ID: 912698895

View in Genome Browser
Species Human (GRCh38)
Location 1:111861569-111861591
Sequence GGGAAGCGGGTGGCAGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1538
Summary {0: 1, 1: 1, 2: 10, 3: 171, 4: 1355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698884_912698895 -2 Left 912698884 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698882_912698895 9 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698887_912698895 -9 Left 912698887 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698880_912698895 15 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698881_912698895 10 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355
912698879_912698895 16 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG 0: 1
1: 1
2: 10
3: 171
4: 1355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698895 Original CRISPR GGGAAGCGGGTGGCAGGAGG GGG Intronic
900087383 1:904953-904975 GGGAGGCGGGTGAGGGGAGGGGG + Intergenic
900143092 1:1146659-1146681 GGGAAGCGGGTGCAGGGAGTGGG + Intergenic
900339226 1:2179965-2179987 GGGCAGCGGGTGGGAGCAGGAGG + Intronic
900621009 1:3587934-3587956 GGGCAGGAGGGGGCAGGAGGGGG + Intronic
900621014 1:3587944-3587966 GGGCAGGAGGGGGCAGGAGGGGG + Intronic
900647953 1:3717530-3717552 GGGAAGGAGAAGGCAGGAGGGGG + Intronic
900836316 1:5007167-5007189 GGGAAGGAGGTGGTAGAAGGAGG - Intergenic
901279088 1:8018360-8018382 TGGAAGCGGGGGGCGGGGGGGGG + Intronic
901400737 1:9013749-9013771 AGGAAGAGGGTAGCAGGTGGTGG + Intronic
901636389 1:10672208-10672230 GGGGAGGGGGTGGCGGGGGGAGG - Intronic
901640116 1:10688852-10688874 GAGAAGCTGGGAGCAGGAGGAGG - Intronic
901648478 1:10729109-10729131 GGGAAGGGGTGGGGAGGAGGGGG + Intronic
901668098 1:10837888-10837910 GGGTAGCAGCTGGAAGGAGGTGG + Intergenic
901817606 1:11803685-11803707 GGGAGGCGGATGGAAGGAGGGGG + Intronic
901842157 1:11960602-11960624 GGGATGCGGGGGTGAGGAGGAGG - Intronic
901874271 1:12158080-12158102 AGGAAGGGGGTGGGAGGAGGAGG + Intergenic
902086822 1:13869029-13869051 GGGAGGAGGGTGGGAGTAGGAGG + Intergenic
902203929 1:14853513-14853535 TGGATGCAGGTGGTAGGAGGGGG + Intronic
902387310 1:16083300-16083322 AGGAAGGGGCTGGCAGGGGGTGG - Intergenic
902393403 1:16119145-16119167 GGGGAGAGGGTGCCAGGAGTGGG + Intergenic
902468128 1:16630633-16630655 GGGCAGCCGGTGGAGGGAGGAGG - Intergenic
902490820 1:16779330-16779352 GGGAAGAGGGTAGGAGGGGGAGG + Intronic
902506031 1:16939396-16939418 GGGCAGCTGGTGGAGGGAGGAGG + Intronic
902542892 1:17166965-17166987 GGGCATCAGGTGGCAAGAGGTGG - Intergenic
902555072 1:17241981-17242003 AGGATGCAGGTTGCAGGAGGTGG + Intronic
902652966 1:17848683-17848705 GGGGGGTGGGTGGCGGGAGGGGG - Intergenic
902985751 1:20153110-20153132 AGGGAGCGGGTGGGAGGAGGAGG + Intergenic
903034715 1:20486239-20486261 GGGAGGAGGGCGGGAGGAGGCGG + Intergenic
903155013 1:21437055-21437077 GGGCAGCTGGTGGAAGGAGGAGG + Intergenic
903271406 1:22190589-22190611 GGGATCAGGGAGGCAGGAGGAGG + Intergenic
903333973 1:22612833-22612855 GGGAAGGTGGTGGCAGATGGTGG - Intergenic
903458217 1:23503622-23503644 GGCAGGCGGGTGGGAGGTGGAGG - Intergenic
903553667 1:24177535-24177557 GGAAAGCAGGTGGCAGATGGTGG - Intronic
903555079 1:24187288-24187310 GGGAGGCGGGAGGCGGGAGGCGG - Intronic
903750199 1:25616750-25616772 GGCCGGCGGGCGGCAGGAGGCGG + Intergenic
903794744 1:25920230-25920252 GGGGAGAGGGTGCCAGGAAGAGG + Intergenic
903973757 1:27136296-27136318 TGGGAGCAGGGGGCAGGAGGAGG + Intronic
904043452 1:27597149-27597171 GGGGGGCAGGTGGCAGGGGGAGG + Intronic
904128702 1:28260149-28260171 GGGGAGAGGGAGGGAGGAGGGGG - Intronic
904328639 1:29744034-29744056 AGGCAGCGGGTCGCAGAAGGAGG - Intergenic
904390807 1:30184568-30184590 GAAAAGAGGGTGGGAGGAGGAGG - Intergenic
904615194 1:31745794-31745816 GGGCAGCAGGGGGCAGGAAGAGG - Intronic
904812663 1:33173520-33173542 GGGGAGGGTGTGGCAGGAGGAGG - Intronic
904842088 1:33379344-33379366 GGGATGGGGGGGGCAGGGGGCGG - Intronic
904899307 1:33843907-33843929 GGGAAGAAGGTGGCAAGAGCTGG - Intronic
904927061 1:34057622-34057644 GGGAAGCGGTGGCCAAGAGGCGG - Intronic
904927342 1:34059358-34059380 GGGAAGAGGGTGTCAGATGGAGG - Intronic
905108164 1:35576290-35576312 AGGAAGTGGGTGGGGGGAGGTGG + Intronic
905215956 1:36407772-36407794 GGAATGTGGGTGGAAGGAGGAGG + Intergenic
905244912 1:36606055-36606077 GAGAAGCAGATGGAAGGAGGGGG + Intergenic
905273924 1:36805127-36805149 GGGCAGCGGGTGTCCTGAGGAGG - Exonic
905385980 1:37604527-37604549 GGGATGGGGGTGGCAGGAGATGG + Intergenic
905647184 1:39633000-39633022 GGGGATCGGGTTGCAGGAGCCGG - Intronic
905687810 1:39921475-39921497 GGAAGGTGGGCGGCAGGAGGTGG - Intergenic
905806510 1:40881319-40881341 GGGGAGTGGGTGGCTGGAGGTGG + Intergenic
905817206 1:40960852-40960874 GGGAGGCGGGTGGCGGGGGGGGG + Intergenic
905876649 1:41435878-41435900 GGGCTGAGGGTGGCAGGGGGCGG - Intergenic
906024056 1:42658234-42658256 GGGACGCGGGAGTGAGGAGGAGG - Intergenic
906216709 1:44045348-44045370 GGGAAGAGGGTTTCAGGCGGAGG - Intergenic
906290808 1:44618120-44618142 GGGCAAAGGGAGGCAGGAGGTGG - Intronic
906344705 1:45007893-45007915 GGGATGAGGGTGGAAGGATGTGG - Intronic
906534537 1:46544238-46544260 GGGTTCCGGGTGGCGGGAGGCGG - Intergenic
906591014 1:47024005-47024027 GGGAGGAGGGAGGAAGGAGGAGG + Intronic
906617151 1:47241257-47241279 CTGAACTGGGTGGCAGGAGGAGG + Intergenic
906653837 1:47533628-47533650 GGGCAGGGGGTGGGAGAAGGCGG + Intergenic
907277057 1:53322552-53322574 GGGAAGTGGGTAACAGGAGCAGG + Intronic
908516480 1:64897517-64897539 GGGGAGGGGGAGGGAGGAGGAGG + Intronic
908683443 1:66688103-66688125 GGTAAGGGGGTGGCAGGTGTGGG + Intronic
908728768 1:67204652-67204674 TGGAGGTGGGTGACAGGAGGAGG + Intronic
908751474 1:67428855-67428877 GAGAAGCACGTGGCAGGAAGGGG + Intronic
908908541 1:69045678-69045700 GGGTGGAGGGTGGCAGGAAGGGG - Intergenic
909170346 1:72285280-72285302 GGGTTGGGGGTGGTAGGAGGAGG + Intergenic
910876911 1:91886295-91886317 GGGAGGCGGGAGGCGGGAGGAGG - Intronic
910876914 1:91886302-91886324 AGGAGGCGGGAGGCGGGAGGCGG - Intronic
911020168 1:93378189-93378211 GGGAGGGGGCTGGCAGGAGTTGG - Intergenic
912044271 1:105435026-105435048 GGTAACAGGGTGGCAGGAGAAGG - Intergenic
912125964 1:106538531-106538553 GGGAAGGCGGGGGCAGGGGGTGG + Intergenic
912376484 1:109213828-109213850 CGGAAGCGGCTGGTTGGAGGCGG - Intergenic
912417585 1:109520509-109520531 GGGTAGCTGGGGGCATGAGGTGG + Intergenic
912698895 1:111861569-111861591 GGGAAGCGGGTGGCAGGAGGGGG + Intronic
912813864 1:112813606-112813628 GGGAAGCGGGGGGCAGGGGCGGG - Intergenic
912944691 1:114075173-114075195 TGGAGGTGGGAGGCAGGAGGTGG + Intergenic
912954474 1:114144922-114144944 GGGAAGGGGGTGGTGGTAGGTGG - Intronic
913200967 1:116495163-116495185 GGGAAGCCGGAGGAAGGAGCAGG - Intergenic
913464432 1:119125205-119125227 GGGAAGAGGATGCCAGGAAGAGG - Intronic
913680743 1:121185825-121185847 GGGAAGCGGGAAGCGAGAGGCGG - Intronic
914032575 1:143973467-143973489 GGGAAGCGGGAAGCGAGAGGCGG - Intergenic
914156871 1:145094500-145094522 GGGAAGCGGGAAGCGAGAGGCGG + Intronic
914196455 1:145450497-145450519 GGGGAGGAGGTGGGAGGAGGCGG - Intergenic
914419672 1:147517855-147517877 GGGCAGCGGGTTGCAGCAGCTGG + Intergenic
914428479 1:147599823-147599845 GGGAAGCTGGGGGCGGGAGGAGG + Intronic
915107422 1:153543110-153543132 TGGAAGTGGGTGGCAGGACAGGG + Intergenic
915272793 1:154767038-154767060 GGGAAGGAGATGGGAGGAGGAGG + Intronic
915310239 1:155002752-155002774 GGGGGGCGGGCGGCAGGAGGAGG + Exonic
915514085 1:156402574-156402596 GGGATGCTGCTGGGAGGAGGAGG - Intergenic
915524711 1:156468544-156468566 GGGTAGGGGGTGGGAGGTGGGGG - Intronic
915565384 1:156710031-156710053 GGGAAGGGAGAGGGAGGAGGTGG + Intergenic
915570544 1:156743105-156743127 GGGAGAAGGGTGTCAGGAGGTGG + Intronic
915598414 1:156908072-156908094 GGGAGACGGGAGGGAGGAGGTGG + Intronic
915714165 1:157929047-157929069 GGGAAGGGGGTGGTAGGAGTTGG - Intergenic
915898787 1:159831451-159831473 GGGTAACAGGTGGCAGGGGGTGG - Intronic
915902021 1:159854481-159854503 GGGGAGAGGGAGGGAGGAGGAGG - Exonic
916107224 1:161441041-161441063 GGGGGGCGGGTGGCAGGTGACGG - Intergenic
916108811 1:161448459-161448481 GGGGGGCGGGTGGCAGGTGACGG - Intergenic
916110399 1:161455840-161455862 GGGGGGCGGGTGGCAGGTGACGG - Intergenic
916111984 1:161463250-161463272 GGGGGGCGGGTGGCAGGTGACGG - Intergenic
916113571 1:161470631-161470653 GGGGGGCGGGTGGCAGGTGACGG - Intergenic
916206762 1:162322400-162322422 GGGAAGCTTGGGGAAGGAGGTGG + Intronic
916276269 1:162997059-162997081 GGGAGGTGGGTGGCAGGTGATGG + Intergenic
916453239 1:164941846-164941868 GGGAGGAGGGTGGGAGGAAGAGG - Intergenic
916696496 1:167242934-167242956 GAGAGGCAGGTGGAAGGAGGGGG - Intronic
916773983 1:167940376-167940398 GGGAGGCGGGGGGCAGGGTGAGG + Intronic
916843555 1:168625531-168625553 AGAAAGAAGGTGGCAGGAGGGGG - Intergenic
917038295 1:170773576-170773598 GGGAAGGGGGAGGAAGGGGGAGG + Intergenic
917639387 1:176968469-176968491 GGGAAGTGGGAGGTGGGAGGTGG - Intronic
918407640 1:184226342-184226364 GGGAAGTGGGTGGCAGGGGCGGG - Intergenic
919075619 1:192809199-192809221 GGGCAGGGGGTGGCGGGAGAGGG - Intronic
919176716 1:194028420-194028442 GGGGAGGGGGAGGAAGGAGGAGG - Intergenic
919518484 1:198556860-198556882 GGGAAGATGGAGGCAGGAGAGGG + Intergenic
919531079 1:198720950-198720972 GGGAAGAGCGTGGAGGGAGGTGG - Intronic
919801976 1:201359571-201359593 GGGAAGGAGGGGGCAGGGGGAGG + Intronic
919842834 1:201622105-201622127 TAGACGAGGGTGGCAGGAGGTGG + Intergenic
919850365 1:201668242-201668264 TGGTAGGGGGTGGCAGGAGGCGG - Intronic
919978087 1:202625760-202625782 GGGAGGCCGGAGGCAGAAGGAGG + Intronic
920180043 1:204127023-204127045 GTGAAGGGGAGGGCAGGAGGAGG - Exonic
920236370 1:204509236-204509258 GGGAGGGTGGCGGCAGGAGGGGG - Intergenic
920287995 1:204895328-204895350 GGGAAGGGGCTGGCAGGAAATGG - Intronic
920468055 1:206204351-206204373 GGGAAGCGGGAAGCGAGAGGCGG - Intronic
920500327 1:206481317-206481339 GGGCTGGGGGTGGCGGGAGGAGG - Intronic
920559621 1:206930109-206930131 GGGATGAGGGTGGCATGAGGAGG - Exonic
920850211 1:209623426-209623448 AGGAAGCAGGTGGCAGCAGTTGG + Intronic
920960738 1:210661834-210661856 GGCAGGTGGGTGGCAGGGGGAGG + Intronic
921077610 1:211712488-211712510 GGGAAGCAGGTGGCAGCAACAGG - Intergenic
921121051 1:212137949-212137971 GGGAAAGTCGTGGCAGGAGGGGG + Intergenic
921808062 1:219478466-219478488 GGGAAGCCGGTGGTAGGAGGTGG + Intergenic
922050998 1:221990556-221990578 TGGATGAGGGTGGCAGGAAGAGG - Intergenic
922234515 1:223712880-223712902 AGGAAGCGCGCGGCAGGACGCGG + Intronic
922314958 1:224434409-224434431 GGGAAGCCGGTGGGGCGAGGCGG + Intronic
922427662 1:225514696-225514718 GGGAGGGGTGGGGCAGGAGGTGG + Exonic
922455536 1:225770896-225770918 GGGAAGGGGATGGGAGGAGGTGG + Intergenic
922580740 1:226695894-226695916 GGGAAGCGGGGAGGAGGGGGAGG + Intronic
922704175 1:227780291-227780313 GGCAGGCAGCTGGCAGGAGGTGG + Intronic
922722622 1:227906454-227906476 AGGGAGAGGGTGGGAGGAGGAGG - Intergenic
922788780 1:228298091-228298113 GGGAAGCAGGTGTCAGGACAAGG + Intronic
923033455 1:230267722-230267744 ACGAAGCGGGTGAAAGGAGGAGG + Intronic
923258520 1:232243686-232243708 TGGAAGAGTGGGGCAGGAGGAGG - Intergenic
923317509 1:232795591-232795613 GGGGACAGGGTGGCAGGAAGGGG - Intergenic
923529624 1:234803205-234803227 GGGAAGAGGGTAGGAGGGGGAGG - Intergenic
924343531 1:243055070-243055092 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
924400807 1:243678942-243678964 GTGGAGCGGGTGGAAGGAGAAGG - Intronic
1062797942 10:358613-358635 GGGACGGGGGTGGGAGGTGGGGG + Intronic
1062797964 10:358654-358676 GGGACGGGGGTGGGAGGTGGGGG + Intronic
1062797997 10:358716-358738 GGGACGGGGGTGGGAGGTGGGGG + Intronic
1062798023 10:358764-358786 GGGACGGGGGTGGGAGGTGGGGG + Intronic
1062798034 10:358784-358806 GGGACGGGGGTGGGAGGTGGGGG + Intronic
1062818158 10:516333-516355 GGGAGGCGGGGGAGAGGAGGGGG + Intronic
1062860977 10:809119-809141 AGGAAGAGGCTGGCGGGAGGCGG - Exonic
1063101202 10:2951391-2951413 GGGAGGCCGGTGGGAAGAGGAGG - Intergenic
1063275739 10:4565737-4565759 CGGGGGCGGGTGGGAGGAGGCGG + Intergenic
1063606799 10:7529660-7529682 GGGAGGAGGGTGGTAGGAGGTGG + Intergenic
1063730700 10:8694007-8694029 GGGTGGAGGGTGGAAGGAGGGGG + Intergenic
1064712408 10:18140664-18140686 GGGAGGCGGGGGCGAGGAGGAGG + Exonic
1064713033 10:18145952-18145974 GGGAGGAGGGAGGAAGGAGGAGG - Intronic
1066022668 10:31319176-31319198 GGGAAGGGGGAGGGAGGGGGAGG + Exonic
1066224998 10:33373553-33373575 TTGAAGTGGGAGGCAGGAGGAGG + Intergenic
1066357370 10:34698049-34698071 GGGAAGAGGTGGGCAGGATGTGG - Intronic
1066671460 10:37844927-37844949 GGGAAGGGGGAGGGAAGAGGAGG - Intronic
1066753417 10:38683867-38683889 GGGTGGAGGGTGGAAGGAGGGGG + Intergenic
1067059934 10:43073098-43073120 GGCAGGCTGGTGGGAGGAGGTGG + Intergenic
1067099979 10:43327595-43327617 GAGAACCGGGGGGCAGGAAGAGG - Intergenic
1067211770 10:44265482-44265504 GGACAGCAGGTGTCAGGAGGAGG + Intergenic
1067216615 10:44309440-44309462 GGGAAGGAGGTGGCGGGGGGAGG + Intergenic
1067460789 10:46456817-46456839 GGGTGGCTGGAGGCAGGAGGAGG + Intergenic
1067626402 10:47927783-47927805 GGGTGGCTGGAGGCAGGAGGAGG - Intergenic
1067942359 10:50667741-50667763 GGGAAGCAGGTGGTAGGAGATGG - Intergenic
1068075541 10:52249006-52249028 GGGAAGGGGAGGGAAGGAGGCGG - Intronic
1069618949 10:69824498-69824520 GGGAGGAATGTGGCAGGAGGGGG + Intronic
1069784235 10:70977678-70977700 GGGAGGTGGGTGGGTGGAGGGGG + Intergenic
1070354588 10:75627309-75627331 GGGAAGCAGGTGGAAGGGAGAGG + Intronic
1070803147 10:79255190-79255212 GGGACTCAGGTGGCAGGAGCAGG - Intronic
1070997455 10:80798005-80798027 GGGAGGTGGTTGGCAGGAGACGG + Intergenic
1071250607 10:83815229-83815251 GAGAAGTGAGAGGCAGGAGGTGG - Intergenic
1071492408 10:86144705-86144727 GGGGAGCGGGTGGGAGCAGAGGG - Intronic
1071527243 10:86365949-86365971 GAGCAGCGGGGGGCAGGGGGAGG - Intronic
1071532891 10:86402381-86402403 GGGAGGGCGGTGGCAGGAGGAGG + Intergenic
1071695245 10:87863407-87863429 GGGCAGGGGGCGGTAGGAGGGGG - Exonic
1071803335 10:89089500-89089522 GGGTAGCGGGTGGGAGGAGGAGG - Intergenic
1072039719 10:91595413-91595435 GGGTAGTGGGGGGCAGGAGGTGG - Intergenic
1072535563 10:96360124-96360146 GGGAAGAGAGTGGAAGCAGGTGG + Intergenic
1072697081 10:97611740-97611762 GGGATGAGGGTGGCAGGCAGCGG + Exonic
1072726054 10:97814939-97814961 GGGAAGCGGGTGGGGGCATGGGG - Intergenic
1072782370 10:98259476-98259498 AGGAACCAGGTGGCAGGGGGTGG - Intronic
1072787715 10:98295526-98295548 AGGAAGCCAGAGGCAGGAGGAGG + Intergenic
1072847055 10:98843184-98843206 GGGTGGAGGGTGGGAGGAGGAGG - Intronic
1073060775 10:100732171-100732193 GGGGAGGGGGTTGCTGGAGGCGG + Intergenic
1073096165 10:100980989-100981011 GGGAAGCAGGTGGGAAGTGGTGG + Exonic
1073108690 10:101048051-101048073 GGGAAGCCGGGGGAGGGAGGCGG - Intergenic
1073181692 10:101587503-101587525 GGGAAGCGGGTCGGGGGAGGGGG + Intronic
1073444190 10:103571139-103571161 GGGGAGCAGGAAGCAGGAGGCGG - Intronic
1073453417 10:103622626-103622648 GGGATGGGGGTGGGAGGAAGGGG + Intronic
1073597787 10:104817586-104817608 GGGAAGGGGATAGGAGGAGGGGG - Intronic
1073791210 10:106942285-106942307 GGGAAGCCGGAGGTGGGAGGAGG - Intronic
1074372138 10:112908691-112908713 GGGAAGCGGGGCCCAGGCGGAGG + Intergenic
1074425188 10:113344431-113344453 GGGAGGTGGGTGGGTGGAGGGGG + Intergenic
1074437302 10:113445071-113445093 GGTTAGGGGCTGGCAGGAGGAGG - Intergenic
1074686225 10:115964689-115964711 GGGAAGGGGGTTGCAAGGGGAGG + Intergenic
1074721835 10:116271457-116271479 GCGGAGCGGGTGGCTGGAGCCGG - Intronic
1074772136 10:116741642-116741664 GGGAAGGGGGTTGCGGGAAGAGG - Intronic
1075025469 10:118980331-118980353 GGGAAACGGGTTGCACCAGGAGG + Intergenic
1075458584 10:122600864-122600886 GGGAAGCAAGTGGCAGGAACAGG + Intronic
1075459215 10:122604923-122604945 GGGAAGCAAGTGGCAGGAACAGG + Intronic
1075459847 10:122608982-122609004 GGGAAGCAAGTGGCAGGAACAGG + Intronic
1075460479 10:122613041-122613063 GGGAAGCAAGTGGCAGGAACAGG + Intronic
1075461111 10:122617100-122617122 GGGAAGCAAGTGGCAGGAACAGG + Intronic
1075481930 10:122789617-122789639 GGGAAGCAGGAGGCTGCAGGAGG - Intergenic
1075629967 10:123994890-123994912 GGGAAGGGTGTGGAAGGGGGCGG - Intergenic
1075710935 10:124530204-124530226 GTGGGGCGGGAGGCAGGAGGCGG - Intronic
1076116872 10:127907126-127907148 GGACAGCGGGCGGCAGGAGCCGG + Exonic
1076189994 10:128476088-128476110 GGGAATGGGGTGGCAGGCTGAGG - Intergenic
1076408118 10:130226822-130226844 GGGCAGTGTGTGGCAGGAGTGGG + Intergenic
1076494900 10:130890714-130890736 GGAAAGAGAGTGGCAGCAGGTGG + Intergenic
1076516186 10:131045574-131045596 GGGAGGAGGGTGGAGGGAGGAGG + Intergenic
1077100953 11:822123-822145 GGGAAGTGGGTAACAGGCGGTGG - Intronic
1077180297 11:1209249-1209271 GGGACACGTGTGGAAGGAGGAGG - Intergenic
1077332057 11:1988167-1988189 GGGAGGTGGGAGGCGGGAGGCGG - Intergenic
1077368990 11:2172820-2172842 GGGCAGCGGCTGGGAGCAGGAGG - Intergenic
1077408710 11:2393740-2393762 GGGTGGCGGGTGGCAGGTGCAGG + Intronic
1077501513 11:2911618-2911640 GGGAAGGAGGCGGCAGCAGGCGG - Intronic
1077543265 11:3157607-3157629 GTGATGTGGGTGGCAGGAAGTGG - Intronic
1077548700 11:3189396-3189418 GGGAGGCGGGTGGGGGGTGGGGG + Intergenic
1078047556 11:7930314-7930336 CGGAGGAGGATGGCAGGAGGAGG + Intergenic
1078098679 11:8315941-8315963 GGGCAGCGGGTGGGAGGGAGGGG - Intergenic
1078377593 11:10808812-10808834 GGGAAGGGGGAGGAAGGAGTCGG + Intronic
1078449325 11:11428511-11428533 GGGAACAGGGAGGCAGCAGGAGG - Intronic
1078690552 11:13575756-13575778 GGGGGGTGGGGGGCAGGAGGAGG + Intergenic
1078786446 11:14499420-14499442 AGGAAGCGGGTGGGGCGAGGTGG - Intronic
1078991656 11:16653618-16653640 GGGAAGCGGGTAGGAGGGTGAGG + Intronic
1079245539 11:18749716-18749738 GGGAGCCGGGTGACAGGAGAGGG - Intronic
1079252904 11:18800425-18800447 GTGAAGGGGGTGGGAGAAGGTGG + Intergenic
1079489026 11:20966829-20966851 GGGCAGGGGGCGGCAGGGGGTGG - Intronic
1080034898 11:27700532-27700554 GGGGAGCGGGGGGCGGGGGGCGG - Intronic
1080376889 11:31723336-31723358 GGGGAGTGGGTGGCGGGGGGCGG - Intronic
1080657078 11:34266611-34266633 AGGAAGGGGGTGGCAGGGGAGGG - Intronic
1080700562 11:34640545-34640567 GGGTGGCTGGTGGAAGGAGGGGG - Intronic
1080824597 11:35837333-35837355 GTGAAGAGGGTGGAAGTAGGAGG - Intergenic
1081612741 11:44572831-44572853 TGGAAGCCGGTGGAAGAAGGTGG + Intronic
1081730756 11:45370189-45370211 GGGAAGGGGCAGTCAGGAGGAGG + Intergenic
1081851031 11:46275456-46275478 GGGAAAGGGGTGGCAGGGGGAGG - Intergenic
1081910553 11:46697286-46697308 GGGGAGCTTGTGGCAGGAGGGGG - Intronic
1082775848 11:57243914-57243936 GGTAAAAGGGTGACAGGAGGTGG - Intergenic
1082786913 11:57322384-57322406 GGGAAGGGGGAGGCAGGCAGTGG - Intronic
1082812044 11:57484328-57484350 GGGAAGTAGGGGGCAGGAGCTGG + Intergenic
1083252493 11:61477483-61477505 GGGAAGGGAGTGGGATGAGGTGG + Intronic
1083295196 11:61711509-61711531 GGAAGGCTGGGGGCAGGAGGAGG + Intronic
1083340163 11:61954211-61954233 GGGAGGCTGGGGGCAGGGGGAGG - Intronic
1083396895 11:62398627-62398649 GGGGAGCAGATGGGAGGAGGAGG - Intergenic
1083616362 11:64028461-64028483 GGGAGGTGGGAGGCAGGAGGCGG + Intronic
1083651591 11:64207691-64207713 GGGAAGAGGGTGGGAGGGAGAGG - Intronic
1083847563 11:65344960-65344982 GGAGAGAGGATGGCAGGAGGAGG - Intronic
1083862836 11:65433871-65433893 GCCTAGGGGGTGGCAGGAGGCGG - Intergenic
1084364025 11:68686008-68686030 GGGAAGAGGGAGGCAGGATTTGG - Intronic
1084498064 11:69516973-69516995 GCAATGCAGGTGGCAGGAGGGGG - Intergenic
1084606701 11:70176687-70176709 AGGAAGCAGGGGGCGGGAGGAGG - Intronic
1084737332 11:71114006-71114028 GCCAAGCGGGGGGCTGGAGGAGG - Intronic
1085313956 11:75532081-75532103 GGGAAGCATGAGGCATGAGGTGG + Intergenic
1085509740 11:77082235-77082257 GGGATGAGACTGGCAGGAGGAGG + Intronic
1085592590 11:77778101-77778123 GGGAAGGGGAGGGGAGGAGGGGG + Intronic
1086341433 11:85852727-85852749 GGGAGGCGGCTGGGAGGTGGAGG - Intergenic
1086518824 11:87646242-87646264 GGGAAGCGGAGGGGAGGAGGGGG - Intergenic
1086579017 11:88375092-88375114 GTGAGGTGGGTGGCAGGTGGCGG - Intergenic
1086949946 11:92881949-92881971 GGGAAGCTGGGGGCTGCAGGTGG - Intronic
1087655831 11:100921959-100921981 AGGAAGCTGTTGGCGGGAGGGGG + Intronic
1088582728 11:111331303-111331325 GGGGAGGGAGGGGCAGGAGGAGG - Intergenic
1088750269 11:112836966-112836988 GGGAAGAGAATGGCTGGAGGTGG + Intergenic
1089111797 11:116063129-116063151 GGGATGGGGGTAGGAGGAGGTGG + Intergenic
1089318985 11:117612425-117612447 GGGTAGGGGGAGGCAGGAGAAGG - Intronic
1089505305 11:118958344-118958366 GGGGAGAGGAGGGCAGGAGGAGG - Exonic
1089555111 11:119311882-119311904 CTGAAACGGGAGGCAGGAGGCGG - Exonic
1089579544 11:119472881-119472903 GGGGTGCAGGTGGGAGGAGGGGG + Intergenic
1089613970 11:119684938-119684960 GGGAGTCTGGAGGCAGGAGGGGG - Intronic
1089668088 11:120032978-120033000 TGGCAGAGGGTGGAAGGAGGGGG - Intergenic
1089690291 11:120182895-120182917 GGGGAGGATGTGGCAGGAGGAGG + Intronic
1089962586 11:122629038-122629060 AGTAAGAGGGAGGCAGGAGGAGG + Intergenic
1090068961 11:123527091-123527113 GGGTGGAGGGTGGGAGGAGGAGG + Intronic
1090624249 11:128592104-128592126 GGAATGGGGGTGGAAGGAGGGGG - Intergenic
1091286686 11:134412080-134412102 GGGAGGCGGGGGGCGGGGGGCGG + Intergenic
1202815038 11_KI270721v1_random:43343-43365 GGGAGGTGGGAGGCGGGAGGCGG - Intergenic
1091387478 12:103893-103915 GGGAGGCGGGGCTCAGGAGGGGG + Intronic
1091450506 12:569641-569663 GGGGAAGGGGTGGCAGGGGGTGG + Intronic
1091473789 12:752977-752999 GGGGCGCGTGTGGGAGGAGGCGG + Exonic
1091568145 12:1662601-1662623 GGGAAGTGGGGAGGAGGAGGCGG - Intergenic
1091601232 12:1918722-1918744 AGGGAGGGGGTGGCAGGGGGTGG + Exonic
1091628136 12:2138379-2138401 GGAAGGCAGGTGGCAGGTGGTGG + Intronic
1091648160 12:2289342-2289364 GGGGAGGGGGTGGATGGAGGAGG + Intronic
1091663595 12:2402434-2402456 TGGAAGAGGCAGGCAGGAGGTGG + Intronic
1091732402 12:2890843-2890865 GGAACGCGGTTGCCAGGAGGCGG + Intronic
1091768569 12:3137414-3137436 GGGAGGCAGGCAGCAGGAGGCGG - Intronic
1091782394 12:3222228-3222250 GGGAAGAGGGGGGCATGTGGAGG + Intronic
1091786706 12:3247304-3247326 GGGACGCGGGTGGCGGGGGGGGG - Intronic
1091789049 12:3260797-3260819 GGGAAGGGCGTGGCTGGTGGAGG + Intronic
1091823297 12:3491969-3491991 GAGCAGCGGGTGGCAGGAGAGGG - Intronic
1091855505 12:3736142-3736164 GGGAAGAAGATGGAAGGAGGGGG + Intronic
1091912247 12:4241999-4242021 GGGATGCCAGTGGAAGGAGGGGG + Intergenic
1092236584 12:6814468-6814490 GGGATGCTGGTGGGCGGAGGAGG + Intronic
1092810403 12:12266972-12266994 GGGAAGCGGGGCGCCGGGGGAGG - Intronic
1092825916 12:12398731-12398753 GGGAAGGGGGAGGCAGGTGGTGG - Intronic
1092923711 12:13255841-13255863 GGCAAGGGGGTGCCAGGAGCTGG - Intergenic
1093062305 12:14619841-14619863 GGGAAGCCTGTGGCACAAGGAGG + Intronic
1093090615 12:14916021-14916043 GGGTGGAGGGTGGGAGGAGGGGG + Intronic
1094023583 12:25940250-25940272 CAGAAGGGGGTGGCAGGAAGGGG - Intergenic
1094041652 12:26125804-26125826 GAGAAGGGGGTGGCACGAGAGGG + Intronic
1094469266 12:30788343-30788365 GGGAAGAGGGTAGAAGGAGATGG + Intergenic
1095818382 12:46450000-46450022 GGGGAGGGGGTGGCAGAGGGTGG - Intergenic
1095953297 12:47793338-47793360 GGGAGGAGGGTGGCGGGTGGAGG - Intronic
1096021557 12:48329687-48329709 GGGACGCGCGAGGCAAGAGGAGG + Exonic
1096512897 12:52141573-52141595 GGGAATGGAGGGGCAGGAGGAGG - Intergenic
1096524228 12:52201053-52201075 AGGAAGCGGGAGGCTGGAGTTGG - Intergenic
1096524498 12:52202526-52202548 AGGAAGCGGGAGGCTGGAGTTGG - Intergenic
1096608497 12:52785118-52785140 GAGAAGACGGTGGCAGGAGAAGG - Intergenic
1096615910 12:52833610-52833632 GAGACGTGGGTGGCTGGAGGCGG - Intronic
1096755493 12:53796154-53796176 GGGCGGGGGGTGGCAGGAGAAGG - Intergenic
1096822716 12:54249661-54249683 TGGAAGCTGGGGGCGGGAGGAGG + Intronic
1096826860 12:54285875-54285897 GGGAGGTGGGTGGGAGGTGGTGG + Intronic
1096983666 12:55743229-55743251 GGGAGGAGGGAGGGAGGAGGAGG - Intergenic
1097194213 12:57234976-57234998 GGGAGGGGAGTGGCAGGGGGAGG + Exonic
1097332778 12:58350486-58350508 GGGGAGTGGGTGGCAGGTAGGGG - Intergenic
1097959696 12:65520489-65520511 GGGAAGCTGGTGGAAGGGGATGG - Intergenic
1098005533 12:65993266-65993288 GGGGAGGGAGTGGGAGGAGGGGG - Intergenic
1098141188 12:67451582-67451604 TGGAGGTGGGTGGGAGGAGGAGG - Intergenic
1098247184 12:68532137-68532159 GGGGAGAGGGAGGCAGGAGATGG + Intergenic
1098370071 12:69749344-69749366 GGGCAGAGGGTGGGAGGAGATGG - Intronic
1099026780 12:77474226-77474248 GGGAAGGGGGTGGCTGAGGGAGG + Intergenic
1099593074 12:84621167-84621189 GGGAGGCGGGAGGCGGGAGGAGG + Intergenic
1101253507 12:102956717-102956739 GGGGAGGGGGTGGCGGTAGGGGG + Intronic
1101259467 12:103013607-103013629 GGGAAGCGGGTGAGGGGAAGGGG + Intergenic
1101968337 12:109295803-109295825 AGGAAGCGGGTGGAAGGAGTTGG - Intronic
1102078386 12:110078205-110078227 GCGAAGCAGGTGGGAGGAGGGGG + Intergenic
1102157506 12:110742832-110742854 GGGAGCGGGGTGGCAGGGGGGGG - Exonic
1102429938 12:112875343-112875365 GGGCAGGGAGTGGGAGGAGGAGG + Intronic
1102657815 12:114497748-114497770 GGGAAGAGGGTGGGAGGAAGAGG - Intergenic
1102789856 12:115635945-115635967 GGGAAGGGGGAGGGGGGAGGGGG + Intergenic
1102840356 12:116113715-116113737 GGGAAGAGGGAGAGAGGAGGGGG + Intronic
1102890477 12:116554815-116554837 TTGAAGCAGGTGGCAGAAGGAGG + Intergenic
1103017817 12:117509260-117509282 GGGAAGGGGATGGAAGGAGGAGG - Intronic
1103192897 12:119017549-119017571 TGTAAGGGGGTGGCAGGAGTGGG + Intronic
1103825106 12:123731813-123731835 AGGGAGGGGATGGCAGGAGGAGG - Intronic
1104053029 12:125209128-125209150 GGGAAGCGGGAGCCAGCAGGTGG + Intronic
1104679710 12:130740996-130741018 GGGAGGCGGGAGGCAGAAGCAGG + Intergenic
1104841299 12:131827347-131827369 GGGAAGCGGGGGGGGGGGGGGGG + Intergenic
1104861531 12:131926707-131926729 GGCAGGCGGGTGGGAGGTGGAGG + Intergenic
1105209164 13:18247709-18247731 GGGAGGCAGGGGGCAGGAAGGGG + Intergenic
1105285272 13:18998344-18998366 GAGAAGCGGAGGGAAGGAGGAGG - Intergenic
1105617142 13:22029095-22029117 GGGAAGCGGGTGGTACTTGGAGG + Intergenic
1105803987 13:23938970-23938992 GGAAAGCGGGTGGCAAGGTGGGG - Intergenic
1105847761 13:24308116-24308138 GGGGAGCGCGTGGCCGGTGGAGG + Intronic
1106131933 13:26948220-26948242 GGGAAGAGGGTGTCTGGAGAAGG + Intergenic
1106250291 13:27977543-27977565 GGGAAGCCGCAGGAAGGAGGCGG - Intergenic
1106301348 13:28469063-28469085 GGGAAGAGGGGAGGAGGAGGAGG - Intronic
1106512231 13:30421880-30421902 GAGGAGCGGGGGGGAGGAGGAGG + Intergenic
1106602434 13:31199749-31199771 TGGAGGCTGGTGGCTGGAGGGGG + Intergenic
1106686620 13:32067109-32067131 GGTAGGAGGGTGACAGGAGGAGG + Intronic
1107359437 13:39603040-39603062 GAGCAGGGGTTGGCAGGAGGCGG + Exonic
1107359473 13:39603211-39603233 GGGCAGCGGAGGGGAGGAGGCGG - Intronic
1107541275 13:41391431-41391453 GGGGTGTGGGTGGGAGGAGGTGG + Intergenic
1107662222 13:42650440-42650462 GGGAAGGGGAGGGGAGGAGGGGG + Intergenic
1107824069 13:44311927-44311949 GGGCAGCGGGTGGTGGGGGGAGG - Intergenic
1108503401 13:51087885-51087907 GGGAAGATGGTGGCTGAAGGCGG - Intergenic
1108510469 13:51151246-51151268 TGGAAGAGGGTGGCAGGAGAGGG + Intergenic
1108555678 13:51589318-51589340 GGGAAGGGGCTGGGATGAGGGGG + Intronic
1108610409 13:52079653-52079675 GGCAGGCGGGTGGGAGGTGGAGG - Intronic
1109308048 13:60662163-60662185 GGGGTGGGGGTGGCAGGGGGCGG - Intergenic
1110602219 13:77388047-77388069 GGGAAGCAGGTAGCACGATGTGG + Intergenic
1111639373 13:90947681-90947703 GGGAAGCTAGTGGCATGAGGAGG + Intergenic
1111666754 13:91279077-91279099 GGGAAGTGGTTAACAGGAGGTGG + Intergenic
1111950941 13:94708427-94708449 GGGGAGGGGGCGGGAGGAGGCGG + Intergenic
1111965702 13:94859365-94859387 AGGAAGCCGCTGGCAGGAAGGGG + Intergenic
1111994436 13:95150481-95150503 GGGAAGGGGGAGGGAGGGGGAGG - Intronic
1112293210 13:98163317-98163339 TGGAGAAGGGTGGCAGGAGGGGG + Intronic
1112802813 13:103131552-103131574 GGGATGGGGGTGGCGGGGGGAGG - Intergenic
1112963773 13:105161611-105161633 GAGAAGCCTGTGGAAGGAGGAGG + Intergenic
1113358581 13:109607173-109607195 GGGTAGAGGGTGGGAGGAGGAGG - Intergenic
1113420089 13:110164553-110164575 CTGGAGCGGGAGGCAGGAGGGGG + Intronic
1113707921 13:112446115-112446137 GGGAAGCTGCTGCCTGGAGGGGG - Intergenic
1113709076 13:112452378-112452400 GAGAAGAGGGTGGGAGGATGTGG + Intergenic
1113728856 13:112625407-112625429 GGGAGGCCGGGGGCAGGAGAGGG - Intergenic
1113794803 13:113050771-113050793 GGGAGGGGGGCGGCAGGGGGCGG + Intronic
1113814467 13:113161737-113161759 GGGCAGGGGGTGGCAGGAATGGG - Intronic
1113909919 13:113836841-113836863 GGGGAGTGGGGGGGAGGAGGAGG + Intronic
1113954366 13:114089293-114089315 GGGAGGAGGGGGGGAGGAGGGGG + Intronic
1114178368 14:20343748-20343770 GGGAAGGGGGTCACAGTAGGTGG - Intronic
1114216855 14:20663636-20663658 GGGACAGGGGTTGCAGGAGGAGG + Intergenic
1114418273 14:22558513-22558535 TGGAAGCCGGAAGCAGGAGGTGG - Intronic
1114519157 14:23321889-23321911 GGCGAGCGGGTGGCAGGCGGGGG + Intronic
1114523366 14:23352460-23352482 GGGCAGGGGGTGGCAGGAGAAGG + Intronic
1114623540 14:24114040-24114062 GGGCAGGAGGGGGCAGGAGGCGG + Intronic
1114626837 14:24135935-24135957 GGGCGGCAGGTGGCGGGAGGCGG + Intergenic
1114674051 14:24429584-24429606 GGTAGGCGGGAGGCGGGAGGCGG - Intronic
1115016041 14:28615681-28615703 GGGTGGAGGGTGGGAGGAGGAGG - Intergenic
1115190029 14:30738095-30738117 GGGAAGGGGGCGGGAGGAGGAGG + Intergenic
1115520970 14:34232748-34232770 GGGAGGGGGATGGCAGGATGGGG + Intronic
1115653855 14:35424102-35424124 GGGCAGAGGGTGGCGGGGGGCGG - Intergenic
1116192156 14:41675245-41675267 GGCAGGCGGGTGGGAGGTGGAGG + Intronic
1116870060 14:50061925-50061947 GGGCTGCTGGTGGCAGGATGTGG - Intergenic
1117722042 14:58637899-58637921 GGGAGGCGGGCGCCAGGCGGGGG + Intronic
1118921945 14:70157383-70157405 GGGAAGAGGGTGGGAGAAGGGGG + Intronic
1119702225 14:76762831-76762853 GGGAAGAAGGTGGCTGGGGGTGG + Exonic
1120406697 14:84100058-84100080 GGCAAGCGGCTGGGAGGTGGAGG + Intergenic
1120526709 14:85584919-85584941 GGGAGGTGGGTGGCAGGGCGGGG + Intronic
1120881366 14:89417250-89417272 GGGAAGCGCGGGGAGGGAGGAGG + Intronic
1120962853 14:90141023-90141045 GGGGATGGGGTGGCAGGTGGCGG - Intronic
1121305893 14:92906745-92906767 GGGAAGGAGGTGGTAGGAGGTGG - Intergenic
1121531482 14:94657777-94657799 GGCAGGCGGGTGGGAGGTGGAGG - Intergenic
1122056466 14:99101662-99101684 GGGTTGCGGGGGGCAGGAGGGGG - Intergenic
1122076107 14:99235706-99235728 GGACAGCGGGGGGAAGGAGGTGG + Intronic
1122078749 14:99252678-99252700 AGGCAGCAGGTGACAGGAGGTGG - Intronic
1122262619 14:100531835-100531857 GGGAAGGAGGCTGCAGGAGGGGG - Intergenic
1122324817 14:100875723-100875745 GGGAAGCGGGGGTGAGGAAGGGG - Intergenic
1122519570 14:102333974-102333996 GGGATGTGGGTGGCAGGGGAGGG - Intronic
1122687179 14:103514903-103514925 GGGAAGAGGGATGCAGAAGGAGG + Intergenic
1122701002 14:103589131-103589153 GGGAAGGCAGGGGCAGGAGGTGG - Intronic
1122774936 14:104112947-104112969 GGGCAGAGGGTGTCTGGAGGAGG - Exonic
1122786574 14:104166911-104166933 GTGCCGCGGGTGGCTGGAGGCGG - Exonic
1122793996 14:104196627-104196649 GGGAAGGAGGGTGCAGGAGGCGG + Intergenic
1122838605 14:104443509-104443531 GGGAAGCCTGAGGCAGGGGGAGG - Intergenic
1122878039 14:104677829-104677851 GGGGAGGAGGTGGAAGGAGGTGG - Intergenic
1122880723 14:104689493-104689515 GGGAGGTGGGTGGCTGGGGGTGG - Intergenic
1123037567 14:105477722-105477744 GGGAAGCGGGTGTGTGGAGGCGG + Intronic
1123808357 15:23897821-23897843 GGGAAGCGGTGCGCAGGAAGGGG + Intergenic
1124179593 15:27460288-27460310 GGGACACGGGTGGCATGAAGAGG - Intronic
1124196181 15:27631873-27631895 AGGAAGCGGGTGGTGGAAGGAGG - Intergenic
1124493699 15:30173700-30173722 GGGAGGCCGGAGGCAGAAGGAGG + Intergenic
1124501503 15:30231462-30231484 GGGAAGTGGGGGGCAAGGGGAGG - Intergenic
1124742063 15:32307205-32307227 GGGAAGTGGGGGGCAAGGGGAGG + Intergenic
1124749868 15:32364949-32364971 GGGAGGCCGGAGGCAGAAGGAGG - Intergenic
1125610144 15:40964157-40964179 AGGCAGAGGGTGGCAGGAGAAGG + Intergenic
1125861446 15:43004732-43004754 GGCAGGCGGCTGGGAGGAGGGGG - Intronic
1126142722 15:45450944-45450966 GGGTAGAGGGTGGCAGTGGGAGG + Intergenic
1126315451 15:47364748-47364770 GGGAGGAGGGTGGCAGTAGGGGG - Intronic
1127324723 15:57883950-57883972 GGGGAGTGGGAGGCAGGAGGCGG - Intergenic
1127606557 15:60592633-60592655 GGGAGGCGGGAGGCGGGAGGCGG + Intronic
1127846963 15:62878413-62878435 GGGCAGCAGTTGCCAGGAGGAGG + Intergenic
1128091168 15:64919895-64919917 GGGAATTTGGAGGCAGGAGGCGG - Intronic
1128756661 15:70187924-70187946 GGCGAGAGTGTGGCAGGAGGAGG - Intergenic
1128784772 15:70386726-70386748 GGGGAGGGGGTGCCAGGAAGGGG + Intergenic
1129263548 15:74382160-74382182 GGGAAGTGGAGGGCAGGTGGGGG + Intergenic
1129313668 15:74728625-74728647 GGCAGGCGGGTGGGAGGTGGAGG - Intergenic
1129473331 15:75767008-75767030 GGGAAGGGGTTGGGGGGAGGGGG + Intergenic
1129636692 15:77326163-77326185 GGGAAGGGAGTAGCAGGAGGGGG - Intronic
1129674237 15:77623670-77623692 GGGAAAGGGGAGGCAGGTGGGGG - Intronic
1129678180 15:77643556-77643578 GGGAAGGGGGTGGCAGGCCAAGG - Intronic
1129684581 15:77677814-77677836 GGGAGGAGGGTGGAGGGAGGAGG - Intronic
1129686249 15:77687689-77687711 GGGCAGTGGGTGGCAGTGGGTGG - Intronic
1129826337 15:78637456-78637478 GGGAAGCAGGTGGGAGGATCAGG + Intronic
1129940802 15:79495255-79495277 GGGAAGTGGGAAGCAGGGGGAGG + Intergenic
1130179739 15:81612941-81612963 GGGAAGCTGTCAGCAGGAGGAGG - Intergenic
1130224278 15:82045779-82045801 GGGAAGCGGGTGGTCAGGGGCGG + Exonic
1130250729 15:82298821-82298843 GCCAAGCAGGTGGCAGGCGGGGG - Intergenic
1130680948 15:85996237-85996259 GGGAATTGGGTGCCAGGGGGAGG - Intergenic
1130910360 15:88266401-88266423 GGGGAGCAGGTGGCGGGGGGCGG + Intergenic
1131155057 15:90069828-90069850 GGGAGGCTGGTGGCTGAAGGCGG - Intronic
1131233045 15:90673497-90673519 GAGAGACAGGTGGCAGGAGGGGG + Intergenic
1131524151 15:93139357-93139379 GGGAAGGGCTTGGCAGCAGGTGG + Intergenic
1131829627 15:96345777-96345799 GGGCCGCGGGCAGCAGGAGGAGG + Intergenic
1131981925 15:98002964-98002986 GGGAAGCAAATGGCAGGAAGGGG + Intergenic
1132364996 15:101251092-101251114 GGGATGCCGGACGCAGGAGGCGG + Intronic
1132415823 15:101618222-101618244 GGGTCGGGGGTGGAAGGAGGTGG - Intergenic
1132540128 16:504652-504674 GGTAAGGGGGGTGCAGGAGGAGG - Intronic
1132847929 16:2009311-2009333 GCCGAGCGGGTTGCAGGAGGGGG - Intronic
1133020144 16:2963558-2963580 GGGAAGGGCGGGGCAGGGGGAGG + Intergenic
1133021719 16:2969846-2969868 GGGAAGCGCGTTGCGGGACGCGG - Intronic
1133023935 16:2979687-2979709 GGGACGGGGGAGGCAGGAGCAGG + Exonic
1133212828 16:4272626-4272648 AGGAAGGGGGTGGGGGGAGGAGG + Intronic
1133392802 16:5422940-5422962 GGGAAGGGGGAGGAAAGAGGAGG + Intergenic
1133460708 16:5984081-5984103 GGGGAGTGGGAGGGAGGAGGAGG - Intergenic
1133520229 16:6549384-6549406 GGGACGAGGGAGGGAGGAGGAGG + Intronic
1133551061 16:6855034-6855056 GGGAGGTGGGTGGGAGGAGTAGG + Intronic
1134014173 16:10877262-10877284 GGGAAGCTGAGGGCACGAGGAGG + Exonic
1134205366 16:12233144-12233166 GGGAGGAGGGAGGAAGGAGGAGG - Intronic
1134301291 16:12993851-12993873 GGGAAGGGGGTTCCAGGTGGAGG + Intronic
1134479481 16:14605730-14605752 GGGAAGTGGGTGGCTAGTGGTGG - Intronic
1134892539 16:17853850-17853872 GGGAAGTGGGGGTCTGGAGGGGG - Intergenic
1135047604 16:19168189-19168211 GGGAAGGGGGTGGGAGGGGGCGG - Intronic
1135415622 16:22266346-22266368 GGGAAGCGAGGGGCTGGGGGTGG - Intronic
1135417531 16:22280136-22280158 GGCAACAGGGTGGCAGGAGGAGG - Intronic
1135607219 16:23835650-23835672 GGGGAGCGGGTGGAAGGGGTGGG - Intergenic
1136114157 16:28084059-28084081 GAGACCCGGGTGGCTGGAGGCGG + Intergenic
1136139839 16:28281520-28281542 TGGAATCGGGTGGGAGGAAGAGG + Intergenic
1136173808 16:28504061-28504083 GGGAAGAGGGTGGCAAGACAGGG + Intronic
1136392619 16:29974793-29974815 GGGAAGGGGGTGGCAACAGAAGG - Intronic
1136406804 16:30053033-30053055 GGGAAGAGGGAGGCGCGAGGCGG + Intergenic
1136424764 16:30162295-30162317 GGGGAGACTGTGGCAGGAGGAGG + Intergenic
1136656524 16:31712503-31712525 GAGAAGCGGGTGTGTGGAGGTGG + Intergenic
1136729291 16:32393124-32393146 GGGTGGAGGGTGGAAGGAGGGGG - Intergenic
1136909987 16:34136758-34136780 GGGAAGGGGCTGTCAGAAGGGGG + Intergenic
1137068944 16:35881848-35881870 GGGAAGGGGTTGACAAGAGGAGG - Intergenic
1137439154 16:48483489-48483511 GGCAAGCGGCTGGGAGGTGGAGG + Intergenic
1137553440 16:49455706-49455728 GGGGAGAGGGAGGCAGGAAGAGG + Intergenic
1137617277 16:49855539-49855561 AGGAAGCCGGGAGCAGGAGGCGG - Intronic
1137767831 16:50991507-50991529 GGGAAGAGGGGGGCAGGAGAGGG + Intergenic
1137783073 16:51114089-51114111 AGGAAGGGGGCCGCAGGAGGGGG + Intergenic
1138171943 16:54859588-54859610 GGAAGGGGGGTGGCAGGTGGAGG + Intergenic
1138354523 16:56366822-56366844 GGGCAGGGGGTGGGGGGAGGTGG + Intronic
1138927716 16:61612197-61612219 GGGAAGGGGAAGGCAGGATGGGG + Intergenic
1139340201 16:66263474-66263496 GGGTGGGGGGTGGCAGCAGGAGG - Intergenic
1139503671 16:67388342-67388364 GGGAATCGGCAGGCAGCAGGTGG - Intergenic
1139534586 16:67563262-67563284 GGGACGGGGCTGGCTGGAGGAGG - Intronic
1139601006 16:67987205-67987227 GTGGATCCGGTGGCAGGAGGTGG - Intergenic
1139824016 16:69742755-69742777 GGGAATCAGGTGGGAGGCGGCGG - Intronic
1139834113 16:69824515-69824537 GGGAAGGGGGAGGGAGGGGGAGG - Intronic
1139959060 16:70707340-70707362 GGGAGTGGGGTGGGAGGAGGAGG + Intronic
1140133388 16:72183767-72183789 GAGAAGACGGTGGCTGGAGGAGG - Intergenic
1140452793 16:75084670-75084692 GGGCAGCGGGTGACAGCTGGGGG - Intronic
1140457282 16:75112752-75112774 GGGCAGCAGGAGGCAAGAGGAGG - Intronic
1140782571 16:78310047-78310069 GGGAAGGAGGGGGAAGGAGGAGG - Intronic
1140892837 16:79299482-79299504 GACAAGCGGGTGGCCGGAGAAGG + Intergenic
1141150501 16:81561544-81561566 GGGAAGAGGGTGGCAGGGGCTGG + Intronic
1141510661 16:84509814-84509836 GGGAAGCAGGTGGGGGCAGGAGG + Intronic
1141530513 16:84643405-84643427 GGGAGGAGGCTGGGAGGAGGAGG - Intergenic
1141571588 16:84937283-84937305 GGGAGGAGGGCGGGAGGAGGTGG - Intergenic
1141577046 16:84970780-84970802 GGGAAGTGGGTGCCAGGTGAGGG - Intergenic
1141585097 16:85028197-85028219 GGGCAGATGGTGGCAGCAGGTGG + Intronic
1141594135 16:85087177-85087199 GGGAGGCTGCTGGCAGGAGGCGG + Intronic
1141624054 16:85252217-85252239 GGGAATCTGGCGGCAGGAGGGGG + Intergenic
1141624070 16:85252286-85252308 GGGAATCTGGTGGCAGGAGGGGG + Intergenic
1141665305 16:85462707-85462729 GGGAGGCGGGAGGCGGGAGGCGG + Intergenic
1141693011 16:85607068-85607090 GGGGGGCGGGAGGGAGGAGGGGG + Intergenic
1141749196 16:85946918-85946940 CGGAAGGGGGAGGCAGGAGCAGG - Intergenic
1141838643 16:86559897-86559919 GGTAAGCGGATGGCTGGGGGAGG + Intergenic
1142008216 16:87700492-87700514 GGGCAGAGGGTGGAGGGAGGAGG + Intronic
1142008225 16:87700517-87700539 GGAAAGAGGGTGGAGGGAGGAGG + Intronic
1142008234 16:87700558-87700580 GGGAAGAGGGTAGAAGGAAGAGG + Intronic
1142109644 16:88324340-88324362 GGGAGGTGGGTGGAAGGATGTGG + Intergenic
1142240182 16:88941386-88941408 CGGCGGCGGGGGGCAGGAGGCGG - Intronic
1142251447 16:88993773-88993795 GGGAAGAGGGAGGAGGGAGGAGG - Intergenic
1142290960 16:89193385-89193407 GCGAAGGAGGTGGGAGGAGGGGG - Intronic
1142409265 16:89907909-89907931 GGGAGGAGGGAGGCAGGAGCTGG - Intronic
1142409343 16:89908141-89908163 GGGAGGAGGGAGGCAGGAGGTGG - Intronic
1142409522 16:89908707-89908729 GGGAGGCGGGAGCCGGGAGGTGG - Intronic
1202997105 16_KI270728v1_random:124397-124419 GGGTGGAGGGTGGAAGGAGGGGG + Intergenic
1203023792 16_KI270728v1_random:436739-436761 GGGTGGAGGGTGGAAGGAGGGGG + Intergenic
1142486013 17:248124-248146 GGAGAGCTGGGGGCAGGAGGAGG - Intronic
1142562935 17:821826-821848 GGGAAGGGGGAGGAAGGGGGAGG - Intronic
1142788318 17:2243058-2243080 GGGAGGTGGGAGGCAGGAGATGG + Intronic
1142806163 17:2372313-2372335 GGGCAGCGGTGGGCAGCAGGAGG - Intronic
1142994212 17:3751344-3751366 GGCAGGTGGGTGGAAGGAGGGGG + Intronic
1143083332 17:4397360-4397382 GGGCAGGGGGCGGGAGGAGGTGG + Intergenic
1143187414 17:5018959-5018981 GGGATGCGGGTGCCTAGAGGGGG - Intronic
1143254259 17:5544096-5544118 GGGAGGGAGGTGGCAGGAGATGG - Intronic
1143286541 17:5794069-5794091 GGGATGCTGGAGGCAGGAGAAGG + Intronic
1143374747 17:6460859-6460881 TCTAAGAGGGTGGCAGGAGGAGG + Intronic
1143607037 17:7993034-7993056 GGCAAGCTGGTGGCAAGGGGTGG + Intergenic
1143747654 17:9005458-9005480 GGGCAGCGGTGGGGAGGAGGAGG - Intergenic
1143760845 17:9102977-9102999 GTGGAGGAGGTGGCAGGAGGTGG + Intronic
1144167251 17:12624923-12624945 GGGAAGGGGACGGGAGGAGGGGG + Intergenic
1144206664 17:12984410-12984432 GGGTGGCGAGGGGCAGGAGGTGG + Intronic
1144212155 17:13024668-13024690 GGGAAGGCGGAGCCAGGAGGAGG + Intergenic
1144461585 17:15463008-15463030 GAGATGGGGGTGGGAGGAGGTGG + Intronic
1144623684 17:16833725-16833747 GAGGAGCAGGTGGCTGGAGGGGG - Intergenic
1144740401 17:17579083-17579105 GGGAAGCGGTGGGGAGGAGATGG + Intronic
1144764086 17:17723630-17723652 GGGAAGGGAGCGGGAGGAGGGGG - Intronic
1144805626 17:17965078-17965100 GGGAAGGTGGGGGAAGGAGGGGG - Intronic
1144882746 17:18438991-18439013 GAGGAGCAGGTGGCTGGAGGGGG + Intergenic
1145149487 17:20505395-20505417 GAGGAGCAGGTGGCTGGAGGGGG - Intergenic
1145241107 17:21241528-21241550 GAGATGCAGCTGGCAGGAGGTGG - Exonic
1146183137 17:30709691-30709713 GGGAAGCTGGTAGGAGGTGGCGG - Intergenic
1146258385 17:31404978-31405000 GGCAGGCTGGAGGCAGGAGGTGG + Intronic
1146376535 17:32298399-32298421 GGGAGGTGTGTGGCAGGACGGGG + Intronic
1146546941 17:33748208-33748230 GGGAAGCAGGCACCAGGAGGCGG - Intronic
1146789507 17:35743400-35743422 TGGGAGCGGGTGGAAGGAGAAGG - Exonic
1146910492 17:36645531-36645553 GGGAGGAGGGAGGGAGGAGGAGG - Intergenic
1146934614 17:36805054-36805076 GCTAAGAAGGTGGCAGGAGGAGG - Intergenic
1146955814 17:36935933-36935955 GGGAAGAGGGAAGGAGGAGGGGG - Intergenic
1146957141 17:36942416-36942438 TGGAAGCGGGTGGCAGCGCGGGG + Intronic
1147141790 17:38464573-38464595 GGGGAGAGGGAGGAAGGAGGGGG + Intronic
1147161848 17:38573030-38573052 GGGACTCGGGTTGCAGCAGGAGG + Intronic
1147183695 17:38702510-38702532 GGGAAGCGGGAAGCAGGAGCGGG + Intergenic
1147258768 17:39196978-39197000 GGGGCGGGGGTGGCACGAGGAGG - Intronic
1147324388 17:39663347-39663369 GGGGAGTGGGTGGCAGGTGGGGG + Exonic
1147453373 17:40519799-40519821 GGGATGCAGGGGGCAGGTGGGGG - Intergenic
1147833747 17:43315386-43315408 GGGAAGGGGGTGGGGGGCGGCGG + Intergenic
1147906345 17:43825577-43825599 GGGTATGGGGTGGCAGCAGGAGG - Intronic
1147949079 17:44097045-44097067 GGGAGGTGGGAGGTAGGAGGTGG + Intronic
1147986093 17:44308568-44308590 GGGGGGCGGGCGGCTGGAGGAGG + Exonic
1148047912 17:44755139-44755161 TGGAACCCGGTGGGAGGAGGAGG + Intergenic
1148050491 17:44767752-44767774 GCTCAGCAGGTGGCAGGAGGTGG + Intronic
1148081155 17:44968261-44968283 GGGAGGCGCGAGGCAGGAGCCGG - Intergenic
1148081167 17:44968318-44968340 GGGAGGCGGGAGGCGGGAGGCGG - Intergenic
1148157610 17:45432638-45432660 GGGAAGGGTGCGGCAGGTGGCGG - Intronic
1148190078 17:45672220-45672242 AGGAAGTGGGAGGCAAGAGGAGG + Intergenic
1148194268 17:45701915-45701937 GGGCAGAGTGTGGAAGGAGGAGG + Intergenic
1148356624 17:46979449-46979471 GGACAGCGGGTGCCAGGAGGGGG - Intronic
1149314008 17:55421923-55421945 GGGAGGCGGGAGGCGGGAGGCGG - Exonic
1149868057 17:60161560-60161582 GGGGAGCTGGTGGGAGAAGGTGG + Intronic
1150154789 17:62843792-62843814 GGGTGGAGGGTGGGAGGAGGGGG + Intergenic
1150389292 17:64781329-64781351 GGGAAGGGTGCGGCAGGTGGCGG - Intergenic
1150501441 17:65654500-65654522 GGCAAGCGGGTGGCTGGTGCAGG + Intronic
1150571532 17:66391154-66391176 GAGCAGCGGGTGGGAGGAGAAGG + Intronic
1150747159 17:67825580-67825602 CGGAAGCGGGTGGAGGGAGAAGG - Intronic
1150919278 17:69466328-69466350 AGGAAGGGGGTGGAAAGAGGAGG - Intronic
1151425803 17:74030422-74030444 GGGATGATGGAGGCAGGAGGGGG - Intergenic
1151560458 17:74866883-74866905 GGGAACAGGGTGGCAGCTGGTGG + Exonic
1151677142 17:75604460-75604482 GGGAGGGGCGTGGCAGGAAGGGG - Intergenic
1151757191 17:76081732-76081754 GAGCAGTGGGTTGCAGGAGGAGG - Exonic
1152029782 17:77834880-77834902 GGCAAGAGGGTGGGAGGAGCTGG - Intergenic
1152077085 17:78166513-78166535 GGGAAGAGGGGAGCAGGTGGGGG - Intergenic
1152097066 17:78278505-78278527 GGGCAGTGGGAGGGAGGAGGCGG + Intergenic
1152109772 17:78351604-78351626 TGGAAGCTGGTGCCGGGAGGGGG - Intergenic
1152261319 17:79268792-79268814 GGAAAGAGGGTGGCAGGCAGCGG - Intronic
1152336001 17:79700544-79700566 GGGGAGCGGGGGACAGGATGAGG + Intergenic
1152360139 17:79829135-79829157 GGGAAGAGAGGAGCAGGAGGAGG + Intergenic
1152366375 17:79859027-79859049 AGGAGGCGGGTGCCAGGAGAAGG - Intergenic
1152368222 17:79869646-79869668 GGGAAAAGGATGGCAGGGGGTGG - Intergenic
1152400821 17:80065201-80065223 AGGAAGGGGGAGGGAGGAGGGGG - Intronic
1152472859 17:80500041-80500063 GGGCAGGAGGGGGCAGGAGGGGG - Intergenic
1152520463 17:80853059-80853081 GGGAGGCGAGTGGAAGGGGGTGG - Intronic
1152597013 17:81242651-81242673 GGGAGGCGGGGGGGAGGGGGAGG + Intergenic
1152618007 17:81346535-81346557 GGGAGGGAGGTGGGAGGAGGTGG + Intergenic
1152645282 17:81465794-81465816 TGGGAGCGGGGGGCTGGAGGCGG - Exonic
1152677407 17:81648592-81648614 GGGAGGGAGGTGCCAGGAGGTGG - Exonic
1152697858 17:81805437-81805459 AGGAAGGGGGTGGCATGCGGTGG + Intronic
1152757247 17:82092156-82092178 GGGAAGAGCGAGGCAGGAGCAGG - Intronic
1152811849 17:82386111-82386133 GGGAAGGCGGAGGCAGGATGGGG - Intergenic
1152913128 17:83016774-83016796 GGGAGGAGGGAGGAAGGAGGAGG + Intronic
1152964126 18:98699-98721 GGGAGGCACTTGGCAGGAGGAGG - Intergenic
1153488870 18:5628918-5628940 GGGAAGCGCGGCGCGGGAGGTGG - Intronic
1154473744 18:14730977-14730999 GGGGAAAGGGTGGAAGGAGGGGG - Intronic
1155392697 18:25352210-25352232 GGGGAGCGGGAGGGAGGAGGGGG + Intergenic
1156076732 18:33288223-33288245 GGGGAGCGGAGGGGAGGAGGAGG - Intronic
1156191471 18:34726096-34726118 GGGGAGTGGGGGGCTGGAGGAGG + Intronic
1156561141 18:38127040-38127062 GGGAAGTGGGGAGGAGGAGGAGG - Intergenic
1157097749 18:44701578-44701600 GAGAAATGGGTGGCAGGAGATGG + Exonic
1157231457 18:45920324-45920346 GGGCTGCAGGTGGCAGGAGATGG + Intronic
1157484212 18:48075574-48075596 GGGAGTGGGGAGGCAGGAGGAGG - Intronic
1157558818 18:48632028-48632050 GGCAAACGGGAGGCAGGAGGTGG + Intronic
1157574637 18:48735496-48735518 AGGAAGCACGTGGCAGGTGGAGG + Intronic
1157603319 18:48909118-48909140 CGGGAGGGGGTGGGAGGAGGAGG - Intergenic
1157610463 18:48952069-48952091 GGGAAGGGGGAGGAAGGGGGAGG - Intergenic
1157619329 18:49007055-49007077 GAGGAGTGGGTGGAAGGAGGGGG - Intergenic
1157739134 18:50076424-50076446 AGGAAAGGCGTGGCAGGAGGAGG + Intronic
1158094870 18:53758976-53758998 TGGAAGAGGCTGGAAGGAGGTGG - Intergenic
1158274892 18:55756651-55756673 GGGGTGGGGGTGGCAGGGGGTGG - Intergenic
1158283255 18:55850902-55850924 GGGAAGCTGGCGGCAGGGTGCGG + Intergenic
1158647950 18:59264427-59264449 AGGAAGCTGGGGGCAGGGGGCGG - Intergenic
1159497327 18:69222915-69222937 GGGAAGCTGGTGGCACTAGGTGG + Intergenic
1160014106 18:75127671-75127693 GAGAGGCTGGTGCCAGGAGGTGG - Intergenic
1160074380 18:75658399-75658421 TGGAAGCGGTGGGGAGGAGGGGG + Intergenic
1160148970 18:76385041-76385063 CGGAAGCACGTGCCAGGAGGAGG + Intronic
1160196381 18:76758894-76758916 AGGAAGTGGGTGGGAGAAGGAGG + Intergenic
1160662330 19:306854-306876 GGGGAGCTGGTGGCTGGAGCAGG + Intronic
1160671239 19:364742-364764 GAGAAGGGGGTACCAGGAGGAGG - Intronic
1160680561 19:410091-410113 ACGAAGCAGCTGGCAGGAGGGGG - Intergenic
1160754250 19:749409-749431 GTGAAGGGGGTGGCGGGAGGCGG + Intergenic
1160786699 19:903433-903455 GGGAAGCGGGTGGTTGGACAGGG + Intronic
1160844189 19:1159437-1159459 GGGACGGGGGTAGCAAGAGGGGG + Intronic
1160887032 19:1354915-1354937 GGGCAGCGGGCGGAAGGGGGCGG + Intronic
1161055965 19:2190755-2190777 GAGAGGCCCGTGGCAGGAGGTGG + Intronic
1161153227 19:2720422-2720444 GGGGTGCGGGTGGAGGGAGGGGG + Intronic
1161262518 19:3345644-3345666 GGGAGCCGGGCGGCGGGAGGGGG - Intergenic
1161373074 19:3924415-3924437 AGAAAGTGGGTGGCAGGAGCCGG + Intronic
1161403942 19:4081617-4081639 AGGAGGCGGGAGGGAGGAGGAGG - Intergenic
1161619709 19:5291668-5291690 GGGAAGGGTGTGCCAGGTGGGGG - Intronic
1161657730 19:5526138-5526160 GGGAAGGGTGTGGCAGGCAGAGG + Intergenic
1161684831 19:5697555-5697577 GGGAAGGGGGTAGAGGGAGGGGG + Intronic
1161837041 19:6654815-6654837 GAGGAGGAGGTGGCAGGAGGAGG - Intergenic
1161972446 19:7590314-7590336 AGGAGGCGGGAGGCTGGAGGGGG + Intergenic
1162145713 19:8611210-8611232 GGGAAGTGGGGGCCTGGAGGAGG + Intergenic
1162181157 19:8869849-8869871 GGGTGGCGGGTGGCGGGTGGAGG + Intronic
1162318989 19:9959816-9959838 GGGAGGTGGGGGGCAGGGGGAGG + Exonic
1162342808 19:10102171-10102193 GAGAAGGGGGAAGCAGGAGGAGG + Intronic
1162403922 19:10462218-10462240 GGGAGGCGGGAGGCGGGAGGCGG - Intronic
1162403925 19:10462225-10462247 GGGAGGCGGGAGGCGGGAGGCGG - Intronic
1162467149 19:10849111-10849133 GTGAGGTGGGTGGCAGGAAGGGG - Intronic
1162539318 19:11284680-11284702 GGGAAGGGGGTGGGGGCAGGGGG - Intergenic
1162561289 19:11419332-11419354 GGGTGGCGGGTGGCGGGCGGCGG + Intronic
1162770952 19:12949024-12949046 TGGAGGAGGGTGGCAGCAGGAGG + Intronic
1162893002 19:13747668-13747690 GGGAGGGCGGTGCCAGGAGGCGG + Intronic
1162975658 19:14206083-14206105 GGGAAGCGGGTAGGAGGTGGCGG + Exonic
1162983010 19:14250879-14250901 GGGAAGGGTGTTGCAGGAAGTGG - Intergenic
1163031170 19:14545259-14545281 GGGAAGCGGGTGACACCCGGAGG - Intronic
1163061263 19:14763894-14763916 GGAAAGAGGATGGGAGGAGGAGG - Intronic
1163387951 19:17011694-17011716 GGGCCGCGGCTGGCAGGCGGAGG - Exonic
1163419546 19:17206389-17206411 GCGGTGCGGGTGGCAGCAGGTGG + Intronic
1163518552 19:17779054-17779076 CGGTAGCGGGTGCCAGGTGGGGG + Intronic
1163724650 19:18915689-18915711 GGAAGGCGGGTGACAGGATGGGG + Intronic
1164527497 19:29022720-29022742 AGGAAGCTGGCGGCAGGGGGAGG + Intergenic
1164541659 19:29125998-29126020 AGGAAGAGGGTGGCAAGAAGAGG + Intergenic
1164572615 19:29385272-29385294 AGAGAGGGGGTGGCAGGAGGTGG + Intergenic
1164630792 19:29760287-29760309 GGGCAGCAGGAGGCAGGCGGCGG + Intergenic
1164731029 19:30504515-30504537 GGTCAGAGGGGGGCAGGAGGAGG - Intronic
1164828894 19:31305173-31305195 GTGGAGGGGGTGGCAGGAGAGGG - Intronic
1164914303 19:32038078-32038100 GGCAGGAGGGGGGCAGGAGGAGG + Intergenic
1165060492 19:33202782-33202804 GGGATGCGGGTTGCAGTGGGGGG - Intronic
1165085802 19:33346151-33346173 GAGAAGCAGGGGGCAGGGGGTGG + Intergenic
1165108320 19:33487284-33487306 GGGAAGCGGCTGGGAGCAGCTGG + Intronic
1165144770 19:33724233-33724255 GGGCAGGGTGTGTCAGGAGGGGG - Intronic
1165329223 19:35132050-35132072 GGGAAGCTGGGGTCAGGGGGAGG + Intronic
1165333181 19:35152691-35152713 GGGAGGAGGATGGGAGGAGGAGG + Intronic
1165432784 19:35781938-35781960 GCCAAGAGGGAGGCAGGAGGTGG + Intronic
1165657327 19:37545213-37545235 GGGAAGTGGGTGGCAGGAATGGG + Intronic
1165735703 19:38174101-38174123 AGGAAGAGGGAGCCAGGAGGAGG + Intronic
1165755519 19:38290592-38290614 GGCAGGCTGATGGCAGGAGGAGG - Intronic
1165926025 19:39326747-39326769 GGGGAGCGGGGAGGAGGAGGAGG + Intergenic
1166519434 19:43470552-43470574 GGGAGGCGGGCGGAGGGAGGGGG - Intergenic
1166559279 19:43720966-43720988 GGGTAGGGGGTGGCAGGGAGAGG + Intergenic
1166694405 19:44844644-44844666 GCGAAGCGGGAGGCCGGGGGAGG - Intergenic
1166705420 19:44905644-44905666 GGGCAGAGGGAGGAAGGAGGTGG - Intergenic
1166762737 19:45234923-45234945 GGGAAAAGGGTTACAGGAGGCGG + Intronic
1166798951 19:45444270-45444292 GCGAAGCGGCTGGCTGGGGGAGG - Intronic
1166828049 19:45621541-45621563 GGGACGCTGGTGTCTGGAGGGGG - Exonic
1166840070 19:45691963-45691985 CGGAAGTGGGTCGCAGGAAGAGG - Exonic
1166853403 19:45770898-45770920 GCTAAGCGGGTGGCAAGGGGCGG + Intronic
1167196711 19:48034075-48034097 TGGAAGCGGGTGGCAGGTTTTGG - Intronic
1167451216 19:49570711-49570733 GGGGAGCGGATGGCAGGTGAGGG - Intronic
1167598230 19:50438413-50438435 GGGAAGCGGATGGATGGATGGGG + Intronic
1168080210 19:54004648-54004670 GGAGAGCAGGTGGCAGGAGAGGG - Intronic
1168251601 19:55145390-55145412 GGAAAGGGGGAGGGAGGAGGAGG + Intronic
1168252776 19:55149778-55149800 GGGAAGCAGGTGTGGGGAGGGGG + Intergenic
1168345886 19:55650043-55650065 GGGGAGGGGGGGACAGGAGGAGG - Intronic
1168357899 19:55713713-55713735 GGGAAGAGGTGGGGAGGAGGGGG - Intronic
1168357909 19:55713734-55713756 GGGAAGAGGTGGGGAGGAGGGGG - Intronic
1168357919 19:55713755-55713777 GGGAAGAGGTGGGGAGGAGGGGG - Intronic
1168401156 19:56087001-56087023 CAGAAGCTGGAGGCAGGAGGAGG + Intergenic
1168612631 19:57813632-57813654 GGGAAGTGCCTGTCAGGAGGGGG - Intronic
1168694333 19:58396248-58396270 GGGAGGCGGGGGGCAGGATAGGG - Exonic
1168694467 19:58396769-58396791 GGGCCGCGGGGGGCCGGAGGAGG - Exonic
1168705853 19:58469936-58469958 GGGAATCGGGTGGGAGGGAGGGG - Intronic
925153746 2:1634927-1634949 GGGAGACTGGTGGCAGGTGGAGG - Intronic
925538473 2:4941104-4941126 GGGAAACAGGAGGCAGGAGTAGG + Intergenic
925927621 2:8681751-8681773 GGGAGGAGGGAGGCGGGAGGAGG - Intronic
926047128 2:9717919-9717941 TGGAGGTGGGTGGCAGTAGGTGG + Intergenic
926054508 2:9766485-9766507 GGGAACCGAGTGGGAGGTGGGGG - Intergenic
926062521 2:9813303-9813325 GGGGAGCGTGGGGGAGGAGGGGG + Intergenic
926226845 2:10972931-10972953 GGGAAGCGGGGTGGAGGGGGAGG + Intergenic
926393341 2:12416745-12416767 TGGAAGTGGGTGCCAGCAGGGGG + Intergenic
927213201 2:20651130-20651152 GGGCAGCGGGAGGCAGGGCGGGG - Intergenic
927622658 2:24678026-24678048 GGGGCAGGGGTGGCAGGAGGGGG - Intronic
927652363 2:24920246-24920268 GGGAGGCGGGAGGCGGGAGGCGG + Intergenic
927652366 2:24920253-24920275 GGGAGGCGGGAGGCGGGAGGCGG + Intergenic
927752785 2:25684943-25684965 GGGGTGGGGGTGGGAGGAGGAGG - Intergenic
927794125 2:26033767-26033789 GGGGAGCGGGGAGCGGGAGGCGG + Intergenic
927794128 2:26033774-26033796 GGGGAGCGGGAGGCGGGAGGCGG + Intergenic
927837052 2:26407543-26407565 GGGACGGGGGTAGCAGGAAGTGG - Intronic
927843209 2:26458011-26458033 GGGGAGCGGCTGGCGGGAGCTGG + Exonic
928458184 2:31443792-31443814 GGGTGGAGGGTGGGAGGAGGAGG - Intergenic
928826438 2:35427030-35427052 GAGAAGGAGGAGGCAGGAGGAGG + Intergenic
928998613 2:37324442-37324464 GGGGAGCGCGCGGCGGGAGGTGG - Intronic
929070924 2:38029717-38029739 GGGGAGGGTGGGGCAGGAGGTGG + Intronic
929075650 2:38076901-38076923 GGGCGGAGAGTGGCAGGAGGAGG + Intronic
929242349 2:39665857-39665879 GGGAGGTGGGGGGCAGGTGGGGG + Intronic
929444516 2:41991987-41992009 GGGAAGAGGAAGGCAGGAGAGGG + Intergenic
929526370 2:42706982-42707004 GGGAAGCGGGGAGGAGGAGGGGG - Intronic
929585372 2:43110688-43110710 GGGCAGCGGGAGGCAGTTGGAGG + Intergenic
931116307 2:59170451-59170473 AGGAAGAGGGTGTGAGGAGGTGG - Intergenic
931330082 2:61271695-61271717 GGGAAGAAGGGGGAAGGAGGAGG + Intronic
932137709 2:69245333-69245355 GGGCAGTGGGGCGCAGGAGGTGG - Exonic
932404334 2:71503595-71503617 AGGAAGCTGGGGACAGGAGGTGG - Intronic
932434682 2:71695967-71695989 GGGATGCAGGAGGCAGGTGGGGG + Intergenic
932451210 2:71811966-71811988 GGGTGGCGGCAGGCAGGAGGTGG + Intergenic
933037109 2:77413632-77413654 GGGAAGCTGTTGCCAGAAGGAGG + Intronic
933045661 2:77533434-77533456 GGGTGGAGGTTGGCAGGAGGTGG + Intronic
933335591 2:80954596-80954618 GGGAAGCAGGGAGTAGGAGGTGG + Intergenic
933454830 2:82507814-82507836 CTGGAGCGGGTGGCAGGAGCAGG - Intergenic
933611251 2:84438053-84438075 GAGAAGGGGGTGGAAGCAGGAGG + Intronic
933667072 2:84971886-84971908 GGGCCGCGGGCGGCAGCAGGAGG + Intronic
933996536 2:87674178-87674200 GGGAAGCAGGTGCCAGCAGGAGG + Intergenic
934058529 2:88272756-88272778 GAGAAGCAGTTGGGAGGAGGAGG - Intergenic
934163197 2:89271770-89271792 GGGAAGCTAGTGGGAGGAGAAGG + Intergenic
934185591 2:89671035-89671057 GGGTGGAGGGTGGAAGGAGGGGG - Intergenic
934204076 2:89910754-89910776 GGGAAGCTAGTGGGAGGAGAAGG - Intergenic
934503379 2:94875196-94875218 GGGAGGATGGAGGCAGGAGGTGG + Intronic
934535940 2:95133455-95133477 AGGAAGGGGGTGGCAGCAGGAGG + Intronic
934728067 2:96638038-96638060 AGGGAGCGGGAGGCGGGAGGCGG - Intronic
934762072 2:96861901-96861923 GAAAAGCGGGGCGCAGGAGGGGG + Intronic
934846527 2:97664240-97664262 GGGACGCGGGCGGCAGAAAGTGG + Intergenic
935147661 2:100407060-100407082 TGGAAGCAGGTGGCAGGAAGAGG + Intronic
935196600 2:100820072-100820094 GGGAGGAGGGTGGAGGGAGGAGG + Intergenic
935500977 2:103838116-103838138 AGGAAGCCGGTGACAGGAGTAGG + Intergenic
935780116 2:106503232-106503254 GGGAAGGGGCTGGCTCGAGGTGG - Intergenic
936026056 2:109031890-109031912 GGGAAGAAGGTGGCGGGGGGTGG - Intergenic
936297315 2:111276732-111276754 GGGAAGCAGGTGCCAGCAGGAGG - Intergenic
936452610 2:112645354-112645376 GGGAAGCGGGGGGGTGGGGGGGG - Intergenic
936997831 2:118433904-118433926 GGGCAGGGGGTAGCAGGAGGCGG + Intergenic
937046366 2:118854032-118854054 CGGATGCGGGGGGCGGGAGGGGG + Intergenic
937206511 2:120240077-120240099 GGAGAGCGGGTGGCAGGAGGAGG + Intronic
937238085 2:120442583-120442605 GGGCTGGGGGTGGCAGCAGGAGG + Intergenic
937239576 2:120451468-120451490 GGGCAGCGGGCGGCAGGCTGAGG + Intergenic
937268176 2:120630283-120630305 GGGAAGGGGGTGGCAGAGTGGGG + Intergenic
937297843 2:120820472-120820494 AAGAAGCTGGTGGCAGGAGGAGG + Intronic
937423692 2:121779385-121779407 GGGGATGGGGTGGGAGGAGGTGG + Intergenic
937503232 2:122506414-122506436 GGGTGGAGGGTGGGAGGAGGGGG + Intergenic
937993206 2:127675290-127675312 GGGGTGGGGGTGGCAGGTGGGGG + Intronic
938379541 2:130828906-130828928 GGAAGGCTGGTGCCAGGAGGTGG - Intergenic
938658313 2:133458733-133458755 AGGATCTGGGTGGCAGGAGGGGG + Intronic
938836047 2:135105223-135105245 GGGAAGGGGGGAGCGGGAGGGGG - Intronic
940261585 2:151785438-151785460 GGAAAGAAGGAGGCAGGAGGTGG + Intergenic
941438470 2:165502720-165502742 AGGGAGCCGGTGGCAGGTGGGGG - Intronic
941463069 2:165793993-165794015 GGTAAGCCGGCGGCAGGCGGAGG - Exonic
941670975 2:168292063-168292085 GGGAAGAGGGGGGCAAGGGGAGG - Intergenic
941773986 2:169371927-169371949 GGGTGGTGGGGGGCAGGAGGAGG + Intergenic
941933251 2:170963477-170963499 GGGAGGGGGGCGGGAGGAGGAGG - Intronic
942097906 2:172550794-172550816 GGGAAACTTGTGGCAGGAGGGGG - Intergenic
942279016 2:174342519-174342541 GGGAAAGGGGCGGCAGGGGGAGG - Intergenic
942560476 2:177213179-177213201 CGGGAGCGGTTGGGAGGAGGTGG + Intronic
943411611 2:187556253-187556275 GGGAGGCGGCTGGGAGGTGGAGG - Intronic
943422232 2:187680448-187680470 GGGTAGTGGGTGGAAGGAGGGGG + Intergenic
943692425 2:190881662-190881684 GGGAAGTGGGTGCCTGGCGGAGG - Intronic
944060071 2:195563157-195563179 GGGGAGCGGGTGGGGGGTGGCGG - Intergenic
944163352 2:196690227-196690249 GGGAGGCGGGAGGGAGGAGGGGG + Intronic
944384807 2:199152115-199152137 GCGTAGTGGGTGGCAGGAGAGGG + Intergenic
944848186 2:203690162-203690184 TGGGAGCAGGTGGCAGCAGGAGG - Intergenic
945039862 2:205734542-205734564 GGGAAGGGGGTGGGAGAGGGAGG + Intronic
945060556 2:205905095-205905117 GTGAAGAGGCTGGGAGGAGGAGG - Intergenic
945116944 2:206417224-206417246 GGGAACCGGGTGGTTGGATGAGG + Intergenic
945711348 2:213300222-213300244 GGAAAAGGGGTAGCAGGAGGAGG - Intronic
945891649 2:215436375-215436397 GGGAAGCGGCTGGGAGGAAAGGG + Intergenic
945942194 2:215961113-215961135 GAGTAGCGGTTGGCAGGGGGTGG + Intronic
946041975 2:216790541-216790563 GGGAGGTGGGAGGCGGGAGGCGG - Intergenic
946225212 2:218260893-218260915 GGGAACTGGGTGGGAGGGGGAGG + Intronic
946338869 2:219055994-219056016 AGGAAGTGGGGGGCAGGAGCTGG - Intronic
946966502 2:225042538-225042560 GGGAAGGGGGTGGGAAGAGTGGG - Intergenic
947498953 2:230658620-230658642 GGGGGGCTGGTGGCTGGAGGAGG - Intergenic
947511403 2:230757814-230757836 GGGGAGTGGGCGGCAGGGGGTGG - Intronic
947732169 2:232437343-232437365 AAGAAGCAGGTGGCAGGAGATGG + Intergenic
947829382 2:233128037-233128059 AGGAACTGGGTGGCAGCAGGAGG + Intronic
947910216 2:233795796-233795818 AGGAAGCTGGCGGCGGGAGGTGG + Intronic
948140515 2:235669629-235669651 GGGTGGCGGGTGGCGGGCGGCGG - Intronic
948225945 2:236309483-236309505 GGGAAGGCAGGGGCAGGAGGAGG + Intergenic
948403789 2:237702769-237702791 GGCAAGGAGGTGGCAGGGGGAGG + Intronic
948420987 2:237859797-237859819 GGGGAGCGGGTGGGAGCGGGTGG + Intronic
948458544 2:238118395-238118417 TGGAAGAGGGTGGACGGAGGAGG + Intronic
948458597 2:238118599-238118621 TGGAAGAGGGTGGATGGAGGAGG + Intronic
948460107 2:238125122-238125144 GGTAAGGAGGTGGCAGGAGAGGG - Intronic
948571912 2:238923001-238923023 GGGAAGCAGGTGGCAGGAGGAGG - Intergenic
948577656 2:238965021-238965043 GGGAGGCAGGAGGGAGGAGGGGG - Intergenic
948646337 2:239407452-239407474 GGGATGAGTGTGGCAGGAGGAGG - Intergenic
948883485 2:240871804-240871826 GGGATGAGGGAGGCTGGAGGAGG - Intronic
948952871 2:241265853-241265875 GGGAAGCTGGCTCCAGGAGGAGG + Intronic
949009122 2:241668419-241668441 GAGAAGCAGTGGGCAGGAGGTGG - Intronic
1168876346 20:1174769-1174791 GGGAGGGGGGTGGCAGGGGGCGG - Intronic
1168996241 20:2135297-2135319 TGGAAGATGGTGGCAGGGGGTGG + Intronic
1169091926 20:2866179-2866201 AGGAAGCGGGTGGAGGGAGAAGG - Intronic
1169210870 20:3765711-3765733 GAGAAGGGGGAGGCAGGAGGAGG - Intronic
1169224431 20:3847208-3847230 GGCCCGCGGGCGGCAGGAGGAGG - Intronic
1169673730 20:8132200-8132222 GGGGGGCGGGGGGGAGGAGGAGG + Intronic
1169867470 20:10217549-10217571 GGGGAGCGCGTGGGAGGTGGGGG - Intergenic
1170545653 20:17433878-17433900 AGGAAGGGGGGGGGAGGAGGAGG - Intronic
1170569368 20:17624192-17624214 GGGAAGGAGGTGGGAGGGGGAGG + Intronic
1170823045 20:19770641-19770663 GGGAAGGAGGCAGCAGGAGGTGG - Intergenic
1170908177 20:20535967-20535989 GGGGAGCGGGTGGTAGAAGATGG + Intronic
1171008884 20:21495870-21495892 GGGAAGTAGGTGGCAGGGGCAGG + Intergenic
1171121368 20:22571832-22571854 GGGAAGGGAGAGGCAAGAGGGGG + Intergenic
1171290337 20:23979422-23979444 GGGAGGCAGGGGGCAGGAAGGGG + Intergenic
1171311825 20:24150887-24150909 GAGAAGCAGGAAGCAGGAGGAGG + Intergenic
1172056087 20:32155262-32155284 GGGAAGGGAATGGCAGGAAGTGG - Intronic
1172189752 20:33054817-33054839 GGGAATGGGGTGGCAGGTGGGGG - Intergenic
1172777199 20:37414643-37414665 GGGATGCCAGGGGCAGGAGGAGG - Intergenic
1172790031 20:37496816-37496838 GGGAATAGGGTGGCAGTGGGTGG + Intronic
1172841057 20:37903051-37903073 GGGAGGAGGGAGGCGGGAGGAGG + Intergenic
1172841060 20:37903058-37903080 GGGAGGCGGGAGGAGGGAGGAGG + Intergenic
1172950857 20:38722819-38722841 TGGGAGGAGGTGGCAGGAGGCGG + Intergenic
1172977818 20:38919837-38919859 TGGAAGGGGGTGGGAGGTGGAGG - Exonic
1173018196 20:39245698-39245720 GGGAAGAGGGAGGAAGGAGGTGG + Intergenic
1173125894 20:40335695-40335717 GAGAGGCGGGTGGGAGGTGGAGG + Intergenic
1173454146 20:43189930-43189952 GGGACGCGGGGGGCGGGGGGCGG + Exonic
1173581459 20:44149605-44149627 GGGAAGAGGGCAGAAGGAGGTGG - Intronic
1173649311 20:44652863-44652885 GGGGAGCGGTGGGGAGGAGGCGG - Intergenic
1173835072 20:46119436-46119458 GGGAACAGGGAGGCAGGGGGAGG + Intronic
1173850852 20:46216743-46216765 GGGAAGCTGGGGTCAGCAGGTGG + Intronic
1174099284 20:48114866-48114888 AGGATGGGGGTGGCAGGTGGAGG - Intergenic
1174109655 20:48189879-48189901 GGGAAGTGGGTGGGAAGAGGAGG + Intergenic
1174137116 20:48387251-48387273 GGGAGGCCTCTGGCAGGAGGTGG - Intergenic
1174304912 20:49608319-49608341 GGGAGGAGGGAGGCAGGATGAGG - Intergenic
1174330806 20:49815833-49815855 GGGGGTGGGGTGGCAGGAGGTGG + Intronic
1174482180 20:50838987-50839009 GGGAAGCACGTGGAGGGAGGAGG + Intronic
1174534574 20:51241014-51241036 AAGAGGCAGGTGGCAGGAGGTGG - Intergenic
1175237331 20:57524253-57524275 GAGAAGGGGGTGGTATGAGGAGG + Intronic
1175258642 20:57661731-57661753 GCGAGGCTGGTGGCAGGAGATGG - Intronic
1175402974 20:58711097-58711119 GGGAGGAGGGGGGGAGGAGGAGG - Intronic
1175429388 20:58891284-58891306 GCGAGGGGGGTGGAAGGAGGAGG - Intronic
1175531153 20:59674863-59674885 GAGAAGCGGGGGACAGGAGAAGG - Intronic
1175568619 20:60001115-60001137 TGGAACCGCATGGCAGGAGGAGG - Intronic
1175569751 20:60009944-60009966 GGGGAGCTGGGGGCAGGGGGAGG - Intronic
1175570121 20:60012008-60012030 GAGAAAGGGGTGGCAGGAAGTGG + Intronic
1175643282 20:60649416-60649438 TGGAAGAGGGAGGCAGGAGAGGG - Intergenic
1175752428 20:61508607-61508629 GAGGACCTGGTGGCAGGAGGGGG + Intronic
1175761914 20:61566977-61566999 GGGGAGCTGATGGGAGGAGGGGG + Intronic
1175830995 20:61965605-61965627 GGGACGCGGGTGCCGGGTGGAGG - Intronic
1175986012 20:62764504-62764526 GGGAAGCCAGAGCCAGGAGGAGG + Intergenic
1176005797 20:62861709-62861731 GGGCGGCGGGCGGCGGGAGGCGG + Exonic
1176005800 20:62861716-62861738 GGGCGGCGGGAGGCGGGAGGCGG + Exonic
1176005803 20:62861723-62861745 GGGAGGCGGGAGGCGGGAGGCGG + Exonic
1176142258 20:63549943-63549965 GGGCAGCAGGTGCAAGGAGGGGG - Intronic
1176177854 20:63737153-63737175 GGGCAGAGGGTGGCTGCAGGTGG + Intronic
1176231677 20:64036206-64036228 GGGAAGCGGTTGGCTGGTGTTGG + Intronic
1178213071 21:30559778-30559800 GGGAAGCAGGTGGAAGGTGAAGG - Intronic
1178213948 21:30571967-30571989 TGGAGGAGGGTGGCAGGAGGGGG + Intergenic
1178600959 21:33993825-33993847 GGGAGGCAGGTGGCAGGCTGAGG - Intergenic
1178824563 21:36004831-36004853 GGGAGGCGGGGGGGAGGAGGCGG + Intergenic
1178824597 21:36004894-36004916 GGGGAGGGGGAGGCAGGGGGAGG + Intergenic
1178929420 21:36804630-36804652 GAGATGGGGATGGCAGGAGGAGG - Intronic
1179030050 21:37712539-37712561 GGGAGGAGGGAGGGAGGAGGAGG - Intronic
1179608799 21:42535652-42535674 GGGAAGCCAGTGGCAAGCGGGGG - Intronic
1179658486 21:42860176-42860198 GGGAGGAGGGTGGAGGGAGGAGG + Intronic
1179714368 21:43280053-43280075 GGGAAGTGGAGGGGAGGAGGAGG + Intergenic
1179812978 21:43884248-43884270 GGGAAGGAGGGGGAAGGAGGGGG - Intronic
1179817601 21:43917679-43917701 GGGAGGAGGCTGGCAGGTGGGGG + Intronic
1179885568 21:44312891-44312913 GGGGAAGGGGTGGCAGGAGAGGG + Intronic
1180143693 21:45908258-45908280 TGAGAGCGGGTGGCAGGAAGTGG + Intronic
1180650115 22:17370022-17370044 GGGAGTCGGGGGCCAGGAGGAGG + Intronic
1180672006 22:17560972-17560994 GGCAAGCGGCTGGGAGGTGGAGG - Intergenic
1181023848 22:20116830-20116852 GGGGATGGGGTGGGAGGAGGCGG - Intronic
1181094412 22:20495799-20495821 GGGAGGCGGGAGGCGGGAGGCGG + Exonic
1181094416 22:20495813-20495835 GGGAGGCGGGAGGCGCGAGGCGG + Exonic
1181401651 22:22653449-22653471 GGGAGGCAGGGGGCAGGAAGGGG - Intergenic
1181495195 22:23283698-23283720 TGGAAGAGGGTGGGAGGATGGGG - Intronic
1181618007 22:24068191-24068213 GGGAAGCAGGAGGGAGAAGGGGG + Intronic
1181703609 22:24634546-24634568 GGGAGGCAGGGGGCAGGAAGGGG - Intergenic
1181781578 22:25197652-25197674 AGCCAGAGGGTGGCAGGAGGAGG - Intergenic
1182059282 22:27385596-27385618 GGGAAGGGGGTGGATGGAAGAGG - Intergenic
1182332581 22:29561465-29561487 GGAAATTGGGGGGCAGGAGGGGG + Intronic
1182368958 22:29797578-29797600 GGGAAGTGGGTGCCAAGAGAAGG - Intronic
1182668340 22:31975025-31975047 GGGAAGCTGGTGGAGGGATGTGG + Intergenic
1182696455 22:32202257-32202279 GGAAAGAGGAAGGCAGGAGGAGG - Intronic
1182897614 22:33872030-33872052 GGAACTAGGGTGGCAGGAGGTGG + Intronic
1183057348 22:35315123-35315145 GGGAGGAGGGAGGCAGGAGGAGG + Intronic
1183317761 22:37146270-37146292 GGGATGTGGGTGGTTGGAGGCGG - Intronic
1183362654 22:37390736-37390758 GGGAGAGGGGTGGCGGGAGGGGG - Intronic
1183374774 22:37456882-37456904 AGGAAGGGGGTGGCAGGATGGGG + Intergenic
1183404466 22:37623678-37623700 GGGGAGGTGGGGGCAGGAGGTGG - Intronic
1183426370 22:37741524-37741546 GTGAAGCGGGTGGGAGGGAGCGG - Intronic
1183647613 22:39135501-39135523 TGGTAGCAGGTGGCAGGAGAAGG - Intronic
1183722751 22:39571978-39572000 GGGTAGTGGGAGGCAGGAGGAGG + Intronic
1183846188 22:40542196-40542218 GGGTAGGGGGTGGGAGGAGGAGG - Intronic
1183942284 22:41302364-41302386 GGGAAGGGGGCGGCAGGAAAGGG + Intronic
1184099184 22:42332900-42332922 GGGCAGCTGCTGGCAGCAGGTGG + Intronic
1184103544 22:42354264-42354286 GGGAAGTGGCGGGGAGGAGGTGG - Intergenic
1184164618 22:42720316-42720338 GGAGAGCGGCCGGCAGGAGGGGG - Intronic
1184490927 22:44808473-44808495 GGGCTGCTTGTGGCAGGAGGAGG + Intronic
1184561896 22:45268509-45268531 GGGAAGCGGGTGAGGGGAGTGGG - Intergenic
1184581787 22:45422899-45422921 GGGGAGTGTGTGGGAGGAGGGGG - Intronic
1184582514 22:45427007-45427029 GGGAAGGTGGTGGGAGGAGCAGG + Intronic
1184594694 22:45506696-45506718 TGGAAGTGGGTAGAAGGAGGGGG - Intronic
1184721595 22:46317726-46317748 AGGACGCCGGTGGCGGGAGGCGG - Intronic
1184791668 22:46703903-46703925 GGGCAGCAGGTGGGAGGAGCTGG - Intronic
1184796956 22:46738239-46738261 GGGCGGCGGGCGGCGGGAGGCGG + Exonic
1184866484 22:47204470-47204492 GGGAGGAGGGTCGCAGGCGGAGG - Intergenic
1184886993 22:47352466-47352488 GGGAAGGGAGTGACTGGAGGGGG - Intergenic
1185002499 22:48254426-48254448 AGGAAGAGGGAGGGAGGAGGAGG + Intergenic
1185050526 22:48551840-48551862 GGAAAGCGCGGGGCAGCAGGTGG - Intronic
1185055408 22:48576269-48576291 GGGGAGCGGGCGGGGGGAGGGGG - Intronic
1185135634 22:49070512-49070534 GGGTATCAGGGGGCAGGAGGGGG - Intergenic
949101407 3:150347-150369 GAAAAGGGGGTGGAAGGAGGGGG - Intergenic
949549860 3:5104049-5104071 GGGAAGGAGGGGGGAGGAGGGGG - Intergenic
950212330 3:11133090-11133112 GTGAAGCGGGGAGTAGGAGGGGG + Intergenic
950215267 3:11154435-11154457 GGGGAGCGGGGCGCCGGAGGAGG - Intronic
950371314 3:12533342-12533364 GGGCATCTGGTGGCAAGAGGAGG + Intronic
950469371 3:13174951-13174973 GGGCAGCGCATGCCAGGAGGAGG - Intergenic
950473078 3:13198438-13198460 GGTAGGCGGGGGGCAGGAAGGGG + Intergenic
950479384 3:13235270-13235292 GGGGAGGGTGTGGCAGGATGTGG - Intergenic
950829450 3:15859721-15859743 GGGAAGGGGGCGTGAGGAGGCGG - Exonic
951015349 3:17725855-17725877 GGGTTGAGGGTGGGAGGAGGAGG - Intronic
951194141 3:19804714-19804736 GGGAAGGGGGAGGAGGGAGGAGG + Intergenic
951217834 3:20040870-20040892 GGGAGGCGAGAGGCAGGAGGCGG - Intronic
951550635 3:23872015-23872037 GGCAGGCGGGTGGGAGGTGGAGG + Intronic
951558603 3:23945170-23945192 GGGAAGCGGGCGGGAGGGAGGGG + Intronic
951571667 3:24070486-24070508 GGGTAGAGGGTAGGAGGAGGGGG - Intergenic
951969166 3:28423836-28423858 GGAAGGAGGGTGGGAGGAGGAGG - Intronic
952339319 3:32432286-32432308 GGGAAGCCTGTGGTGGGAGGAGG - Intronic
952753339 3:36843581-36843603 GGGATGCAGGTGGCAGGGTGGGG - Intronic
952818493 3:37465998-37466020 GGGAAGCAGGTGGCCAGAGGAGG - Intronic
953326175 3:42013920-42013942 GGCAGGCGGGCAGCAGGAGGCGG + Intronic
953457129 3:43052341-43052363 GGGAAGCAGGGAGCAGCAGGAGG - Intronic
954121860 3:48504273-48504295 GGGAGGAAGGTGGAAGGAGGAGG + Exonic
954328798 3:49878003-49878025 GGGATGGGGGTGGCAGGGGTGGG + Intergenic
954356812 3:50088881-50088903 AGGAGGCGGGTGACAGGGGGAGG + Intronic
954357477 3:50094367-50094389 CCGAGGCGGGTGGCAGGAGATGG - Intronic
954424389 3:50435750-50435772 GGGATGGGGGTGGCGGGAGGAGG - Intronic
954590021 3:51775326-51775348 GTGCAGAGGGTGGCAGGAGGTGG - Intergenic
954670878 3:52290795-52290817 GGGAAGCGGGTGGGGAGGGGAGG - Intronic
954687089 3:52376928-52376950 GAGAAGCCCGTGGCAGGAAGGGG - Intronic
954784893 3:53085338-53085360 GGGAAGGGGATGCCAGGAGCAGG - Intronic
954906507 3:54067732-54067754 GGGCAGAGGGGGCCAGGAGGTGG - Intergenic
955053878 3:55439029-55439051 GGAAGGCCTGTGGCAGGAGGCGG + Intergenic
955058278 3:55474792-55474814 GGGAGGGGGGAGGTAGGAGGTGG + Intronic
955235484 3:57135333-57135355 GGGAAGTGGCAGGCAGGAAGTGG - Intronic
955349301 3:58182194-58182216 GGGAGGAGGGTGGAAGGAGGAGG + Intergenic
955788935 3:62568386-62568408 ACGAAGCAGGTGGAAGGAGGTGG + Intronic
955942269 3:64157764-64157786 GGGAGGTGGGTGGGAGGACGGGG + Intronic
956141529 3:66151330-66151352 GGGAAGCAGGGGGCAGGGAGTGG + Intronic
956403569 3:68905240-68905262 GGGAGGCAGGAGGCGGGAGGCGG - Intronic
956603670 3:71050127-71050149 GGGAAGGGAGTGGCAGGGGGTGG - Intronic
956605731 3:71071194-71071216 GGGGAGCGGGTGGGAGAGGGAGG + Intronic
956657696 3:71568057-71568079 GGGAAGAGGGGGGGAGGAGAGGG + Intronic
956659544 3:71583985-71584007 GGGAGGGGGGAGGGAGGAGGGGG - Intronic
956793248 3:72696071-72696093 GGGAGGGGGGTGGGAGGAGTGGG + Intergenic
957467075 3:80608071-80608093 GGGGAGTGGGAGGGAGGAGGGGG + Intergenic
957564275 3:81865064-81865086 GGGAAGGGGGAGGGAGGGGGCGG - Intergenic
958431167 3:94043548-94043570 GGGAAGAGGGAGGGGGGAGGGGG - Intronic
958450419 3:94266330-94266352 GAGAAGCGGGTGTCAGGAAGAGG + Intergenic
958468102 3:94483283-94483305 GGGCAGGGAGTGCCAGGAGGGGG + Intergenic
958641898 3:96815030-96815052 CGGGAGTGGGTGGGAGGAGGAGG + Intronic
958807046 3:98823902-98823924 GGAATGGGGGTGGCAGGATGGGG + Intronic
958980059 3:100709836-100709858 GGGAAGGGGCTGGAGGGAGGAGG + Intronic
958996401 3:100910258-100910280 GGGAAGTCGGGGGCAGGAGGAGG + Intronic
959085679 3:101849215-101849237 CGGAGGCGGGAGGCGGGAGGCGG + Intronic
959085682 3:101849222-101849244 GGGAGGCGGGAGGCGGGAGGCGG + Intronic
959085684 3:101849229-101849251 GGGAGGCGGGAGGCGGGAAGCGG + Intronic
959671489 3:108982579-108982601 GGGATGGGGGGGGCAGGGGGAGG + Intronic
959849514 3:111071268-111071290 GGGGAGGGGAAGGCAGGAGGGGG - Intronic
959866175 3:111273026-111273048 AGGAGGCGGGAGGCGGGAGGCGG - Intronic
959866178 3:111273033-111273055 GGGAGGCAGGAGGCGGGAGGCGG - Intronic
959866181 3:111273040-111273062 GGGAGGTGGGAGGCAGGAGGCGG - Intronic
960251820 3:115463794-115463816 GGGGAGGGGGTGGGGGGAGGGGG + Intergenic
960294553 3:115927426-115927448 GGGAGGCAGGTAGGAGGAGGAGG - Intronic
960770877 3:121191182-121191204 GGCAGGCGGCTGGCAGGTGGAGG + Intronic
960953981 3:123018455-123018477 GGGCATCTGGTGTCAGGAGGAGG - Intronic
961044021 3:123696495-123696517 AGGAAGCCGGTGGTTGGAGGAGG - Intronic
961135197 3:124503546-124503568 GGTAGGCAGGTGGCTGGAGGAGG + Intronic
961161531 3:124730685-124730707 TGGAAGAGGGTGACAGGAGTTGG + Intronic
962252185 3:133842105-133842127 GGGAGGCAGGGGGCAGGAGCAGG + Intronic
962374745 3:134850569-134850591 GGGAAGTGTGGGGCAGGAAGAGG + Intronic
962459245 3:135593550-135593572 GGGAGGCTGGGGGCAAGAGGAGG + Intergenic
962847817 3:139286864-139286886 GGGAAGGGGAGGGCAGCAGGGGG - Intronic
963032600 3:140993519-140993541 GGGTAGGGGGAGTCAGGAGGAGG + Intergenic
963081105 3:141394394-141394416 GGGAGGAGGGTGGTAGGGGGTGG - Intronic
963123320 3:141794127-141794149 GGCAAGCAGGTGGCAGGAGGGGG + Intronic
963284225 3:143417488-143417510 GGGGAGAGGGAGGGAGGAGGGGG + Intronic
964015220 3:151936914-151936936 GGGAAGTGGGAGGCAGGAGAGGG + Intergenic
964118651 3:153161171-153161193 GGGAAGTGGGAGGCAGAGGGTGG + Intergenic
964756958 3:160097214-160097236 GGGAAGTGGGTGGGAGGAGGTGG - Intergenic
965046662 3:163586399-163586421 GGGTAGTGGGTGGCAGGGGGAGG + Intergenic
965166214 3:165196435-165196457 GGGAGGGGGGTGGGAGGGGGAGG + Intronic
965694755 3:171396102-171396124 GGGCAGTGGGTGGGAGGATGAGG - Intronic
966134279 3:176680823-176680845 GGGAGGTGGGGGGCAAGAGGAGG + Intergenic
966559814 3:181307745-181307767 GGGGAGTGGGGGGCAAGAGGAGG + Intergenic
966668582 3:182500674-182500696 GGGGAGGGGGTGGACGGAGGGGG + Intergenic
966941943 3:184753316-184753338 GAGAAGGTGGTGGCAGAAGGTGG + Intergenic
967155121 3:186684798-186684820 GGGAGGCGGGAGGCAAGAGGAGG + Intergenic
967378082 3:188827843-188827865 GGGAAGCAGATGGGAGGAGCAGG - Intronic
967814756 3:193789193-193789215 GGGCAGTGGGTGGCAGAGGGTGG + Intergenic
967880338 3:194297221-194297243 GGGACGGAGGGGGCAGGAGGGGG - Intergenic
967881759 3:194306465-194306487 AGGAAGCAGGTGGCAGGGAGTGG - Intergenic
967887514 3:194343155-194343177 GGGCAGAGGTGGGCAGGAGGAGG - Intronic
967939219 3:194753610-194753632 GGGTGGCGGGTGGCGGGAAGAGG + Intergenic
967987702 3:195107551-195107573 GGGAAGAGGGGGAGAGGAGGAGG + Intronic
968004164 3:195228105-195228127 GAGAAGATGGTGGCGGGAGGTGG - Intronic
968131831 3:196196657-196196679 AGGACGCGGCAGGCAGGAGGGGG + Intergenic
968450497 4:674010-674032 GGGACGGGGGTCGCGGGAGGAGG + Intronic
968529974 4:1086585-1086607 GGCATGAGGGTGGCAGGAGAGGG + Intronic
968591431 4:1461664-1461686 GGGAAGCACGGGGAAGGAGGGGG - Intergenic
968622156 4:1608671-1608693 GGGCAGCGGGTGTCAGGTGCCGG - Intergenic
968682186 4:1928945-1928967 GGGAGGGGTGTGGCAGGAGTAGG + Intronic
969075488 4:4574846-4574868 AGGAAGGGGGAGGAAGGAGGAGG - Intergenic
969299423 4:6288897-6288919 GGGAAGTGGGTGAAAGGAGGTGG + Intronic
969353916 4:6614111-6614133 GGGAAGTGGCTGGCAGGGGCAGG + Intronic
969445985 4:7244959-7244981 GGAAGGGGGGTGGCTGGAGGGGG + Intronic
969486577 4:7475546-7475568 GGGAGACAAGTGGCAGGAGGGGG - Intronic
969859456 4:10024128-10024150 GGGAGGCTGCTGGGAGGAGGTGG - Intronic
970913154 4:21302696-21302718 GGGATGCAGGGCGCAGGAGGCGG - Intronic
971394490 4:26215794-26215816 GGGATGCGGGAGGCGGGAGTGGG - Intronic
971405627 4:26319484-26319506 GGGAGGCGGGCGGCGGGCGGCGG - Intronic
971834721 4:31748393-31748415 GGGGAGCAGGTGCCAGGAGTGGG + Intergenic
972022116 4:34327828-34327850 GGGAAGTGGGAGGAGGGAGGAGG + Intergenic
972117945 4:35661969-35661991 GAGAAGCGAGTGGCAGGAATGGG + Intergenic
972503479 4:39698532-39698554 GGGAAGGCGGCGGAAGGAGGAGG - Intronic
972747542 4:41952637-41952659 GGGCAGGGAGTGGCAGGAGATGG + Intronic
973774103 4:54229988-54230010 GGGTTGCGGGGCGCAGGAGGCGG + Intronic
973823776 4:54685269-54685291 TGGAAACTGGAGGCAGGAGGTGG - Intronic
973986450 4:56359323-56359345 GGGAGGCAGGAGGCAGGAGGCGG - Intronic
974901688 4:68007059-68007081 GGAAGGCGGGTGGTAGGAGGAGG + Intergenic
975526855 4:75360432-75360454 GGGAAGGGGGTGGCAGCATTGGG + Intergenic
975639455 4:76484836-76484858 GGGAAGCGGGTGGGGGCAGAGGG - Intronic
975754852 4:77562149-77562171 GGGCAGCGGTGGGCAGGGGGTGG - Intronic
976032464 4:80772705-80772727 GGGAGGCGGAGGGCAAGAGGAGG - Intronic
977051705 4:92136453-92136475 GGGTGGAGGGTGGGAGGAGGAGG - Intergenic
977260525 4:94791811-94791833 GGGGTGGGGGTGGCAGGAGAGGG - Intronic
977607340 4:98995993-98996015 GCGACGCGGGTGGGGGGAGGAGG - Intronic
977942973 4:102878134-102878156 GGGGGGCGGGGGGAAGGAGGGGG + Intronic
977948702 4:102944229-102944251 GGGTGGAGGGTGGAAGGAGGGGG + Intronic
978007195 4:103631176-103631198 GGGGTGTGGGTGGCTGGAGGAGG + Intronic
978705093 4:111698450-111698472 GGGAGGGGGGAGGAAGGAGGGGG + Intergenic
978734191 4:112066569-112066591 GGGAAGTGGGTGTTGGGAGGTGG + Intergenic
979433643 4:120662873-120662895 GGGCAGGGGATGGGAGGAGGAGG - Intergenic
979474092 4:121134804-121134826 AGGAAGGGTGTGGCTGGAGGAGG - Intronic
980054039 4:128062405-128062427 GGGAAGGGAGCGGCAGGAAGAGG + Intronic
980563018 4:134502020-134502042 GGGAAGGGGGTGGGAGAAGGTGG - Intergenic
981518517 4:145635789-145635811 GTGATGCTGGTGGCATGAGGAGG - Intronic
981786333 4:148483311-148483333 GGGAAGCTGGTGTGAGAAGGAGG - Intergenic
981885565 4:149668508-149668530 GGGCAGCGGGGGGCAAGGGGAGG + Intergenic
982081753 4:151796977-151796999 TGGAAGAAGGTGGCAGGTGGAGG + Intergenic
982428718 4:155297738-155297760 AGGAAGTGGGTGGCGGGGGGTGG + Intergenic
982678058 4:158399113-158399135 GGGAAGCAGATCCCAGGAGGAGG - Intronic
982763480 4:159316456-159316478 GGTTAGAGGGTGGGAGGAGGTGG - Intronic
983613856 4:169679533-169679555 GGCAGGCGGCTGGCAGGTGGAGG + Intronic
983628669 4:169828156-169828178 GGCAGGCGGCTGGCAGGTGGAGG - Intergenic
983811176 4:172064488-172064510 GAGACGTGGGAGGCAGGAGGAGG + Intronic
983938437 4:173518846-173518868 GGGAAGCGGGGAGCAGGGGGCGG - Intergenic
984123906 4:175781311-175781333 GGGAAGGGGGTGTCAGGGAGGGG + Intronic
984613764 4:181872462-181872484 AGGCAGAGGGTGGAAGGAGGGGG - Intergenic
984706518 4:182851090-182851112 GGGAACGGGGTGGCGGGCGGGGG + Intergenic
985058486 4:186056620-186056642 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058491 4:186056634-186056656 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058522 4:186056704-186056726 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058527 4:186056718-186056740 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058535 4:186056739-186056761 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058543 4:186056760-186056782 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058602 4:186056907-186056929 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058632 4:186056977-186056999 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058637 4:186056991-186057013 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058642 4:186057005-186057027 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058667 4:186057068-186057090 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058672 4:186057082-186057104 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058695 4:186057138-186057160 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058700 4:186057152-186057174 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058742 4:186057257-186057279 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058747 4:186057271-186057293 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058752 4:186057285-186057307 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058789 4:186057369-186057391 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058797 4:186057390-186057412 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058805 4:186057411-186057433 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058813 4:186057432-186057454 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058870 4:186057579-186057601 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058900 4:186057649-186057671 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058905 4:186057663-186057685 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058958 4:186057796-186057818 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058963 4:186057810-186057832 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985058979 4:186057852-186057874 GGGAGGTGGGTGGCGGGAGGTGG - Intergenic
985058985 4:186057866-186057888 GGGAGGTGGGTGGCGGGAGGTGG - Intergenic
985058996 4:186057894-186057916 GGGAGGTGGGTGGCTGGAGGTGG - Intergenic
985059006 4:186057922-186057944 GGGAGGTGGGTGGCTGGAGGTGG - Intergenic
985059011 4:186057936-186057958 GGGAGGTGGGTGGCGGGAGGTGG - Intergenic
985059017 4:186057950-186057972 GGGAGGTGGGTGGTGGGAGGTGG - Intergenic
985059023 4:186057964-186057986 GGGAGGTGGATGGCGGGAGGTGG - Intergenic
985059058 4:186058104-186058126 TGGAGGTGGGTGGCTGGAGGTGG - Intergenic
985141021 4:186840643-186840665 GAGAAGAGGGAGGGAGGAGGAGG - Intergenic
985659868 5:1151700-1151722 GGGAGGCGGGGGGCAGGGGGTGG + Intergenic
985673412 5:1218045-1218067 GGGCAGGAGGTGGGAGGAGGCGG - Intronic
985824021 5:2179711-2179733 GGGAAGCTGGTGGCAGCCGCGGG + Intergenic
985964473 5:3329572-3329594 AGGAAGTAGGTGGCAGGAGGTGG - Intergenic
986310577 5:6547833-6547855 AGGAAGAGGGAGGCAGGAGGAGG + Intergenic
986328858 5:6702937-6702959 GGGGAGAGGGAGGGAGGAGGAGG - Intergenic
986517680 5:8581060-8581082 GGGAGGCAGGTGGGAGGAGGGGG - Intergenic
986581456 5:9270694-9270716 GGGCAGCGGGTGGGGGCAGGGGG + Intronic
986686326 5:10278332-10278354 GGGAAGGTGGTCCCAGGAGGCGG - Intronic
986704893 5:10446707-10446729 GGGAGGAGGGTGGCGGGTGGGGG + Intronic
986772577 5:10987616-10987638 GGAAAGAGGAGGGCAGGAGGAGG - Intronic
987049371 5:14136551-14136573 GGCAGGGTGGTGGCAGGAGGAGG + Intergenic
988982654 5:36587009-36587031 GGGAAGAGGCTTGGAGGAGGAGG - Intergenic
989108545 5:37886030-37886052 GGGAGGCGGGAGGCAGGTGGTGG + Intergenic
989182411 5:38591761-38591783 GAGAAGGGGGTGACAGGAGGTGG + Intronic
989749932 5:44881191-44881213 AGGAAGAGGGCGGAAGGAGGAGG + Intergenic
990861423 5:60331680-60331702 GGGAAGGGGAAGGCAAGAGGAGG + Intronic
991217331 5:64170729-64170751 GAGAAGCAGGTGGCATCAGGAGG + Intronic
992379737 5:76225462-76225484 GAGAACTGGGTGGCAGGAGATGG + Intronic
994457198 5:100025708-100025730 GGGGGGCGGGGGGCAGGGGGGGG + Intergenic
994662503 5:102670625-102670647 GGGATGGGGGTGGCAGGGAGAGG + Intergenic
995587290 5:113661209-113661231 GGGAAGGGGAGAGCAGGAGGAGG - Intergenic
995846385 5:116498570-116498592 GGGGAGGGGGTGGAAGGGGGTGG + Intronic
996343193 5:122460859-122460881 GTGAAGATGGGGGCAGGAGGAGG - Intronic
996398234 5:123034428-123034450 AGGAAGCTGGTGGCTGCAGGAGG - Intronic
997257153 5:132437842-132437864 GGGCAGAGGGAGGGAGGAGGAGG + Intronic
997353528 5:133247869-133247891 GGGAAGCAGATGGAAAGAGGGGG - Intronic
998007137 5:138664569-138664591 GAGAAGCAGGTTGTAGGAGGAGG + Intronic
998138259 5:139685718-139685740 GGGAAGTGGGAGGTGGGAGGTGG - Intergenic
998151369 5:139759362-139759384 GGGCAGCAGGAGGCAGGAGCAGG - Intergenic
998406275 5:141876379-141876401 GCGCAGCGGGCGCCAGGAGGGGG + Intronic
998957223 5:147451195-147451217 AGGAAGGGCATGGCAGGAGGCGG - Intronic
998985428 5:147751507-147751529 GTGAAGGGGGTGGGGGGAGGGGG - Intronic
999279450 5:150355462-150355484 GGGGGGCGGGTGGTAGGTGGCGG - Intergenic
999300235 5:150486220-150486242 GGAGAGCGGGCGGGAGGAGGCGG + Intronic
999452245 5:151687013-151687035 GGGAAGGAGGAGACAGGAGGAGG - Exonic
999991875 5:157057526-157057548 GGGCAGAGGGTGGGAGGTGGAGG - Intronic
1000296390 5:159916602-159916624 GGGGAGCGGCGGGGAGGAGGGGG - Intergenic
1000329921 5:160198264-160198286 GGGAAGAGGAAGGCAGGAAGAGG + Intronic
1000340615 5:160274614-160274636 GAGAAGTGTCTGGCAGGAGGTGG - Intronic
1000411601 5:160938961-160938983 GGGATTGGGGTGGCAGGTGGCGG + Intergenic
1000463177 5:161547216-161547238 GTGCAGCGGGTGGGAGGAGGGGG + Intronic
1001081831 5:168672914-168672936 GAGAAGGGGGAGGCAGGAGATGG - Intronic
1001178866 5:169499612-169499634 GGGTAAAGGGTGGAAGGAGGGGG - Intergenic
1001564009 5:172687902-172687924 GGGGACCTGCTGGCAGGAGGAGG + Exonic
1001724816 5:173888114-173888136 GGGAAGCGGGTTCCAGGCGCCGG + Intergenic
1001829558 5:174774106-174774128 GGGAAGGGTGTGGCAGGAGGTGG - Intergenic
1002201548 5:177531509-177531531 GGGCAGCGGGTGGCTGGGGGTGG + Intronic
1002482617 5:179513302-179513324 GGGAGGGGGGAGGGAGGAGGGGG - Intergenic
1002842352 6:917132-917154 GAGAAGTGGGAGGAAGGAGGAGG - Intergenic
1003685457 6:8297947-8297969 GTGAGGAGGATGGCAGGAGGAGG + Intergenic
1003995909 6:11538551-11538573 GGGAAGGGGGTGGCGGGAGCCGG - Intronic
1004321326 6:14633856-14633878 GGGAAGGGGCTGGCAGGACCAGG - Intergenic
1004504777 6:16238837-16238859 GGCAAGTGGGTGGAAGGGGGTGG + Intronic
1005353937 6:24963995-24964017 TGGAAGGCGGAGGCAGGAGGAGG - Intronic
1005739460 6:28776730-28776752 GGGAAGGGGGAGGAAAGAGGGGG - Intergenic
1005826067 6:29632585-29632607 GGGCCGAGGGAGGCAGGAGGAGG - Intronic
1005968747 6:30744626-30744648 GGGGAGCGGTTGGCAGCAGCGGG + Intergenic
1006044999 6:31287807-31287829 GGAAAGTGTGTGGCTGGAGGAGG + Intronic
1006073613 6:31515322-31515344 GGGTGGAGGGTGGGAGGAGGGGG + Intergenic
1006184818 6:32175783-32175805 GGGAAAGGGATGGGAGGAGGAGG - Intronic
1006192876 6:32220376-32220398 GGGTAGAGGGTATCAGGAGGTGG - Intronic
1006502134 6:34465909-34465931 GGGTGGCGGGTGGCGGGTGGCGG - Intergenic
1006935671 6:37715783-37715805 GGGAGGAGTGTGGCTGGAGGAGG + Intergenic
1006983263 6:38162245-38162267 GGGCAGTGGACGGCAGGAGGAGG + Intergenic
1007130899 6:39472589-39472611 GGGAAGGGGGAGAGAGGAGGAGG - Intronic
1007184368 6:39955650-39955672 GGGAAGAGGGTGGGAGGAGGGGG + Intergenic
1007286726 6:40753247-40753269 GGGGAGAGGGTGGCTGGTGGAGG - Intergenic
1007418608 6:41706262-41706284 GGGAGGTGGGGGGCAGAAGGGGG + Intronic
1007424008 6:41735315-41735337 GGGGAGCGAGAGGCACGAGGAGG - Intronic
1007473863 6:42106701-42106723 GGGAGGGGGGGTGCAGGAGGGGG + Exonic
1007498018 6:42274947-42274969 GGGATGGGGGTGGAAGGTGGAGG - Intronic
1007712911 6:43836020-43836042 GGGAAACTGGTGGGAGCAGGAGG + Intergenic
1007737287 6:43989748-43989770 GGGAGGCAGGAGGCAGCAGGTGG + Intergenic
1007745094 6:44038803-44038825 GGGAAGTGCCTGGCAGGTGGTGG + Intergenic
1007751097 6:44072611-44072633 GGCAAGTGGGTGGCCGGGGGGGG - Intergenic
1007759858 6:44127524-44127546 GGGGAGCGGGGGGAGGGAGGGGG - Intronic
1008023835 6:46611107-46611129 AAGAAGCTGGTGGCTGGAGGAGG - Intronic
1008537490 6:52517896-52517918 GGTGAGGGGGTGGGAGGAGGTGG + Intronic
1008667932 6:53735211-53735233 GGGAAGTGGGAGACAGGAAGGGG - Intergenic
1008944545 6:57083266-57083288 GGGAAGGGGGTGGGAGCAAGTGG + Intergenic
1009808696 6:68634978-68635000 GGGGAGAGGCTGGCGGGAGGGGG - Intergenic
1010305717 6:74319434-74319456 AGGAAGCAGGTGGAAGTAGGTGG + Intergenic
1011410186 6:87059647-87059669 GGGAGGGGGGAGGCTGGAGGAGG + Intergenic
1011427592 6:87247252-87247274 GTGTTGCGGGTGGCAGGGGGCGG - Intronic
1011921579 6:92583493-92583515 GAGAACTGGGTGGCAGGAGGGGG + Intergenic
1011968387 6:93189709-93189731 GGAAAGTGGGGGGCTGGAGGAGG - Intergenic
1012981067 6:105831058-105831080 GGGAAGGGGGAAGCTGGAGGAGG + Intergenic
1012981129 6:105831212-105831234 GGGAAGGGGGCAGCTGGAGGAGG + Intergenic
1013253874 6:108363363-108363385 GTGTAGAGGGTGGGAGGAGGGGG - Intronic
1013254041 6:108365878-108365900 GGGAAGCGGGTGGGAAGAGGAGG + Intronic
1013466950 6:110426402-110426424 GGGAAGCAGGAGTGAGGAGGAGG - Intronic
1013620150 6:111879951-111879973 GGGAGTTGGGGGGCAGGAGGCGG + Intergenic
1014192459 6:118513246-118513268 GGTAAGAAGGTGGCAGGGGGTGG + Intronic
1014769452 6:125444774-125444796 GGGGAGACGGGGGCAGGAGGTGG - Intergenic
1015294423 6:131574525-131574547 GGGAGGAGGGTGGTAGAAGGAGG - Intronic
1015380368 6:132560472-132560494 GGGAGGAGGGTGGAAGGAGGGGG + Intergenic
1015702408 6:136050916-136050938 GGGAAGCGTCTGAGAGGAGGAGG - Intronic
1015963597 6:138675439-138675461 GGGAAGAGGGTGGGAGGAGTAGG + Intronic
1016130530 6:140462924-140462946 GGGAAGTGAGTGGAAGGAGCAGG - Intergenic
1016461665 6:144285351-144285373 GGGAAGCGGGCAGCAGCAGCCGG + Intergenic
1016597050 6:145814710-145814732 GGGAAGAGGGGCGGAGGAGGCGG - Exonic
1016773140 6:147874527-147874549 GGCCAGCTGGTGGCAGGAGCTGG + Intergenic
1016798804 6:148147173-148147195 GGGAAGCGAGAGGAAAGAGGCGG + Intergenic
1016801479 6:148173522-148173544 GGGAAGAAGGGGGGAGGAGGAGG + Intergenic
1017006108 6:150029009-150029031 GGGAACCTGGAGCCAGGAGGAGG - Intergenic
1017444451 6:154494693-154494715 AGGAAGAGGGTGGCAGAGGGTGG - Intronic
1018017745 6:159727378-159727400 GGGAGGCGGGAGGCGGGAGGCGG + Intronic
1018062634 6:160102671-160102693 GGTAAGCGGGTGGCAGGGCGAGG + Exonic
1018064430 6:160115589-160115611 GGGAGGGGAGTGGCAGGAGCAGG + Intergenic
1018323410 6:162637257-162637279 GGGGGGCGGGTGGGAGGAGGTGG - Intronic
1018433346 6:163740664-163740686 GGGAAGAGGCTGGGAGGAGGAGG + Intergenic
1018469518 6:164083279-164083301 GTGATGCGGGGGGCAGGGGGTGG + Intergenic
1018794774 6:167177337-167177359 GGGAAGCAGCTGGCAGGACTTGG - Intronic
1018802784 6:167236380-167236402 GGGCAGCGGGTGGAGGGAGGGGG + Intergenic
1018821545 6:167377730-167377752 GGGAAGCAGCTGGCAGGACTTGG + Intronic
1018985859 6:168636855-168636877 GGGAGGAGGGAGGCGGGAGGAGG - Intronic
1018985862 6:168636862-168636884 GGGAGGCGGGAGGAGGGAGGCGG - Intronic
1018985865 6:168636869-168636891 GGGAGGAGGGAGGCGGGAGGAGG - Intronic
1019126279 6:169842362-169842384 GGGAAGCAGCCGGAAGGAGGGGG - Intergenic
1019273424 7:163462-163484 GGGAAGCCCGTGGCAGGCGTGGG + Intergenic
1019278096 7:186697-186719 GGGCTCTGGGTGGCAGGAGGAGG - Intergenic
1019320656 7:414084-414106 GGGAAGAGGAGGGGAGGAGGGGG - Intergenic
1019327230 7:444469-444491 GGGAAGTGGGTGGAAGGAAAGGG - Intergenic
1019328163 7:449553-449575 GGGGAGCTCATGGCAGGAGGGGG - Intergenic
1019437076 7:1027973-1027995 GGGCCGCGGGTGGCAGGGTGGGG - Intronic
1019533216 7:1513959-1513981 GGGGAGCGGGAGGCGGGAGCAGG + Intergenic
1019609380 7:1929238-1929260 GGGAGGAGGGAGGCAGGGGGAGG - Intronic
1020111657 7:5451251-5451273 TGGAGGGGGGTGGCGGGAGGTGG - Intronic
1020214364 7:6178370-6178392 GTGAAGGGGGTGGCAGGGAGCGG - Intronic
1020560639 7:9726513-9726535 GGGCCGCGGCTGGCAGGCGGAGG + Intergenic
1021135013 7:16954969-16954991 GGGAAGAGGGTGGATGGGGGAGG - Intergenic
1021432710 7:20579161-20579183 TGGAAGAGGGTGGCATGAGATGG + Intergenic
1021673952 7:23061696-23061718 GGGGGGGGGGTGGGAGGAGGGGG + Intergenic
1021868697 7:24981977-24981999 GGAAAGGGACTGGCAGGAGGAGG - Intergenic
1022112073 7:27238057-27238079 GGGATGGGGGTGGCAGGGTGAGG + Intergenic
1022333536 7:29401753-29401775 GGGTAGATTGTGGCAGGAGGCGG + Intronic
1022396367 7:29990671-29990693 GGGAGGCGGGAGGCAGGAGGCGG - Intergenic
1022396372 7:29990685-29990707 GGGAGGCGGGAGGCGGGAGGCGG - Intergenic
1022533183 7:31079624-31079646 GGGGAGGGGCTTGCAGGAGGTGG + Intronic
1022970825 7:35515199-35515221 GGGGAGCGGGTGGGAGGGGGAGG + Intergenic
1023401002 7:39793016-39793038 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1023604309 7:41914720-41914742 GGGAAGAGGGAAGAAGGAGGTGG + Intergenic
1023822186 7:43986437-43986459 GGGAAGGGGGTGGCTGGGGGAGG + Intergenic
1023874924 7:44281766-44281788 GACAAGCAGGTGGGAGGAGGAGG - Intronic
1023878832 7:44307289-44307311 GGGAAGAGGGTGTGAGCAGGCGG + Intronic
1023991707 7:45132594-45132616 GGGAGGAGGGAGGGAGGAGGTGG + Intergenic
1024023312 7:45390400-45390422 GGGAAGGAGGTGGAGGGAGGTGG + Intergenic
1024042872 7:45568586-45568608 GAGAACTGGTTGGCAGGAGGAGG - Intergenic
1024074226 7:45810603-45810625 GGGCACCGGGAGGCAGGAGCTGG - Intergenic
1024239107 7:47420327-47420349 TGGCAGCTGGTGCCAGGAGGAGG + Intronic
1024648630 7:51387761-51387783 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1024874761 7:54009176-54009198 GGAAAGGGGCTGGCAGGAGGAGG - Intergenic
1025178589 7:56813970-56813992 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179027 7:56815760-56815782 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179483 7:56817646-56817668 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179932 7:56819484-56819506 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025180407 7:56821466-56821488 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025180850 7:56823304-56823326 GGCCACCGGGAGGCAGGAGGTGG + Exonic
1025181277 7:56825055-56825077 GGCCACCGGGAGGCAGGAGGTGG + Intronic
1025181723 7:56826893-56826915 GGCCACCGGGAGGCAGGAGGTGG + Intronic
1025212745 7:57030014-57030036 GGGGGGCGGGGGGCAGGGGGCGG + Intergenic
1025659208 7:63546810-63546832 GGGGGGCGGGGGGCAGGGGGCGG - Intergenic
1025690194 7:63750102-63750124 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025690641 7:63751925-63751947 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691092 7:63753748-63753770 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691526 7:63755524-63755546 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691966 7:63757347-63757369 GGCCACCGGGAGGCAGGAGGTGG - Exonic
1025692415 7:63759170-63759192 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025692859 7:63760993-63761015 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693275 7:63762672-63762694 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693718 7:63764495-63764517 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1026028009 7:66762706-66762728 GGGACGGGGGTGGCAGGAGAGGG - Intronic
1026335121 7:69387574-69387596 GGGAAAAGGGTGGAAGGATGGGG + Intergenic
1026517816 7:71087872-71087894 GCGAAAGGAGTGGCAGGAGGAGG + Intergenic
1026776665 7:73235087-73235109 AGGAAGTGGGGGGCAGTAGGGGG - Intergenic
1026945287 7:74312339-74312361 GGGGGGCGGGGGTCAGGAGGCGG + Intronic
1027017517 7:74788457-74788479 AGGAAGTGGGGGGCAGTAGGGGG - Intronic
1027070506 7:75157475-75157497 AGGAAGTGGGGGGCAGTAGGGGG + Intergenic
1027135827 7:75623335-75623357 GGGCAGCCGCTGGGAGGAGGTGG + Intronic
1027189625 7:75989228-75989250 GGGAAGGGGGTGGCGGGGTGAGG + Intronic
1027190983 7:75995277-75995299 GGGATGGGGGTGGGAGGGGGTGG - Intergenic
1027397149 7:77767784-77767806 GGGAAGGGGGAGGGAGAAGGGGG - Intronic
1028121305 7:87059337-87059359 AGGAAGCGGGCGGCTGGAGGAGG + Exonic
1029089401 7:98036365-98036387 GAACAGCGGGTGCCAGGAGGTGG - Intergenic
1029270778 7:99375347-99375369 GGGAGGCGGGTGGGAGCAGCGGG - Intronic
1029407355 7:100383500-100383522 AGGCAGAGGGTGGAAGGAGGCGG + Intronic
1029412946 7:100427124-100427146 GGGAGGAGGGAGGGAGGAGGGGG - Intronic
1029419983 7:100467387-100467409 GTGGAGGTGGTGGCAGGAGGGGG + Intronic
1029451262 7:100642814-100642836 GGGGTGAGTGTGGCAGGAGGTGG - Intergenic
1029582687 7:101447857-101447879 GGAAAGCTGCTTGCAGGAGGAGG - Intronic
1029640452 7:101816505-101816527 GGGGAGCGGGCGGCGGGGGGCGG + Intronic
1029729726 7:102431507-102431529 TTGATGGGGGTGGCAGGAGGAGG + Intergenic
1029744817 7:102511028-102511050 GAGAAGTGGTTGGCATGAGGTGG - Intronic
1029750452 7:102539851-102539873 GGGAAGGGGGTGGCTGGGGGAGG + Intronic
1029762809 7:102610190-102610212 GAGAAGTGGTTGGCATGAGGTGG - Intronic
1029768404 7:102638959-102638981 GGGAAGGGGGTGGCTGGGGGAGG + Intronic
1029978103 7:104852841-104852863 GGGAAGAGGGTGGAGGGAGGAGG - Intronic
1030260903 7:107563529-107563551 GGGAAGCTGGAGGCATGGGGGGG + Intronic
1030835914 7:114285029-114285051 GGGTTGAGGGTGGGAGGAGGGGG + Intronic
1031148546 7:118025750-118025772 TAGAAGCAGGTGTCAGGAGGTGG + Intergenic
1031312292 7:120213477-120213499 GGGGAGAGGGTGGAAGGAGGGGG + Intergenic
1032018680 7:128394814-128394836 GGGAAGTCGGTGGCATGAGCGGG + Intronic
1032578473 7:133081371-133081393 GGGGAGTGGGTGGGAGGAGGGGG + Intronic
1033159824 7:138985298-138985320 GGGAAGAGGGTGTCAGGCAGAGG + Intergenic
1033174023 7:139108886-139108908 GAGAAGGGAGTGGCTGGAGGCGG + Intronic
1033410127 7:141109721-141109743 GAGAAGCCTGTGGCAGGAGATGG + Intronic
1033656835 7:143380845-143380867 GGGTAGCGGGTGGTGGCAGGAGG + Intergenic
1033872851 7:145777902-145777924 GGGTAGGGGGTGGTAGGGGGTGG - Intergenic
1034277772 7:149831102-149831124 GGGCATTGAGTGGCAGGAGGTGG - Intergenic
1034424469 7:151007322-151007344 GGGCAGAGTGAGGCAGGAGGAGG - Intronic
1034448074 7:151123480-151123502 GAGAAGCGGGGGCGAGGAGGTGG - Intronic
1034467759 7:151239807-151239829 AGGAAGCGGGTGGGAAGGGGAGG + Intronic
1035230730 7:157464039-157464061 GGGAAGAGGATGGGAGGATGGGG - Intergenic
1035242746 7:157542829-157542851 GGGCGTCGGCTGGCAGGAGGAGG + Intronic
1035280777 7:157776690-157776712 GAGGAGAGGGAGGCAGGAGGAGG - Intronic
1035287311 7:157814562-157814584 GAGAGACGGGGGGCAGGAGGGGG + Intronic
1035287316 7:157814572-157814594 GGGCAGGAGGGGGCAGGAGGGGG + Intronic
1035934616 8:3822605-3822627 AGGTAGCGGGTGACAGAAGGTGG - Intronic
1036614746 8:10379565-10379587 GGGAAGAGGGGGGAAGGCGGAGG - Intronic
1036747079 8:11417518-11417540 GGGAAGTGAGTCGGAGGAGGTGG - Intronic
1036779115 8:11633692-11633714 GGGAAGGGGGTTCCAGGATGAGG + Intergenic
1036926366 8:12909672-12909694 GGGGAGTGGGTAGCAGGTGGGGG + Intergenic
1037169392 8:15873859-15873881 GGGAAGGGGGAGGGAGAAGGGGG - Intergenic
1037583677 8:20261888-20261910 GGGAGGGAGGAGGCAGGAGGCGG - Intronic
1037587483 8:20288047-20288069 GGGCAGGGAGAGGCAGGAGGTGG - Intronic
1037717456 8:21412152-21412174 GAGATGCAGGTGGCAGCAGGAGG + Intergenic
1037760434 8:21738210-21738232 GGGAAGAGGGGAGGAGGAGGAGG - Intronic
1037837398 8:22222207-22222229 GTGGATGGGGTGGCAGGAGGTGG - Intronic
1037928889 8:22865684-22865706 GGGATCCGGGCGGCGGGAGGTGG - Intronic
1038042630 8:23737976-23737998 GGGAAGGGGTGGGGAGGAGGAGG - Intergenic
1038060780 8:23909186-23909208 GGTGAGTGGGTGGCAGCAGGTGG + Intergenic
1038240108 8:25800512-25800534 GGGAAGCGGGGGGGTGGGGGGGG - Intergenic
1038419055 8:27420443-27420465 GGGAGGTGGCTGGCAGGTGGTGG - Intronic
1038542637 8:28402271-28402293 GGGAGGAGGGAGGGAGGAGGAGG + Intronic
1039132520 8:34283375-34283397 AGGAAGAGGGTGGTAGGAGTGGG + Intergenic
1039343402 8:36675754-36675776 GGGAATCAGAGGGCAGGAGGGGG - Intergenic
1039382639 8:37100311-37100333 GGGTGGAGGCTGGCAGGAGGAGG - Intergenic
1039542147 8:38381626-38381648 GGGAAGCGGGTGGCCTGAAAGGG - Intronic
1039793114 8:40891248-40891270 GGGAAGGGGGAGGGGGGAGGGGG + Intronic
1040072777 8:43201930-43201952 AAGAAAAGGGTGGCAGGAGGAGG - Exonic
1041614942 8:59895559-59895581 TGGAAGCGGGGAGCAGGAGAGGG - Intergenic
1042021932 8:64378007-64378029 GGGAGGCGGGAGAGAGGAGGGGG - Intergenic
1042200507 8:66276063-66276085 GGGGAGAGGGTGGCATGAGCAGG - Intergenic
1042591760 8:70403641-70403663 GGGGGGCGGGCGGCAGGCGGGGG - Intronic
1043289343 8:78577343-78577365 GGGTAGAGCGTGGGAGGAGGGGG + Intronic
1043354961 8:79401543-79401565 GGGGGGCGGGGGGCAGGGGGTGG - Intergenic
1043372614 8:79611914-79611936 GGGAAGCGCGCGGCAGGGAGGGG + Intronic
1044047434 8:87454075-87454097 AAGAAGTGGGTGGCAGGGGGAGG + Intronic
1044058743 8:87605739-87605761 GGGGGGAGGGTGGCAGGGGGTGG + Intronic
1044419405 8:91975987-91976009 GGGAAGGGGGTGGAGAGAGGAGG + Intronic
1044497077 8:92899376-92899398 GGGGAGGGGGTGGAAGGAGTGGG - Intronic
1044857927 8:96494656-96494678 GGGGAAAGGGTGGCAGGAGGGGG + Intronic
1045708094 8:104950724-104950746 GGGGAGGGGGTGGCAGGCGAGGG - Intronic
1045819910 8:106324361-106324383 GGGAGGAGGTTGGGAGGAGGAGG + Intronic
1046100608 8:109610075-109610097 GGGGATGGGGTGGCAGGTGGTGG - Intronic
1046259470 8:111747732-111747754 GGGTAGGGGGAGGGAGGAGGGGG - Intergenic
1046545750 8:115648229-115648251 GGGAAGAAGCGGGCAGGAGGCGG + Intronic
1046547504 8:115669349-115669371 GGGTAGTGGGGGGCAGGTGGGGG + Intronic
1046718071 8:117588892-117588914 AGAAAGAGGGTGGGAGGAGGTGG - Intergenic
1046768737 8:118098006-118098028 GGAAAGCGGGGAGAAGGAGGAGG + Intronic
1047248088 8:123161330-123161352 GGGAGGAGGGTGGGAGAAGGAGG - Intergenic
1047254804 8:123207055-123207077 AGGAAGAGGGAGGGAGGAGGTGG - Intronic
1047273272 8:123383194-123383216 GGGGAGTGGGGGGCATGAGGAGG + Intronic
1047899579 8:129405550-129405572 GAGAAGAGGGTGGAAGGAGAGGG + Intergenic
1048375484 8:133818945-133818967 GGGGGGCGGGGGGCAGGGGGCGG + Intergenic
1048600820 8:135916954-135916976 GGGAAAAGGGTGGCTGGAGGAGG + Intergenic
1048601522 8:135923676-135923698 GGGAGGCTGCTGGCAGGAAGGGG - Intergenic
1048716104 8:137272036-137272058 GGGCAGAGGGTGGGAGGAGAGGG + Intergenic
1048923724 8:139252453-139252475 GGGAAGGGAGTGGCAGGGGCAGG + Intergenic
1049273886 8:141710144-141710166 GGGCTGCGGGTGGCGGGCGGTGG - Intergenic
1049355616 8:142186743-142186765 GGGAGCCAGGTGGCAGGAGGTGG - Intergenic
1049368232 8:142251192-142251214 GGGAATCTGGTGGAAGGCGGTGG - Intronic
1049438564 8:142598822-142598844 AGGAGGCCGGTGGCAGGCGGGGG + Intergenic
1049498274 8:142946993-142947015 GGGAAGTGACTGGCAGGTGGGGG + Intergenic
1049657150 8:143803947-143803969 GGGAGGAGGGTGGCAGCTGGTGG + Intronic
1049688414 8:143948487-143948509 GGGAAGCTAGGGGAAGGAGGCGG - Intronic
1049719409 8:144108662-144108684 GGGAACCGGCAGGCAGCAGGTGG - Exonic
1049820230 8:144628997-144629019 GGGAAGCGCGTGGCAGGTGCTGG - Intergenic
1050090839 9:2015864-2015886 GGGAGGGGGGTGGCCGCAGGAGG + Intronic
1050537894 9:6645828-6645850 GGGAAGAGGGTAGGAAGAGGGGG - Intergenic
1050672174 9:8009860-8009882 GGGCAGAGGGTGGAAAGAGGAGG + Intergenic
1051088696 9:13381237-13381259 GGGAAGCAGGGAGCAGGAAGGGG - Intergenic
1051144608 9:14013307-14013329 GGGATGAGGCTGGCAGCAGGAGG + Intergenic
1052619577 9:30889149-30889171 GAGAAGAAGGGGGCAGGAGGGGG - Intergenic
1052864520 9:33456942-33456964 GGGGAGGAGGTGGCAGAAGGAGG + Intergenic
1052928581 9:34038636-34038658 GGCAGGCGGGTGGGAGGTGGAGG - Intronic
1052960536 9:34292550-34292572 GGGATGGGGGAGGCTGGAGGTGG + Intronic
1053157741 9:35792152-35792174 GAGAACGGGGTGGCAGGGGGAGG - Exonic
1053173554 9:35907229-35907251 GGGAAGCGTGTGGCTGGAGCAGG + Intergenic
1053314606 9:37040942-37040964 GGGGAGAGGGTGGCAAGGGGTGG + Intergenic
1053358290 9:37465334-37465356 GGGGGGCGGGTGGAAGGGGGAGG - Exonic
1053835482 9:42130118-42130140 GGGAGGTGGGAGGCAGGGGGCGG + Intergenic
1054112563 9:61123639-61123661 GGGAGGCGGGAGGCAGGGGGCGG + Intergenic
1054595146 9:67058492-67058514 GGGAGGCGGGAGGCAGGGGGCGG - Intergenic
1055340797 9:75280746-75280768 TGGAAGAGGGAGGCAGGATGAGG - Intergenic
1055350182 9:75378557-75378579 TGGGGGAGGGTGGCAGGAGGGGG + Intergenic
1055766055 9:79664692-79664714 TGGCAGCGGGAGGCAGGAGGAGG - Intronic
1056106294 9:83349856-83349878 GGGGAGTGGGGGCCAGGAGGGGG + Intronic
1057214341 9:93219785-93219807 GGCAAGCTGGTGGCAACAGGTGG - Intronic
1057466268 9:95317304-95317326 GGGAGGCGGGAGGCGGAAGGTGG - Intronic
1057466270 9:95317311-95317333 GGGAGGCGGGAGGCGGGAGGCGG - Intronic
1057522621 9:95772139-95772161 GGGGAGGGGCTGGGAGGAGGGGG + Intergenic
1058357012 9:104094529-104094551 GGGAGGCGGGAGGCGGGAGGCGG + Intronic
1058638802 9:107063205-107063227 GGGAATAGGGAGGCAGGAGCGGG + Intergenic
1058869667 9:109191068-109191090 GGGAAGCAGATGGAGGGAGGAGG + Intronic
1058991181 9:110256333-110256355 GGGAAGGCGGTGGCGGGAGGTGG - Intronic
1059040011 9:110802671-110802693 GGGAAGAGGATGTCAGCAGGAGG - Intergenic
1059115761 9:111599215-111599237 GGCAAGCGGGCGGCGGGCGGCGG - Intronic
1059155112 9:111982679-111982701 AGGAAGGGGTTGGGAGGAGGAGG - Intergenic
1059471161 9:114505532-114505554 GGGAGGGGGCGGGCAGGAGGAGG - Intergenic
1059519119 9:114923259-114923281 GGAAAGATGGTGGCAGGAGGAGG - Intronic
1060124036 9:121024296-121024318 GGGGAGCGGGAGGGGGGAGGGGG + Intronic
1060124069 9:121024351-121024373 GGGGAGCGGGAGGGGGGAGGGGG + Intronic
1060201216 9:121652562-121652584 GGGAAGCCCCTGGGAGGAGGAGG + Intronic
1060222766 9:121773307-121773329 CGGCCGCGGGGGGCAGGAGGTGG - Exonic
1060268648 9:122126618-122126640 GGGAAGGGGTTGCCAGGAGGAGG + Intergenic
1060334702 9:122711142-122711164 GGCAGGCGGGTGGGAGGTGGAGG - Intergenic
1060359444 9:122941113-122941135 GGTAGGAGGGTGGGAGGAGGAGG - Intronic
1060491536 9:124088716-124088738 GGGAAGGGGGTGTCAGCTGGAGG + Intergenic
1060546769 9:124466427-124466449 GGGAGGGGGGTGTCAGGAGGGGG + Intronic
1060555334 9:124504885-124504907 GGGAACAGGGAGGCAGGATGGGG - Intronic
1060801735 9:126549434-126549456 GGGCAGTGGCTGGCAGGAGGTGG + Intergenic
1060829753 9:126706103-126706125 GGGATGGGGGTGGGAGGTGGGGG - Intergenic
1060967680 9:127720892-127720914 GGGAGGAGGGAGGAAGGAGGAGG - Intronic
1060975809 9:127764369-127764391 GGGAAGCCAGTGGGAGGTGGTGG - Intronic
1061045082 9:128160478-128160500 GGGAAGCAGGTGACCCGAGGGGG + Exonic
1061177364 9:129005817-129005839 GGGAAGTGGCAGGCAGGGGGAGG - Intronic
1061248502 9:129413626-129413648 GGGACCCGGGGTGCAGGAGGAGG + Intergenic
1061259652 9:129472813-129472835 GGGATGGGGGTGACAGGATGCGG + Intergenic
1061290260 9:129646682-129646704 TGGAGGTGGGTGGCAGGAAGGGG - Intergenic
1061365881 9:130172325-130172347 GGGAGGGGGGAGGCGGGAGGCGG + Intergenic
1061422175 9:130478369-130478391 GGGAGGCGGGTGGCAGGCTGCGG + Intronic
1061488722 9:130933710-130933732 GGGAAGCGGCGGGCGGGTGGGGG + Intronic
1061491682 9:130948300-130948322 GGGAAGAGGCTGTGAGGAGGTGG + Intergenic
1061496518 9:130977916-130977938 AGGAAGCTGGTGCCAGGAGGTGG + Intergenic
1061538850 9:131266511-131266533 AGGAAGTGGGGGGGAGGAGGAGG - Intronic
1061754723 9:132804516-132804538 GGGATGCGGGAGGCAGGGGAAGG - Intronic
1061852208 9:133422868-133422890 GGGAGACAGGAGGCAGGAGGTGG - Intronic
1061874103 9:133535370-133535392 GGGAGGTGGGGGGCAGGCGGCGG + Intronic
1061927910 9:133815183-133815205 GGGAAGAGGGAGGCGGGCGGGGG - Intronic
1061942644 9:133891659-133891681 GGGAAGCGGGAGGGATGAAGAGG + Intronic
1062045303 9:134422150-134422172 GGGAAGTGTGTCCCAGGAGGGGG - Intronic
1062045310 9:134422170-134422192 GGGAAGTGTGTCCCAGGAGGGGG - Intronic
1062050555 9:134444535-134444557 GGGAGGGGGATGGAAGGAGGGGG - Intergenic
1062165346 9:135104805-135104827 GAGGAGCAGGAGGCAGGAGGTGG - Intronic
1062191768 9:135251507-135251529 GGGAGGTGGGTGACAGCAGGGGG + Intergenic
1062280023 9:135747643-135747665 GAGAGGCGTGGGGCAGGAGGAGG + Intronic
1062339009 9:136085603-136085625 GGGAGGCGGCTGCCAGGGGGTGG + Intronic
1062381309 9:136288145-136288167 GGGAAGGGGGTGGCATGGCGGGG + Intronic
1062443956 9:136585610-136585632 GGGCAGAGGGTGGCTGGAGCTGG + Intergenic
1062561943 9:137145605-137145627 GGGACAGGGGTGGGAGGAGGGGG + Intronic
1062577792 9:137216661-137216683 GGGAAGGGGGTGGGGGGACGAGG - Exonic
1062578985 9:137221434-137221456 GGGGAGGGGGAGGCAGGCGGGGG + Intronic
1062698278 9:137886338-137886360 GGGGAGGAGGTGGGAGGAGGCGG + Intronic
1062733986 9:138125086-138125108 GGGAGGCACTTGGCAGGAGGAGG + Intergenic
1203564268 Un_KI270744v1:79084-79106 GGGAGGATGGAGGCAGGAGGTGG + Intergenic
1185463144 X:341505-341527 GGCAGGAGGGGGGCAGGAGGAGG - Intronic
1185499356 X:585169-585191 GGGAAGAGGGGGGCAGAGGGTGG + Intergenic
1185751003 X:2609495-2609517 GGGATCCGGGTGGGAGGACGCGG + Intergenic
1185822537 X:3219298-3219320 GGGCAGATGGGGGCAGGAGGGGG + Intergenic
1185918886 X:4066929-4066951 GGGTGGAGGGTGGGAGGAGGGGG + Intergenic
1185993084 X:4913571-4913593 GGGAAGTGTGTGGTAGGAGATGG + Intergenic
1186414770 X:9373516-9373538 ACGAAGGGGGTGGCAGGCGGAGG + Intergenic
1186613222 X:11159157-11159179 AGGAGGCGGGTGGTAGGAAGGGG + Intronic
1186696076 X:12033617-12033639 GGCAAGCAGGTGGGAAGAGGAGG + Intergenic
1187045985 X:15647549-15647571 GGGAAGGGGGAGGGAGGAGCGGG + Intronic
1187051964 X:15703851-15703873 GGGAAGGGGGAGGGAGGAGCGGG + Intronic
1187299271 X:18031953-18031975 GGGAAGCAGGAGGCAGGAAGAGG + Intergenic
1187695641 X:21917036-21917058 GGGAAGCGGGAGGTAGGTGAGGG - Intergenic
1187854412 X:23623202-23623224 GGGAGGAGGGTGAAAGGAGGAGG - Intergenic
1188008640 X:25036185-25036207 GGGAAGAGCGTTGCAGGTGGAGG + Intergenic
1188238115 X:27753682-27753704 GGGAACAAGGTGGCAGGGGGTGG + Intergenic
1188811065 X:34655436-34655458 GGGAACTGGTTGGCAGCAGGAGG - Intronic
1188828944 X:34872561-34872583 GGGTAGAGTGTGGGAGGAGGGGG + Intergenic
1189168311 X:38883765-38883787 GGAAGGAGGGTGGGAGGAGGGGG - Intergenic
1189909339 X:45794395-45794417 GGGAACTGTGTGGCTGGAGGTGG + Intergenic
1190566164 X:51732383-51732405 GGCAAGCGGGTGCCAGGCTGGGG - Intergenic
1190936713 X:55004404-55004426 GGGAGGTGAGTGGCAGAAGGTGG + Intronic
1191135814 X:57063744-57063766 GGGAAGTGGGTTACAGGATGAGG - Intergenic
1193102987 X:77636834-77636856 AGGAAGGAGGTGGAAGGAGGAGG + Intronic
1193261355 X:79410320-79410342 GGGAAGCTGGTGGTTGGGGGCGG - Intergenic
1193362089 X:80590742-80590764 GGCAGGCGGGTGGGAGGTGGAGG - Intergenic
1194880941 X:99251635-99251657 GGGTAGTAGGTTGCAGGAGGGGG - Intergenic
1195009700 X:100723473-100723495 GGGAGGCGGCTGGGAGGTGGAGG - Intronic
1195345630 X:103948038-103948060 GGGGAGCGGGGGGCAAGGGGAGG + Intronic
1195688307 X:107604276-107604298 GGGAGGGGGGTGGGGGGAGGGGG + Exonic
1196419541 X:115507962-115507984 GGGCAGCGGGTGGCAGGGAGGGG - Intergenic
1196685060 X:118503829-118503851 GGGAAGTGGGAGGCAGGGTGTGG + Intronic
1196731086 X:118942223-118942245 GGGAAGAAGGAGGAAGGAGGAGG + Intergenic
1197626246 X:128805201-128805223 GAAAAGCTGGTGGCAGGATGGGG + Intergenic
1197655621 X:129113178-129113200 GGGAAGAGGGTATCAGGATGAGG - Intergenic
1197753251 X:129979914-129979936 GGGAAGTGGGGGGCCGGGGGAGG + Intergenic
1197753368 X:129980305-129980327 GCGAAGCGGGAGGAGGGAGGTGG - Intergenic
1199765115 X:150935840-150935862 GGGAGACAGCTGGCAGGAGGGGG + Intergenic
1200057777 X:153470647-153470669 GGGAAGGGGGTGGGCGCAGGCGG - Intronic
1200058193 X:153472440-153472462 GGGTGGTGGGTGGCAGGTGGTGG - Intronic
1200133202 X:153862526-153862548 GGGGACCGGGTGGTAGGAAGGGG + Exonic
1200146102 X:153927122-153927144 GGAAGGCGGGAGGCGGGAGGCGG + Intronic
1200223331 X:154402914-154402936 GGGATGGGGCTGGCATGAGGAGG - Intronic
1200256586 X:154585816-154585838 TGGGAGCGGGTGGCGGGAGGTGG + Intronic
1200261183 X:154618587-154618609 TGGGAGCGGGTGGCGGGAGGTGG - Intronic
1201184055 Y:11380666-11380688 GGGTGGAGGGTGGAAGGAGGGGG + Intergenic