGTTGCAGTAGGGG + Intergenic
947982839 2:234425269-234425291 AGGGTGGTGGGTGGCAAGAGAGG + Intergenic
948460108 2:238125123-238125145 AGGTAAGGAGGTGGCAGGAGAGG - Intronic
948696767 2:239736768-239736790 AGGGAGGCGGGCAGCAGGACTGG + Intergenic
948855233 2:240727264-240727286 AGGGAGGAGGGAGGCAGGACAGG + Intronic
948917345 2:241041176-241041198 AGGGGAGGGTGGGGCAGGAGCGG + Intronic
948939038 2:241187186-241187208 AAGGAGTCGGGAGGCAGGAGGGG - Intergenic
1168805601 20:670634-670656 AGGGCAGCGGGGGGCAGGGGAGG - Intronic
1168835749 20:876184-876206 AGGCAAGTGGGTGGCAGATGTGG + Intronic
1168919685 20:1520882-1520904 AAGGAAGAGGCTGGCAAGAGAGG - Intergenic
1168970929 20:1930165-1930187 AGGTGAGCAGGTGACAGGAGGGG - Intronic
1168993626 20:2115887-2115909 AGTGAAGGGGGGGGCAGGAGTGG - Intronic
1169140120 20:3223089-3223111 AGGGAAGCTGGGGACAGGGGGGG - Intronic
1169141169 20:3228175-3228197 GGGGCAGCGGCTGGGAGGAGGGG - Intronic
1169379620 20:5095395-5095417 AGGAAGGTCGGTGGCAGGAGTGG - Intronic
1170226032 20:13992831-13992853 GGGAAAGGGGGTGGGAGGAGAGG + Intronic
1170595018 20:17798739-17798761 AGGGCAGCTGGAGGCAGGGGTGG - Intergenic
1170828097 20:19814368-19814390 TGGGGAGGGGGTGGGAGGAGGGG - Intergenic
1171185502 20:23121527-23121549 GGGCATGCGGGGGGCAGGAGGGG - Intergenic
1171246405 20:23613424-23613446 TGAGAAGCAGGTGGGAGGAGAGG + Intergenic
1171253347 20:23667481-23667503 GAGGAACCGGCTGGCAGGAGAGG + Intergenic
1171456467 20:25275392-25275414 AGGGCAGGGGCTGGCAGGAGAGG + Intronic
1171797982 20:29581255-29581277 AGGGAGGAGGGAGGCAGGAAGGG - Intergenic
1171850258 20:30302905-30302927 AGGGAGGAGGGAGGCAGGAAGGG + Intergenic
1171853730 20:30326280-30326302 AGGGAGGCAGGTGGAAGCAGGGG + Intergenic
1172077560 20:32310927-32310949 AGGGAAGGTGGTGGCAGTGGTGG + Exonic
1172189753 20:33054818-33054840 AGGGAATGGGGTGGCAGGTGGGG - Intergenic
1172474866 20:35228951-35228973 AGGGAAGGGGGAAGCAGGATGGG - Intronic
1173217887 20:41103707-41103729 AGGGAAGAAAGAGGCAGGAGAGG - Intronic
1173538340 20:43832630-43832652 AGAGAAGCAGGAGGCAGCAGGGG - Intergenic
1173564966 20:44032089-44032111 AGGGGAGCGGGTTGCAGTATTGG + Intronic
1173570958 20:44075720-44075742 AGGGAAGGGGATGGCAGGGGTGG + Intergenic
1173676826 20:44843354-44843376 GTGGAAGAGGGAGGCAGGAGAGG - Intergenic
1173870589 20:46339570-46339592 AGGAAAGCGAGTTCCAGGAGTGG - Intergenic
1174132989 20:48359240-48359262 TGGGAAGGGGGTGTCAGGACAGG - Intergenic
1174310241 20:49647529-49647551 AGGGGATCGTGTGGCAGGGGTGG - Intronic
1174414155 20:50356300-50356322 ACAGAAGCGGGTGACAGGATGGG + Intergenic
1174485982 20:50861560-50861582 AGGGATGGGGTTGGCAGGTGAGG + Intronic
1175294678 20:57900240-57900262 AGGGAAACGAGTGGGAGGAAGGG - Intergenic
1175326824 20:58135408-58135430 AGGGAAGGCAGTGGGAGGAGAGG + Intergenic
1175387398 20:58606044-58606066 AGGGAGGTGGGTGGCGGGATAGG - Intergenic
1175540566 20:59745166-59745188 AGGGAAGAGCATGGCAGCAGTGG + Intronic
1175643234 20:60649237-60649259 AGTGATGTGGGAGGCAGGAGAGG - Intergenic
1175643242 20:60649267-60649289 AGTGATGTGGGAGGCAGGAGAGG - Intergenic
1175643268 20:60649357-60649379 AGTGATGTGGGAGGCAGGAGAGG - Intergenic
1175643276 20:60649387-60649409 AGTGATGTGGGAGGCAGGAGAGG - Intergenic
1175643283 20:60649417-60649439 GTGGAAGAGGGAGGCAGGAGAGG - Intergenic
1175658435 20:60792114-60792136 AAGGAAGGGGAGGGCAGGAGGGG - Intergenic
1175685722 20:61027019-61027041 ATGGAAGTGGTTGGCGGGAGGGG - Intergenic
1175704116 20:61163135-61163157 AGGAAAGCGGGTGGAGGGTGTGG - Intergenic
1175828823 20:61951103-61951125 AGGGGAGAGGGTGGGAAGAGGGG - Intergenic
1175907644 20:62389168-62389190 TGGGATCTGGGTGGCAGGAGAGG + Exonic
1175975454 20:62708475-62708497 AGGGAAGAGGGTGGCAGGAAGGG + Intergenic
1176142259 20:63549944-63549966 AGGGCAGCAGGTGCAAGGAGGGG - Intronic
1176454257 21:6894687-6894709 AGGGTCGCTGGTGGCAGTAGAGG + Intergenic
1176794542 21:13361314-13361336 AGGGAATAGGGTGTCAGGAGAGG - Intergenic
1176832431 21:13759735-13759757 AGGGTCGCTGGTGGCAGTAGAGG + Intergenic
1177115658 21:17083030-17083052 GGGGCAGTGGGTGGCAGCAGAGG - Intergenic
1178177732 21:30123731-30123753 AGGGTAGTGGGAGGCTGGAGGGG - Intergenic
1178213947 21:30571966-30571988 GTGGAGGAGGGTGGCAGGAGGGG + Intergenic
1178279115 21:31265782-31265804 AGGGAAGTGTGTGGGGGGAGTGG - Intronic
1178498178 21:33104343-33104365 AGGGAAGTGGGGAGCAGGAAGGG + Intergenic
1178762213 21:35413843-35413865 AGGGAAGAGGGAAGCAGGGGCGG + Intronic
1178766104 21:35452338-35452360 GTGGAAGAGGGAGGCAGGAGAGG - Intronic
1178842691 21:36150620-36150642 AAGGAAGCAGGGGGCAGGGGAGG - Intergenic
1179052607 21:37900998-37901020 AAGGAAGGGGGAGGCAGAAGTGG - Intronic
1179216858 21:39374915-39374937 AGGGAAGTGGAGGGCAGGGGAGG - Intergenic
1179249814 21:39663452-39663474 AGGGAAGGGGATGGGAGGGGAGG - Exonic
1179265528 21:39799145-39799167 AGGGAAGAAATTGGCAGGAGAGG - Intronic
1179385352 21:40936813-40936835 ATGGAAGCAGGTGGCAGGGGAGG - Intergenic
1179608800 21:42535653-42535675 AGGGAAGCCAGTGGCAAGCGGGG - Intronic
1179885567 21:44312890-44312912 GGGGGAAGGGGTGGCAGGAGAGG + Intronic
1180177375 21:46097485-46097507 CGGGAAAGGGGTGGCAGGGGTGG + Intergenic
1180736776 22:18023509-18023531 AGGGAAGGGGTTGGCAGGCACGG + Intronic
1181288858 22:21775235-21775257 CGGGAAGCAGCTGGCAGGTGCGG + Intronic
1181531290 22:23518953-23518975 ACGGGAGCGGGGGGCTGGAGGGG + Intergenic
1181710181 22:24679625-24679647 AGGGTGGTGAGTGGCAGGAGTGG + Intergenic
1181727355 22:24820650-24820672 ATGGAAGGGTGTGGCAGGAGTGG + Intronic
1181997914 22:26897638-26897660 AGGGAGGCTGGTGGGAGGTGAGG + Intergenic
1182387449 22:29957103-29957125 GGGGGCGGGGGTGGCAGGAGGGG - Intronic
1182667973 22:31972930-31972952 AGGGAAGTAGGTGGCAGGTTTGG - Intergenic
1183172962 22:36201531-36201553 AGGGACAGGGGTGACAGGAGAGG + Intronic
1183180314 22:36255447-36255469 AGGGACAAGGGTGACAGGAGAGG - Intronic
1183201140 22:36386855-36386877 AGGGAAGCGGGTGCGTGGAGTGG + Intronic
1183273711 22:36878117-36878139 AGGAAATGGGGTGGCAGGACAGG - Intergenic
1183362655 22:37390737-37390759 AGGGAGAGGGGTGGCGGGAGGGG - Intronic
1183374773 22:37456881-37456903 TAGGAAGGGGGTGGCAGGATGGG + Intergenic
1183485426 22:38085637-38085659 AGTGAGGAGGGTGGCAGGTGCGG - Intronic
1183942283 22:41302363-41302385 CGGGAAGGGGGCGGCAGGAAAGG + Intronic
1184039745 22:41935716-41935738 AGGGCAGGGGGTGGCAGGATAGG - Intergenic
1184448827 22:44570817-44570839 AGGGTAGGGGATGGGAGGAGAGG + Intergenic
1184495166 22:44836833-44836855 AGGGAAGGGGGAGGGAGGAATGG - Intronic
1184561897 22:45268510-45268532 AGGGAAGCGGGTGAGGGGAGTGG - Intergenic
1184581788 22:45422900-45422922 AGGGGAGTGTGTGGGAGGAGGGG - Intronic
1184886994 22:47352467-47352489 AGGGAAGGGAGTGACTGGAGGGG - Intergenic
1185055409 22:48576270-48576292 AGGGGAGCGGGCGGGGGGAGGGG - Intronic
1185298240 22:50064713-50064735 AGGGAAGAGGATGGAGGGAGCGG + Intronic
949101408 3:150348-150370 AGAAAAGGGGGTGGAAGGAGGGG - Intergenic
949414332 3:3799643-3799665 AGGGCAGGGGGAGGCAGGACTGG - Exonic
949920625 3:8997359-8997381 AGTGAAGAGGGTGGCATGGGAGG - Intronic
950212329 3:11133089-11133111 AGTGAAGCGGGGAGTAGGAGGGG + Intergenic
950450680 3:13063484-13063506 AGGGCAGAGGAGGGCAGGAGTGG + Intronic
951571668 3:24070487-24070509 AGGGTAGAGGGTAGGAGGAGGGG - Intergenic
951780902 3:26362045-26362067 AGGGTGGAGGGTGGGAGGAGGGG - Intergenic
952866933 3:37861226-37861248 AGGGAAGCGGTGTGCAGAAGTGG - Intergenic
953207937 3:40848476-40848498 GGGGAGAGGGGTGGCAGGAGTGG - Intergenic
953389962 3:42528208-42528230 AGGGAAGAGGGAGGAGGGAGAGG - Intronic
953550605 3:43899509-43899531 AGGGAAGCAGGAGGTGGGAGAGG - Intergenic
953671976 3:44970409-44970431 AGGTTAGCGAGTGGCAGGATTGG - Intronic
954111407 3:48435409-48435431 AGGGAAGTGGGTAGCAGGGAAGG - Intronic
954328797 3:49878002-49878024 AGGGATGGGGGTGGCAGGGGTGG + Intergenic
954437623 3:50504223-50504245 AGCGAAGCGAGTGGCTGCAGAGG - Intronic
954687090 3:52376929-52376951 AGAGAAGCCCGTGGCAGGAAGGG - Intronic
955238976 3:57163798-57163820 GGGGAAGGGGGTGGCGGGGGCGG + Intronic
955831011 3:63004091-63004113 AGGGAATAGGGAGGCTGGAGAGG + Intergenic
955897634 3:63717559-63717581 ATGGAAGAGGGAGGCAGAAGAGG - Intergenic
955942268 3:64157763-64157785 AGGGAGGTGGGTGGGAGGACGGG + Intronic
955981933 3:64535831-64535853 GGGGGAGGGGGTGGCAGGTGCGG - Intronic
956060642 3:65344827-65344849 AGGGTAGGGGGAGGCAAGAGAGG - Intergenic
956657695 3:71568056-71568078 GGGGAAGAGGGGGGGAGGAGAGG + Intronic
956793247 3:72696070-72696092 GGGGAGGGGGGTGGGAGGAGTGG + Intergenic
957002898 3:74907502-74907524 AGGGAGGAGGAGGGCAGGAGGGG - Intergenic
957036599 3:75299055-75299077 AGGGAAGCAGATGGCAGTAAAGG - Intergenic
957467074 3:80608070-80608092 AGGGGAGTGGGAGGGAGGAGGGG + Intergenic
957746495 3:84349531-84349553 AGGGTGGAGGGTGGGAGGAGGGG + Intergenic
958468101 3:94483282-94483304 AGGGCAGGGAGTGCCAGGAGGGG + Intergenic
960837591 3:121923155-121923177 AGGGAAGTGGCTGTAAGGAGCGG - Intronic
960926066 3:122795600-122795622 AGGGAGGCGGCTGGCAGGCCTGG - Intronic
961076353 3:123986577-123986599 AGGGAAGGTGTTGGCAGGGGTGG + Intronic
961345297 3:126260151-126260173 AGGGAGGAGGGAGGTAGGAGAGG - Intergenic
961349842 3:126292796-126292818 AGGTCTGCAGGTGGCAGGAGGGG + Intergenic
962140492 3:132785294-132785316 AGGGTAGAGGGTGGTAGAAGGGG - Intergenic
962672429 3:137722670-137722692 AGGGATGCAGGGGGCAGCAGTGG - Intergenic
963123319 3:141794126-141794148 AGGCAAGCAGGTGGCAGGAGGGG + Intronic
963440275 3:145332810-145332832 AGGCATGCGTGGGGCAGGAGAGG + Intergenic
963677413 3:148329981-148330003 AGGGAAGAGGATGTCAGGTGGGG - Intergenic
963815321 3:149824400-149824422 ATGGAAGAGGGAGGCAGAAGAGG + Intronic
964015219 3:151936913-151936935 TGGGAAGTGGGAGGCAGGAGAGG + Intergenic
964335532 3:155650032-155650054 AGGGAGGCGTGAGGGAGGAGAGG + Intronic
965886697 3:173454965-173454987 AGGGAATAGGGAGGCAGGAGCGG + Intronic
967169578 3:186812666-186812688 AGGGATGAGGGAGGCAGGACTGG - Intergenic
967992089 3:195139035-195139057 AGGGGAGCTGGTGAGAGGAGAGG + Intronic
968442224 4:629730-629752 AGGGAGGAGGGTGGCAGGACCGG + Intronic
968529973 4:1086584-1086606 TGGCATGAGGGTGGCAGGAGAGG + Intronic
968652979 4:1767369-1767391 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968652988 4:1767387-1767409 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968652997 4:1767405-1767427 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968930501 4:3576255-3576277 AGGGAGACGGGTGGGAGGAAGGG + Intergenic
969276328 4:6138111-6138133 AGGGAAGTAGGTGCCAGTAGTGG - Intronic
969315923 4:6381270-6381292 AGGGAAGAGGAGGGCAGGAGGGG - Intronic
969346910 4:6575633-6575655 AGGGAAGCCTGGAGCAGGAGAGG + Intronic
969684898 4:8665931-8665953 ATGGGAGCAGGTGGGAGGAGGGG - Intergenic
969685561 4:8672160-8672182 AGGGCAGCAGGTGGGAGGAGGGG + Intergenic
970092914 4:12430279-12430301 AGGGGAGGGACTGGCAGGAGTGG + Intergenic
971317728 4:25581331-25581353 AGGGAAAGGGGGAGCAGGAGAGG - Intergenic
971394491 4:26215795-26215817 AGGGATGCGGGAGGCGGGAGTGG - Intronic
971400377 4:26270295-26270317 AGGGAAGGGGAGGGGAGGAGGGG + Intronic
971665314 4:29475966-29475988 AGGGTAATGGGTGGCTGGAGGGG + Intergenic
971834720 4:31748392-31748414 TGGGGAGCAGGTGCCAGGAGTGG + Intergenic
972117944 4:35661968-35661990 AGAGAAGCGAGTGGCAGGAATGG + Intergenic
972127595 4:35789152-35789174 AGAGAAGAGGGTAGGAGGAGAGG + Intergenic
972833686 4:42843082-42843104 TGGGAAGCTGGTGGAAGGTGGGG + Intergenic
972907127 4:43764195-43764217 AGGTAAGAGGGTGGGTGGAGAGG + Intergenic
973787845 4:54350334-54350356 AGGGAAGTAGGAGGCAGGGGAGG + Intergenic
975322355 4:73023171-73023193 AGGGAGGCTGGTGGCTGCAGAGG - Intergenic
975526854 4:75360431-75360453 TGGGAAGGGGGTGGCAGCATTGG + Intergenic
975639456 4:76484837-76484859 AGGGAAGCGGGTGGGGGCAGAGG - Intronic
975718721 4:77229804-77229826 ATGGAATAGGGTGGCAGGATTGG + Intronic
975756988 4:77580774-77580796 AGGGGAGAGGAGGGCAGGAGAGG - Intronic
976812023 4:89108474-89108496 AGGCGTGGGGGTGGCAGGAGCGG + Intronic
977260526 4:94791812-94791834 TGGGGTGGGGGTGGCAGGAGAGG - Intronic
977430793 4:96928465-96928487 AGAGAAGACTGTGGCAGGAGTGG - Intergenic
977948701 4:102944228-102944250 AGGGTGGAGGGTGGAAGGAGGGG + Intronic
978705092 4:111698449-111698471 AGGGAGGGGGGAGGAAGGAGGGG + Intergenic
980670416 4:135997217-135997239 AGGGGAGAGGGTAGGAGGAGGGG + Intergenic
984123905 4:175781310-175781332 AGGGAAGGGGGTGTCAGGGAGGG + Intronic
984206583 4:176793122-176793144 CGGGGAGCGGGCGGCCGGAGGGG + Intergenic
984613765 4:181872463-181872485 AAGGCAGAGGGTGGAAGGAGGGG - Intergenic
984706517 4:182851089-182851111 AGGGAACGGGGTGGCGGGCGGGG + Intergenic
984711378 4:182888112-182888134 AGGGATGCGGGTGGCAAGTTTGG + Intergenic
984777893 4:183499481-183499503 ATGGAAGTGAGTGGCAGGAAGGG - Intergenic
985503518 5:264373-264395 AGGGAAGCGGGAGGTAAGACAGG + Intergenic
985654996 5:1126628-1126650 AGGGCAGAGAGTGGGAGGAGGGG - Intergenic
985698921 5:1358821-1358843 AGGCCAGCAGGTGGCAGGAAGGG + Intergenic
985824020 5:2179710-2179732 AGGGAAGCTGGTGGCAGCCGCGG + Intergenic
985883610 5:2658935-2658957 AGGCGTCCGGGTGGCAGGAGGGG + Intergenic
985912779 5:2896478-2896500 TAGGCTGCGGGTGGCAGGAGTGG - Intergenic
985957796 5:3277517-3277539 AGGGAAGGGGAGGGGAGGAGAGG + Intergenic
985993736 5:3584759-3584781 AGGAAAGAGGGAGGCAGGACAGG + Intergenic
985993795 5:3584992-3585014 AGGAAAGAGGGAGGCAGGACAGG + Intergenic
986415776 5:7526326-7526348 AGGGAAGCGGGTGGTAAAATTGG + Intronic
986517681 5:8581061-8581083 AGGGAGGCAGGTGGGAGGAGGGG - Intergenic
989043187 5:37249541-37249563 AGGGGAGCGCGCGGGAGGAGGGG - Intergenic
989538864 5:42595757-42595779 AAGGAAGTGGGTTGCTGGAGAGG + Intronic
990499896 5:56385699-56385721 AGGGAAGCAGGAGGAAGAAGAGG - Intergenic
990851462 5:60209697-60209719 AGGGAGGAGAGTGGGAGGAGAGG + Intronic
991347045 5:65680172-65680194 AGGGCAGAGGATGGGAGGAGAGG + Intronic
991482792 5:67101211-67101233 AGGGAAGGGAGAGGCAGGATTGG + Intronic
991540304 5:67720455-67720477 AGGGAAGAGGAGAGCAGGAGAGG - Intergenic
991583786 5:68182579-68182601 AGAGTAGAGGGTGGCAAGAGGGG - Intergenic
991950053 5:71938836-71938858 GGGGATGCCGGTGGCAAGAGAGG - Intergenic
992269798 5:75053100-75053122 AGGGCAGCGGGCGGCGGGCGCGG - Intergenic
993791813 5:92219164-92219186 AAGAAGGCAGGTGGCAGGAGTGG - Intergenic
995483888 5:112619600-112619622 ATGGCAGTGGGGGGCAGGAGGGG + Intergenic
996185826 5:120474064-120474086 AGGGCCCAGGGTGGCAGGAGTGG + Intronic
996436177 5:123434954-123434976 AGGGAAGGGAGGGGGAGGAGAGG + Intergenic
997883380 5:137610616-137610638 AGGGATGAGGGAAGCAGGAGAGG - Intergenic
998059236 5:139106020-139106042 AGGGGAGGGGGACGCAGGAGTGG + Intronic
998062613 5:139131300-139131322 AGGGAGGAATGTGGCAGGAGTGG - Intronic
998094266 5:139388430-139388452 AGGGAGGTGGGGGGCAGGATTGG + Intronic
998307767 5:141096282-141096304 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998308404 5:141102135-141102157 AGGGAAGAGAGGGGCAGGTGCGG - Exonic
998310314 5:141123481-141123503 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998312754 5:141151737-141151759 AGGGAAGAGAGGGGCAGGTGCGG - Exonic
998313444 5:141157484-141157506 AGGGAGGCGAGGGGCAGGTGCGG - Intergenic
998314935 5:141174321-141174343 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998315512 5:141179523-141179545 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998316054 5:141184045-141184067 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998316609 5:141188804-141188826 AGGGAGGCGAGGGGCAGGTGTGG - Exonic
998317243 5:141194038-141194060 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998318872 5:141210393-141210415 AGGGAGGCGAGGGGCAGGTGCGG - Exonic
998322001 5:141241402-141241424 AGGGAGGCGAGGGGCAGGTGCGG - Intergenic
998489351 5:142532598-142532620 AGGGAAGTAAGTGGGAGGAGAGG + Intergenic
998550101 5:143069087-143069109 AGGAGAGAGGATGGCAGGAGGGG - Intronic
999451030 5:151678398-151678420 AGGGATGGGGGTGGCAGGGAGGG - Intronic
999517301 5:152314432-152314454 AGGGAAGCAGAGGGGAGGAGAGG - Intergenic
999747112 5:154600838-154600860 AAGGAAGATGGTGTCAGGAGAGG - Intergenic
1000132127 5:158310073-158310095 AGGGAAGGGGGAGGGAGGAAGGG - Intergenic
1000463176 5:161547215-161547237 TGTGCAGCGGGTGGGAGGAGGGG + Intronic
1001178867 5:169499613-169499635 AGGGTAAAGGGTGGAAGGAGGGG - Intergenic
1001629508 5:173164231-173164253 ATGGGAGCGGGAGACAGGAGGGG - Exonic
1001648821 5:173301256-173301278 AGGGAAGGGGAGGGGAGGAGAGG - Intergenic
1002205119 5:177557325-177557347 GGAGAAGAGGGTGGCAGCAGAGG - Intergenic
1002451512 5:179321601-179321623 AAGGAAGAGGGAGGCAGAAGGGG - Intronic
1002456007 5:179345621-179345643 AGGGAAGCGGGCGGCGGCGGCGG - Intergenic
1002482618 5:179513303-179513325 AGGGAGGGGGGAGGGAGGAGGGG - Intergenic
1002674427 5:180899259-180899281 ATGGAAACGGATGACAGGAGAGG - Exonic
1002881730 6:1258361-1258383 AGGGAAGAGGGAGGCCTGAGAGG - Intergenic
1002901971 6:1417035-1417057 AAGCAAGCGAGTGGCAGGACTGG + Intergenic
1003020157 6:2502655-2502677 AGGAGGGCGGGTGGCAAGAGTGG + Intergenic
1003059730 6:2853585-2853607 AGGGGAGGGGGTCCCAGGAGAGG - Intergenic
1003059766 6:2853675-2853697 AGGGGAGGGGGTCCCAGGAGAGG - Intergenic
1003094459 6:3131645-3131667 CGGGGAGGGGCTGGCAGGAGGGG - Intronic
1003177695 6:3764978-3765000 AGGGAACATGGTGGCAGGGGTGG - Intergenic
1003202925 6:3979015-3979037 AGGGGAGCTGGTGGGAGGATTGG + Intergenic
1003256158 6:4476729-4476751 AGGGAAGAAGGTGGCAGGGATGG - Intergenic
1004034075 6:11904921-11904943 AGGGTGGAGGGTGGGAGGAGCGG - Intergenic
1004233327 6:13852039-13852061 AGGGAAGAGGAGGGGAGGAGAGG - Intergenic
1005166141 6:22923317-22923339 AGGGAAGAAGATGGCAGGAAAGG + Intergenic
1005897769 6:30192399-30192421 AGGGATTGGGGTGACAGGAGAGG - Intronic
1005968746 6:30744625-30744647 TGGGGAGCGGTTGGCAGCAGCGG + Intergenic
1006073612 6:31515321-31515343 AGGGTGGAGGGTGGGAGGAGGGG + Intergenic
1006140041 6:31922994-31923016 ATGGAAGAAGCTGGCAGGAGAGG + Intronic
1006383032 6:33711774-33711796 AGTGGAGCGGGAGGCCGGAGTGG + Intergenic
1006413522 6:33889964-33889986 AAGGAAGCAGGGGACAGGAGGGG - Intergenic
1006814159 6:36839536-36839558 AGGGAAGAGGGCGGAGGGAGCGG + Exonic
1007184367 6:39955649-39955671 AGGGAAGAGGGTGGGAGGAGGGG + Intergenic
1007399099 6:41593692-41593714 AGGGAGGCGGGCGGCTGGAGTGG - Intronic
1007418607 6:41706261-41706283 AGGGAGGTGGGGGGCAGAAGGGG + Intronic
1007473862 6:42106700-42106722 AGGGAGGGGGGGTGCAGGAGGGG + Exonic
1007609811 6:43142113-43142135 AGGGAGGGGGGCTGCAGGAGAGG - Intronic
1008560685 6:52721856-52721878 ATGGAAGAGGATGGCAGTAGTGG - Intergenic
1008667933 6:53735212-53735234 AGGGAAGTGGGAGACAGGAAGGG - Intergenic
1009635537 6:66259960-66259982 AGGGGAGGGGGTGGTGGGAGTGG - Intergenic
1010534504 6:77011200-77011222 ATAGAAGTGGGTGCCAGGAGAGG - Intergenic
1011496040 6:87937353-87937375 AGGGATGCTGGAGGCAGAAGAGG + Intergenic
1011634171 6:89354587-89354609 AGAGAAGTGGCTGGCAGGTGTGG + Intergenic
1011765605 6:90616135-90616157 AGGGAAGAGGGAGGCAGTTGTGG + Intergenic
1011921578 6:92583492-92583514 AGAGAACTGGGTGGCAGGAGGGG + Intergenic
1012376132 6:98563837-98563859 AGGAAAGAGGGAGGCAAGAGTGG - Intergenic
1013253875 6:108363364-108363386 AGTGTAGAGGGTGGGAGGAGGGG - Intronic
1013366456 6:109441327-109441349 AGGGAAGAGCGGGGCAGGGGAGG - Intronic
1015380367 6:132560471-132560493 AGGGAGGAGGGTGGAAGGAGGGG + Intergenic
1015592762 6:134838376-134838398 AGGGTGGAGGGTGGGAGGAGAGG - Intergenic
1016029415 6:139322397-139322419 ATGGAAAGGGCTGGCAGGAGTGG - Intergenic
1016298039 6:142597092-142597114 AGAGAAGAGGGTGGCAAGAAGGG + Intergenic
1016649159 6:146444165-146444187 AGGGAAGGGGATGGGAGGGGAGG + Intergenic
1016749184 6:147613768-147613790 AGGAAAAGAGGTGGCAGGAGAGG + Intronic
1017510791 6:155112875-155112897 AGGGAGGGGGGTGGTAGGGGAGG - Intronic
1017864353 6:158429951-158429973 AGGGAAGAAAGGGGCAGGAGAGG + Intronic
1017987949 6:159460860-159460882 AGGGGAGTGGGTGGGAGGATTGG - Intergenic
1018224058 6:161610759-161610781 AGGAAAGAGGATGCCAGGAGGGG + Intronic
1018719419 6:166561484-166561506 TGGGGAGGGGGTGGCAGTAGGGG - Intronic
1018802783 6:167236379-167236401 AGGGCAGCGGGTGGAGGGAGGGG + Intergenic
1018811961 6:167304936-167304958 AGGGGAGAAGGTGGCAGGAGTGG - Intronic
1018912695 6:168112089-168112111 AGGGAAGCTTCTGGAAGGAGAGG + Intergenic
1018963878 6:168468431-168468453 GGGGAAGGTGGTGGCAGGAGTGG - Intronic
1019074826 6:169378867-169378889 AGGGACGTCGTTGGCAGGAGAGG - Intergenic
1019205727 6:170360045-170360067 AGGGAAGAGGGGAGCAGGTGAGG - Intronic
1019273423 7:163461-163483 GGGGAAGCCCGTGGCAGGCGTGG + Intergenic
1019316224 7:388207-388229 AAGGAAGTCGGTGGCTGGAGAGG - Intergenic
1019327231 7:444470-444492 GGGGAAGTGGGTGGAAGGAAAGG - Intergenic
1019381822 7:727791-727813 AGGGAGGAGGGTGGGAGGTGAGG - Intronic
1019415615 7:925433-925455 AGGGAAGAGGGAGGAGGGAGAGG - Intronic
1019494656 7:1332144-1332166 AGGGGAGGGGCTGGGAGGAGCGG + Intergenic
1020016868 7:4836327-4836349 CGGGCAGTGGGTGTCAGGAGGGG + Intronic
1020274474 7:6615955-6615977 AGGGAAGGGGCTGAGAGGAGCGG - Exonic
1020281717 7:6653366-6653388 AGCCCAGCGGGTGGGAGGAGGGG - Exonic
1020564560 7:9778874-9778896 AGCGAAGAGGGTAGCTGGAGAGG + Intergenic
1022503718 7:30897771-30897793 AGGAAAGTGGGTGGGAGGAGGGG + Intergenic
1022559247 7:31332372-31332394 CTGGAAGGGGCTGGCAGGAGGGG + Intergenic
1023874379 7:44278729-44278751 AGGCAGGCTGGGGGCAGGAGAGG + Intronic
1023967213 7:44969284-44969306 AGGGGTGGGGGTGGCAGAAGTGG + Intronic
1024524425 7:50336387-50336409 AGGGGTGGAGGTGGCAGGAGTGG + Intronic
1025007692 7:55366689-55366711 TGGGAAGCGGGTGTAAGGGGAGG + Intronic
1025198378 7:56948527-56948549 CAGGAAGGGGGTGGCTGGAGGGG - Intergenic
1025673572 7:63628406-63628428 CAGGAAGGGGGTGGCTGGAGGGG + Intergenic
1025958326 7:66199637-66199659 AGGGAAGATGGTGGCAGAGGTGG - Intergenic
1025992862 7:66508731-66508753 AGGGAAGAGGGAGGAAGGAAGGG - Intergenic
1026028010 7:66762707-66762729 GGGGACGGGGGTGGCAGGAGAGG - Intronic
1026323600 7:69288609-69288631 AGGGAAGTGGGTGGAAGCAGAGG - Intergenic
1026964558 7:74430997-74431019 AGGGAGGAGGGAGGCAGGTGAGG - Intergenic
1027397150 7:77767785-77767807 AGGGAAGGGGGAGGGAGAAGGGG - Intronic
1027519649 7:79189546-79189568 AGGGAAGCTGGGGGAAGGAGGGG - Intronic
1027714471 7:81652952-81652974 TGTGAAGTGGGTGGCAGCAGAGG + Intergenic
1028330114 7:89579805-89579827 AGGGCGGGGGGTGGCAGGAGTGG + Intergenic
1029270779 7:99375348-99375370 GGGGAGGCGGGTGGGAGCAGCGG - Intronic
1029412947 7:100427125-100427147 AGGGAGGAGGGAGGGAGGAGGGG - Intronic
1029494860 7:100891131-100891153 CGGGCAGCGGCTGGGAGGAGGGG - Intronic
1029702329 7:102255210-102255232 AGGGAAGGTGGTGGTGGGAGAGG - Exonic
1029941179 7:104482225-104482247 AGGGAAGTGGGTAACAGCAGAGG - Intronic
1030260902 7:107563528-107563550 AGGGAAGCTGGAGGCATGGGGGG + Intronic
1030835913 7:114285028-114285050 AGGGTTGAGGGTGGGAGGAGGGG + Intronic
1031070089 7:117152532-117152554 AGGAAAGCAGGTGGGAGGAATGG - Intronic
1031312291 7:120213476-120213498 AGGGGAGAGGGTGGAAGGAGGGG + Intergenic
1031563204 7:123263095-123263117 AGGTAAAAGGGTGGCAAGAGCGG - Intergenic
1031586347 7:123535149-123535171 AGGGAAGCGGCAGGGAGAAGGGG + Intergenic
1032018679 7:128394813-128394835 GGGGAAGTCGGTGGCATGAGCGG + Intronic
1032479741 7:132236750-132236772 AGGGAGACAGGTGGCAAGAGTGG - Intronic
1032578472 7:133081370-133081392 TGGGGAGTGGGTGGGAGGAGGGG + Intronic
1032738090 7:134711175-134711197 AGGGAAGTGGTTGGGAGGACAGG + Intergenic
1033157007 7:138965884-138965906 AGGGAAGTGGGTGCTAGGGGTGG - Intronic
1033821182 7:145135884-145135906 AGGGTAGTGGGTGGTTGGAGGGG - Intergenic
1034255434 7:149722311-149722333 AGGGACTTGGGTGGCTGGAGAGG + Intronic
1034513250 7:151553339-151553361 AGGGGAGAGGGTGGCAGTCGAGG - Intergenic
1034967266 7:155399054-155399076 AGGGAAAAGGGTGGGAGGCGAGG + Intergenic
1034975947 7:155449381-155449403 AGGGGAGGGGGAGGAAGGAGCGG - Intergenic
1036295196 8:7529193-7529215 AGGGAAGGGGAGGGGAGGAGTGG - Intergenic
1036327374 8:7791825-7791847 AGGGAAGGGGAGGGGAGGAGTGG + Intergenic
1036962930 8:13265719-13265741 AGGGAAGGGGAGGGGAGGAGAGG - Intronic
1037364564 8:18108007-18108029 AGGGGGCAGGGTGGCAGGAGGGG + Intergenic
1037834209 8:22206827-22206849 AGGGAAGCGAGTGACGGAAGGGG - Intronic
1037847464 8:22296333-22296355 AGGGAAGAGGGGGCCAGGCGCGG - Intronic
1038311978 8:26451631-26451653 AGGGAAGAGGGAAGCTGGAGAGG + Intronic
1038397794 8:27259888-27259910 AGGGCAGGGTGAGGCAGGAGAGG + Intergenic
1038477415 8:27877919-27877941 AGGAAGGCGGCTGGGAGGAGTGG + Intronic
1038644479 8:29350854-29350876 CGGGGAGGGGGTGGGAGGAGGGG - Intergenic
1038650847 8:29401997-29402019 AGGGAAGAGGGAGGGAGGAAGGG - Intergenic
1038686006 8:29719111-29719133 GGGGAAGCGGAAGGCAGCAGGGG - Intergenic
1038948795 8:32391134-32391156 AGGGGGGCTGGTGGCAGGACAGG + Intronic
1039125009 8:34191737-34191759 AGGGGAGCGGAGGGGAGGAGAGG - Intergenic
1039132519 8:34283374-34283396 TAGGAAGAGGGTGGTAGGAGTGG + Intergenic
1039343403 8:36675755-36675777 AGGGAATCAGAGGGCAGGAGGGG - Intergenic
1039542148 8:38381627-38381649 GGGGAAGCGGGTGGCCTGAAAGG - Intronic
1039890464 8:41682303-41682325 AGGGAAGCGGGTGGCACTCGAGG - Intronic
1040676648 8:49758017-49758039 AGGGAAAGGTCTGGCAGGAGTGG - Intergenic
1040681890 8:49820708-49820730 AGGGAAGGGGAGGGAAGGAGAGG + Intergenic
1040746023 8:50643446-50643468 AGGGAAGCAGCTGGCAAGAGGGG + Intronic
1041045029 8:53880540-53880562 AAGGGAGCGGGAGGAAGGAGCGG - Intronic
1041169156 8:55123433-55123455 AGGCCAGTGGGTGGAAGGAGTGG + Intronic
1041586780 8:59529851-59529873 AGGGAAGCGAGAGGAGGGAGGGG - Intergenic
1041614943 8:59895560-59895582 GTGGAAGCGGGGAGCAGGAGAGG - Intergenic
1041748117 8:61231537-61231559 AGGGAGGTGGGTGGGAGGAAGGG - Intronic
1042021933 8:64378008-64378030 AGGGAGGCGGGAGAGAGGAGGGG - Intergenic
1043289342 8:78577342-78577364 AGGGTAGAGCGTGGGAGGAGGGG + Intronic
1043858222 8:85286168-85286190 AGGGAAGGGGAAGGGAGGAGAGG + Intergenic
1044497078 8:92899377-92899399 TGGGGAGGGGGTGGAAGGAGTGG - Intronic
1044857926 8:96494655-96494677 AGGGGAAAGGGTGGCAGGAGGGG + Intronic
1045236441 8:100356480-100356502 AGGGTAGTGGGGGGCAGGAAAGG + Intronic
1045331033 8:101155762-101155784 AGGGAGACGAGTAGCAGGAGGGG - Intergenic
1045505040 8:102772274-102772296 AGGGAAGGGGAGGGGAGGAGAGG + Intergenic
1045708095 8:104950725-104950747 TGGGGAGGGGGTGGCAGGCGAGG - Intronic
1046028701 8:108756766-108756788 AGGGGAGGGGAGGGCAGGAGGGG + Intronic
1046155852 8:110289344-110289366 AAGGAAGTGGGGGGCAGCAGAGG - Intergenic
1046380547 8:113444291-113444313 AGGGGAGGGGGTGGGAGCAGAGG - Intergenic
1047297442 8:123583618-123583640 AGGGGAGTGGGAGACAGGAGAGG + Intergenic
1047365238 8:124205216-124205238 GTGGAAGAGGGAGGCAGGAGAGG + Intergenic
1047899578 8:129405549-129405571 AGAGAAGAGGGTGGAAGGAGAGG + Intergenic
1048124010 8:131612611-131612633 AGGGAAGGAGTTGGCAGTAGAGG + Intergenic
1048436564 8:134423966-134423988 AGGGAGGCAGGTGGCAGGCATGG - Intergenic
1048507139 8:135031805-135031827 AGGGGAGTGGGTGGGAGGAAGGG - Intergenic
1048716103 8:137272035-137272057 GGGGCAGAGGGTGGGAGGAGAGG + Intergenic
1048925138 8:139264867-139264889 AGGGAGGAGGGAGGCGGGAGGGG - Intergenic
1049282949 8:141759777-141759799 TGGGAAGCGGCTGGCAGTGGAGG - Intergenic
1049579698 8:143405695-143405717 AGGGAGGCGGAGGGCAGCAGGGG - Intergenic
1049712429 8:144071294-144071316 AGGGGAGCGGAGGGGAGGAGAGG - Intergenic
1049856403 8:144864681-144864703 AGGGAAGTGTGTGGTAGAAGAGG + Intergenic
1049945757 9:593844-593866 AGGGAATGGGATGGCAGGTGGGG + Intronic
1050445296 9:5715801-5715823 AGGGAAGGGGATGGGAGGGGAGG - Intronic
1050720345 9:8581777-8581799 AGGGAAGGGGAGGGGAGGAGAGG + Intronic
1051331890 9:16032142-16032164 AGGGAGGAAGGTGGCAGGAGAGG + Intronic
1052619578 9:30889150-30889172 AGAGAAGAAGGGGGCAGGAGGGG - Intergenic
1053131894 9:35620041-35620063 AGAGCAGCTGGTGGCAGGGGTGG + Intronic
1053566086 9:39253658-39253680 AGGGAAGCAGGAGGAAGGTGGGG - Intronic
1053788037 9:41666197-41666219 AGGGAGGAGGGAGGCAGGAAGGG + Intergenic
1053831853 9:42091473-42091495 AGGGAAGCAGGAGGAAGGTGGGG - Intronic
1053887692 9:42656861-42656883 AGGGAATAGGGTGTCAGGAGAGG + Intergenic
1054131062 9:61365382-61365404 AGGGAAGCAGGAGGAAGGTGGGG + Intergenic
1054157096 9:61648571-61648593 AGGGAGGAGGGAGGCAGGAAGGG - Intergenic
1054176313 9:61877539-61877561 AGGGAGGAGGGAGGCAGGAAGGG + Intergenic
1054476871 9:65579576-65579598 AGGGAGGAGGGAGGCAGGAAGGG - Intergenic
1054598691 9:67095953-67095975 AGGGAAGCAGGAGGAAGGTGGGG + Intergenic
1054661226 9:67703269-67703291 AGGGAGGAGGGAGGCAGGAAGGG - Intergenic
1054883663 9:70172508-70172530 AGGGAAGCGGGTGGTCTCAGAGG - Intronic
1055350181 9:75378556-75378578 ATGGGGGAGGGTGGCAGGAGGGG + Intergenic
1055687424 9:78791712-78791734 AGGGAAGCAGGAGGTAGGAAGGG + Intergenic
1056722288 9:89082432-89082454 AGGGAAGCATGCAGCAGGAGTGG - Intronic
1056926273 9:90837481-90837503 AGCCAAGCAGGAGGCAGGAGAGG + Intronic
1057192957 9:93097375-93097397 AGGGGAGCAGGTGGCAGCTGGGG - Intronic
1057395136 9:94673503-94673525 AGGGTGGAGGGTGGGAGGAGAGG + Intergenic
1057456287 9:95215339-95215361 AGGGAAGAAGGTGGTAGGAGAGG + Intronic
1057502543 9:95607198-95607220 AGTGAGGCGCCTGGCAGGAGAGG - Intergenic
1057522620 9:95772138-95772160 AGGGGAGGGGCTGGGAGGAGGGG + Intergenic
1057586267 9:96331518-96331540 AGGGGAAAGGGTGGCAGGAGGGG - Intronic
1057605195 9:96494003-96494025 GGGAAAGCGGGTAGGAGGAGGGG - Intronic
1058638801 9:107063204-107063226 AGGGAATAGGGAGGCAGGAGCGG + Intergenic
1059141814 9:111860321-111860343 AGGGAAGCGGGAGTGAGGAGAGG - Intergenic
1059542484 9:115144276-115144298 AGGGAAGGGGAGGGGAGGAGAGG - Intronic
1060124035 9:121024295-121024317 AGGGGAGCGGGAGGGGGGAGGGG + Intronic
1060124068 9:121024350-121024372 AGGGGAGCGGGAGGGGGGAGGGG + Intronic
1060473885 9:123970905-123970927 AGGGAAGGGGAGGGGAGGAGAGG - Intergenic
1060546768 9:124466426-124466448 TGGGAGGGGGGTGTCAGGAGGGG + Intronic
1060853178 9:126894462-126894484 AGGGAAGGGGGTGGCAGGGAAGG + Intergenic
1061393337 9:130329999-130330021 AGGGAAGAGGGAGACAGGAGAGG - Intronic
1061406440 9:130395187-130395209 TGGGAAGGGGGTGGCACAAGAGG - Intronic
1061517082 9:131096374-131096396 CGCGGAGCGGGTGGCGGGAGGGG + Intergenic
1061708104 9:132468468-132468490 AGGGCAGGGGCTGGCAGGTGGGG - Intronic
1061913568 9:133737764-133737786 AGGGAGGTGGCAGGCAGGAGGGG - Intronic
1061927911 9:133815184-133815206 AGGGAAGAGGGAGGCGGGCGGGG - Intronic
1062050556 9:134444536-134444558 AGGGAGGGGGATGGAAGGAGGGG - Intergenic
1062105714 9:134753769-134753791 AGGGCTGGGGGTGGCAGGGGAGG - Intronic
1062111362 9:134783749-134783771 AAGGAAGGGGGAGGAAGGAGGGG + Intronic
1062127019 9:134869434-134869456 AGGGCAGCTGGTCCCAGGAGAGG - Intergenic
1062212183 9:135371148-135371170 GGGGGAGCTGGAGGCAGGAGGGG - Intergenic
1062446242 9:136596526-136596548 AGGGTAGGGTGTGGAAGGAGGGG - Intergenic
1062451826 9:136618963-136618985 AGGGAGGCGGGTCCCAGGAGAGG + Intergenic
1062618297 9:137407827-137407849 CGGGAGGCGGGAGGCGGGAGGGG + Intronic
1062625046 9:137438757-137438779 AGGGGGGCGGGGGGCAGCAGAGG + Intronic
1062682091 9:137787627-137787649 GTGGAAGCGGGAGGGAGGAGGGG + Intronic
1185589858 X:1268840-1268862 AGAAAAGCAGGTGGAAGGAGAGG + Exonic
1185763846 X:2708671-2708693 AGGGCAGAGGGTGGGAGAAGGGG + Intronic
1185822536 X:3219297-3219319 AGGGCAGATGGGGGCAGGAGGGG + Intergenic
1185918885 X:4066928-4066950 AGGGTGGAGGGTGGGAGGAGGGG + Intergenic
1186296222 X:8151390-8151412 AGGTCAGCTGGTGGCTGGAGAGG + Intergenic
1186555727 X:10556325-10556347 GGGGATGCGGGTGGCAGGGGTGG - Intronic
1186613221 X:11159156-11159178 AAGGAGGCGGGTGGTAGGAAGGG + Intronic
1187045984 X:15647548-15647570 GGGGAAGGGGGAGGGAGGAGCGG + Intronic
1187051963 X:15703850-15703872 GGGGAAGGGGGAGGGAGGAGCGG + Intronic
1187194758 X:17072511-17072533 AGGGATGGGTGTGGAAGGAGGGG - Intronic
1187490340 X:19745323-19745345 AGGGCAGCTGGAGGCAGTAGAGG + Intronic
1187695642 X:21917037-21917059 GGGGAAGCGGGAGGTAGGTGAGG - Intergenic
1188505060 X:30873563-30873585 AGGGGAGGAGGTGGAAGGAGAGG - Intronic
1188828943 X:34872560-34872582 AGGGTAGAGTGTGGGAGGAGGGG + Intergenic
1189168312 X:38883766-38883788 AGGAAGGAGGGTGGGAGGAGGGG - Intergenic
1189172888 X:38926355-38926377 AGGGAAGCAGGAGACAGAAGGGG + Intergenic
1190253028 X:48741901-48741923 TGAGAAGCGGGAGGCTGGAGAGG + Intergenic
1190566165 X:51732384-51732406 AGGCAAGCGGGTGCCAGGCTGGG - Intergenic
1193406822 X:81110729-81110751 AGGGAAGAGTGGGGTAGGAGTGG - Intergenic
1194214751 X:91115986-91116008 AAGGTGGAGGGTGGCAGGAGGGG + Intergenic
1194640484 X:96398435-96398457 ATTGAAGGGAGTGGCAGGAGAGG - Intergenic
1194880942 X:99251636-99251658 AGGGTAGTAGGTTGCAGGAGGGG - Intergenic
1194887916 X:99340871-99340893 GGGGAAGAGGGTGGCTGGAGGGG - Intergenic
1194977920 X:100411364-100411386 TGGGAAGCGGGAGGCCGGCGTGG + Intergenic
1195624547 X:106994367-106994389 AGGGAAGAGGGTGGAAGGGAAGG - Intronic
1196160662 X:112479059-112479081 AGGGTAGTGGGAGGCTGGAGAGG - Intergenic
1196237571 X:113300041-113300063 AGGGGAGCGGATGGGAGGGGAGG - Intergenic
1196419542 X:115507963-115507985 TGGGCAGCGGGTGGCAGGGAGGG - Intergenic
1196429338 X:115606081-115606103 AGGGGGGCGGGGGGCAGGAATGG + Intronic
1197178976 X:123513910-123513932 TGGGAAGCGGGTGGGAGGCAGGG - Intergenic
1197626245 X:128805200-128805222 AGAAAAGCTGGTGGCAGGATGGG + Intergenic
1197749067 X:129952672-129952694 AGGAGAGCGGGAGGGAGGAGGGG - Intergenic
1197823284 X:130563142-130563164 AGGGAAGCGGGTGGGGGGAGGGG + Intergenic
1199153011 X:144511447-144511469 AGGGGAGAGGGTGGGAGGTGGGG + Intergenic
1199264774 X:145817781-145817803 AGTAAAGCGGGAGGGAGGAGAGG - Intergenic
1199637503 X:149827146-149827168 AGGGGAGGGACTGGCAGGAGTGG - Intergenic
1200070748 X:153527841-153527863 AGGGGAGCGTGTGGCGGGAGGGG + Intronic
1200139104 X:153889084-153889106 AGGGCAGGGGGTGGTGGGAGTGG - Intronic
1201184054 Y:11380665-11380687 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1201580953 Y:15511791-15511813 CTGGAAGCATGTGGCAGGAGGGG - Intergenic