ID: 912698896

View in Genome Browser
Species Human (GRCh38)
Location 1:111861577-111861599
Sequence GGTGGCAGGAGGGGGCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 530}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698879_912698896 24 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698887_912698896 -1 Left 912698887 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698881_912698896 18 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698884_912698896 6 Left 912698884 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698882_912698896 17 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530
912698880_912698896 23 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG 0: 1
1: 0
2: 5
3: 60
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698896 Original CRISPR GGTGGCAGGAGGGGGCCCAC CGG Intronic
900143976 1:1150122-1150144 GGTGGGAGGTGGTGGCCCAGGGG + Intergenic
900233966 1:1577774-1577796 GATGGCAGTAGGAGGCACACAGG + Intergenic
900511504 1:3063102-3063124 GGTGGGAGGAGGGAGACCCCAGG + Intergenic
900594824 1:3475980-3476002 AGTGCAACGAGGGGGCCCACAGG + Exonic
900611706 1:3547028-3547050 GGTGGCTGGGGGGGGGCCAGCGG + Intronic
900621089 1:3588132-3588154 GGGGGCAGGAGGGGGCAGAAGGG + Intronic
900634890 1:3658101-3658123 GGTGGCAGGAAGGGCCCTGCTGG + Intronic
900656814 1:3762705-3762727 GGTGGCAGGTGCGGGCCGCCTGG + Exonic
900662013 1:3789497-3789519 GGAGGCGGGCGGGGCCCCACCGG + Intronic
900707689 1:4090634-4090656 GGTGGCTGCAGGGCACCCACAGG + Intergenic
900717816 1:4156483-4156505 GGAGGCAGGAGGGGGCAGAGGGG + Intergenic
901053430 1:6437375-6437397 AGGGGCTGGTGGGGGCCCACTGG - Intronic
901079642 1:6576708-6576730 GGGAGCAGGAGGGGGGCCCCAGG + Intronic
901442368 1:9286198-9286220 GGTAGCTGGAGGGGGCTCAGCGG - Intergenic
901784692 1:11616930-11616952 GGTGGCACGGGGGGGCCCCAGGG + Intergenic
901872242 1:12144952-12144974 GGAGGCAGGGGGAGGACCACAGG + Intergenic
901924046 1:12554742-12554764 GGTGGCAGCAGGGAGCGCCCAGG + Intergenic
902075026 1:13777615-13777637 GGTGGGAGGAGGAGCCCTACTGG - Intronic
902480853 1:16710789-16710811 AGGGGCTGGTGGGGGCCCACTGG + Intergenic
903179247 1:21597162-21597184 GGAGGCAGGGGGCAGCCCACGGG + Exonic
903421474 1:23220412-23220434 AGAGGTAGCAGGGGGCCCACGGG + Intergenic
903478234 1:23635008-23635030 GGTGGCACGAGAGGTCCCAGTGG + Intronic
903890837 1:26569423-26569445 GTTTGAAGGAGGGAGCCCACGGG + Intronic
904747458 1:32719916-32719938 GGTGGAAGGAGGGTGCACAGTGG + Intergenic
904771031 1:32881521-32881543 GGTGGATGGAGGGGGCCCAAGGG + Intergenic
904841322 1:33373667-33373689 GATGGCAGGAGGGTGACCAGTGG - Intronic
905638792 1:39574839-39574861 CGTGGCAGGAGGGAGGCCAGAGG - Intronic
905793133 1:40800808-40800830 GGGTGCCTGAGGGGGCCCACAGG + Intronic
905827119 1:41034243-41034265 GGTGGGGGGAGGGGCACCACAGG + Intronic
906538077 1:46562984-46563006 GGTGGCATCAGGCGGCTCACTGG - Intronic
907751232 1:57265132-57265154 CATGGGAGGAGGGAGCCCACTGG - Intronic
909784218 1:79590034-79590056 GGTGGCAGGAGCAGTCCCATTGG + Intergenic
910321646 1:85952635-85952657 GCTGGCAGGAGGTAGCCTACGGG - Intronic
912698896 1:111861577-111861599 GGTGGCAGGAGGGGGCCCACCGG + Intronic
913165591 1:116181772-116181794 GGAGGATGGAGGGAGCCCACAGG - Intergenic
915902988 1:159859812-159859834 AGTGGCAGGAGGGGCCTCACTGG - Intronic
915916917 1:159945840-159945862 GGCGGCGGGAAGCGGCCCACCGG - Intergenic
915936605 1:160093362-160093384 GGAGGCAGGAGGGGACACAGAGG + Intronic
916379083 1:164188690-164188712 GGGAGCAGGAGGGGGCCTGCAGG - Intergenic
918099988 1:181364898-181364920 GCTGGCAGGAAGGGGGCCATGGG - Intergenic
918621018 1:186606013-186606035 TGTGGCAGGAGGAGTCCCAAAGG + Intergenic
919896200 1:202011216-202011238 GGTGGCAGCAGGGGGAACAGAGG - Exonic
920111703 1:203591714-203591736 TGTGTCAGGAGGGAGACCACTGG - Intergenic
920299056 1:204977374-204977396 AGTGGCAGTAGGGCACCCACGGG - Intronic
920500323 1:206481306-206481328 GGCGGGAGGAGGGGGCCTTCAGG - Intronic
922471403 1:225879535-225879557 CAAGGCAGGAGGGAGCCCACTGG - Intronic
922566057 1:226602459-226602481 TGAGGCAGGTGGGGTCCCACAGG - Exonic
922806793 1:228394478-228394500 GGTGGCTGGAGGGGTCTCCCAGG + Exonic
923107974 1:230868709-230868731 GGTGGCGGGGGGGGGCCCGGAGG - Intronic
923273938 1:232380366-232380388 AGTAGCAGGATGGGGTCCACAGG + Intergenic
924924951 1:248671366-248671388 GCTGGCAGAAGGGTCCCCACTGG + Intergenic
924924964 1:248671417-248671439 GCTGGCAGGAGGGTCCCCACTGG + Intergenic
924924978 1:248671468-248671490 GCTGGCAGGAGGGTCCCCACTGG + Intergenic
924924993 1:248671519-248671541 GCTGGCAGGAGGGTCCCCACTGG + Intergenic
924925006 1:248671570-248671592 GCTGGCAGGAGGGTCCCCACTGG + Intergenic
924925036 1:248671672-248671694 GCAGGCAGGAGGGTCCCCACTGG + Intergenic
924925066 1:248671774-248671796 GCAGGCAGGAGGGTCCCCACTGG + Intergenic
924925081 1:248671825-248671847 GCTGGCAGGAGGGTCCCCACTGG + Intergenic
924925110 1:248671927-248671949 GCAGGCAGGAGGGTCCCCACTGG + Intergenic
924925140 1:248672029-248672051 GCAGGCAGGAGGGTCCCCACTGG + Intergenic
924925155 1:248672080-248672102 GCTGGCAGGAGGGTCCCCACTGG + Intergenic
1062833725 10:623169-623191 GGTGACAGGAGGGGGCACGGAGG + Intronic
1063309807 10:4941499-4941521 GGAGGCAGGAGTGGGGCCACCGG - Intronic
1063317485 10:5020603-5020625 GGAGGCAGGAGTGGGGCCACCGG + Intronic
1067806654 10:49397551-49397573 GGTGGCAGGCAGGGGCCGGCAGG + Intergenic
1068040383 10:51816831-51816853 GTTGGCTGGAGGGGGTCCAATGG + Intronic
1068651002 10:59522642-59522664 GGTGGCAGGAACAGGGCCACTGG + Intergenic
1069911663 10:71763503-71763525 GGCGGCAGGCTGGGACCCACTGG + Intronic
1072284891 10:93904943-93904965 GCTAGCAGGAGGGGGCCGAATGG - Intronic
1073452369 10:103617478-103617500 GGTGGCAGCAGGGAGACCATGGG + Intronic
1073469614 10:103714592-103714614 GGTGGCAGGAAAATGCCCACAGG - Intronic
1074532310 10:114305862-114305884 GGGTGCAGGAGGGGGCGCAGGGG + Intronic
1074695886 10:116049978-116050000 GGTCGCAGGGGAGAGCCCACAGG + Intergenic
1075090985 10:119444120-119444142 GGAGGGAGCAGGAGGCCCACGGG - Intronic
1075646806 10:124102288-124102310 GGTGGGAGGAGGGGCCTCAGAGG - Intergenic
1075711590 10:124533677-124533699 GGTGGCAGAAGCGGGCCACCTGG - Intronic
1076035289 10:127195255-127195277 GGAGGGAGGAGGGAGCCCGCGGG - Intronic
1076617830 10:131768496-131768518 GGTGATAGGAGGGGGCTCTCTGG + Intergenic
1077024335 11:432624-432646 GGTGGCTTGAGGGGGCTGACGGG - Intronic
1077173419 11:1178358-1178380 GGTGGGAGGAGGCGGCCTAGGGG + Intronic
1077284455 11:1759540-1759562 AGTGGATGGAGGGGACCCACAGG + Exonic
1078765136 11:14289145-14289167 GGAGGCTGTAGGGGGCACACTGG + Intronic
1080565231 11:33503094-33503116 GGTGGCATGAGGGGGACTTCAGG - Intergenic
1080639738 11:34151797-34151819 GGTGGCAGGGGGGGGTCCACAGG + Exonic
1080700559 11:34640537-34640559 GGTGGAAGGAGGGGGGCCCAGGG - Intronic
1081810331 11:45910692-45910714 GCTGGAAGGAGGGTGTCCACTGG - Intronic
1081962448 11:47148348-47148370 GGTGGCTGGAGGGTGTCCTCAGG - Intronic
1082002323 11:47400115-47400137 GGTAGCAGGAGGGGGTCTCCAGG + Intergenic
1082096818 11:48137728-48137750 GGTGGGAGGAGTGGACCCGCAGG + Intronic
1082652646 11:55812439-55812461 AGTGGCAGGCGGGGGTTCACGGG + Intergenic
1082653626 11:55825357-55825379 GGTGGCAGTAGGAGGCCCACGGG + Intergenic
1082782323 11:57297599-57297621 GGTGGGAGGAGGGTGGGCACTGG - Intergenic
1083147330 11:60769101-60769123 CCTGGCAGGAGGGGGCTCAGAGG - Intronic
1083757973 11:64801659-64801681 GGAGGGAGGAGGAGGCCCTCGGG - Intronic
1083778762 11:64907353-64907375 GGGGGCATCAGGTGGCCCACAGG - Exonic
1083954489 11:65976061-65976083 GGTGGCAGGAGGGAGCCTGGAGG + Intronic
1084125546 11:67096689-67096711 GGTGGCTGCAGGGGCCCCATGGG + Intergenic
1084183162 11:67456500-67456522 GCTGGCAGGAGGTGGCCCTTGGG + Intronic
1085308417 11:75501404-75501426 GGTGACATGAGTGGGCACACTGG + Intronic
1085515681 11:77110564-77110586 GCTGGCAGAAGGCTGCCCACAGG - Intronic
1086064525 11:82732455-82732477 CGGGGGAGGAGGGGGCGCACCGG - Exonic
1087012761 11:93529329-93529351 GGAGGAAGGAGGGGCCCCAAAGG + Intronic
1088694577 11:112355854-112355876 GGTGCCAGCAGGGGGCCCTCTGG + Intergenic
1088813508 11:113406801-113406823 GTTGGCAGGAGAGGACCCTCTGG + Intergenic
1088881620 11:113977448-113977470 GGTCGGAGCAGGTGGCCCACGGG - Intronic
1089198695 11:116710601-116710623 GGTGGGTGGAGGGGGCGCAGAGG - Intergenic
1089199332 11:116714401-116714423 TCTGGGAGGAGGGGGCTCACAGG - Intergenic
1089214839 11:116829273-116829295 GGAGGCAGCGGGGGGCACACAGG + Intergenic
1089243093 11:117098330-117098352 GGAGGCAGCAGGCGGCCCGCGGG + Exonic
1089340342 11:117752982-117753004 GGTGGCAGGGGTGGGAGCACGGG + Intronic
1089523458 11:119081161-119081183 GGTGGAAGGAGTGGCCACACAGG - Exonic
1089572054 11:119417560-119417582 GGGGGCAAGAGGGGGACCGCAGG - Exonic
1089613969 11:119684930-119684952 GGAGGCAGGAGGGGGCAGCCTGG - Intronic
1089647334 11:119888934-119888956 GGTGGGAGGATGGGGGCCAGAGG + Intergenic
1089698269 11:120228931-120228953 GCAGGCAGGTGGGGGACCACGGG + Exonic
1090658695 11:128865156-128865178 GTGGGCAGGAAGGGGCCTACTGG - Intronic
1092192936 12:6533660-6533682 GATGGCTGGTGGGGGCCCAGAGG - Intergenic
1092942047 12:13419118-13419140 TGTGGCATGAGTGGCCCCACTGG - Intergenic
1094541038 12:31363408-31363430 GGTGGCAGGCAGGGGTCCAGAGG + Intergenic
1095665590 12:44794053-44794075 GGAGGCAGGAAGGGGACAACGGG - Intronic
1096229414 12:49888964-49888986 GGTGCCAGGAGGGGCCGCACAGG + Intronic
1096387650 12:51205365-51205387 GGTGGCAGGACTGGAGCCACAGG - Intronic
1096576972 12:52558929-52558951 GGTGCCAGGAGGGGGGCTTCTGG - Intergenic
1096594528 12:52686219-52686241 GGTGGCAGGGTGGGGCACTCTGG - Intergenic
1096615909 12:52833602-52833624 GGTGGCTGGAGGCGGCCTTCAGG - Intronic
1096618258 12:52846803-52846825 GGTATGAGGAGGAGGCCCACAGG - Exonic
1097280955 12:57845451-57845473 GGAGGCGCGAGGGGGCCCGCAGG - Intronic
1101371758 12:104137675-104137697 GGCGGGAGGAGGGCGCCCCCGGG + Intronic
1101940109 12:109093548-109093570 GGTGGCACCAGGGGGCCGCCCGG - Intronic
1102124477 12:110469044-110469066 GGTGGCAGCATGGGGCCCCCGGG + Intronic
1103192900 12:119017557-119017579 GGTGGCAGGAGTGGGAGCAGGGG + Intronic
1103339166 12:120212107-120212129 GGAGGGAGGAGGGGGCCCAGAGG + Exonic
1103534775 12:121626859-121626881 GGTGGCGGGGCGGGGCCCCCGGG - Exonic
1103535870 12:121633484-121633506 GGTGGCAGGGGGAGGGCCAGGGG - Intronic
1104275180 12:127320519-127320541 GGTGGATGGAGGGGGTCCTCTGG - Intergenic
1104634345 12:130428201-130428223 GGGGGAAGGAGGCGGCCCAGCGG - Exonic
1104914338 12:132257074-132257096 TGTGGCAGGAGCAGGCTCACTGG - Intronic
1105298976 13:19116606-19116628 AGTGCTAGGAGGGTGCCCACAGG - Intergenic
1105512171 13:21060745-21060767 GGCGGCCGGCGGGGGCCAACAGG + Intronic
1106282320 13:28286546-28286568 TGTGGGAAGAGGGTGCCCACAGG - Intronic
1107990997 13:45819183-45819205 GGTGACAGCAGGGGGCCATCTGG - Intronic
1108577162 13:51800461-51800483 GTTGGCAGGTGGAGGCCCAGAGG + Intronic
1110209847 13:72958618-72958640 GGTCTCAGGAGAGGGGCCACAGG - Intronic
1112416234 13:99205623-99205645 GGAGGCAGGAGGGCAGCCACAGG + Intronic
1113313667 13:109156822-109156844 GGTAGCAGGAGGGGACGCCCAGG - Intronic
1113800854 13:113085655-113085677 GGTGGCAGGAGGGAGCTCCCCGG + Intronic
1113800872 13:113085712-113085734 GGTGGCAGGAGGGAGCTCCCCGG + Intronic
1113800890 13:113085769-113085791 GGTGGCAGGAGGGAGCTCCCCGG + Intronic
1113800909 13:113085826-113085848 GGTGGCAGGAGGGAGCTCCCCGG + Intronic
1113800928 13:113085883-113085905 GGTGGCAGGAGGGAGCTCCCCGG + Intronic
1113903004 13:113806822-113806844 GGTAGAAGGAGGAGGCCCGCAGG + Intronic
1114051413 14:18921773-18921795 AGTGGTAGGAGGGTGCCCGCGGG + Intergenic
1114111148 14:19480152-19480174 AGTGGTAGGAGGGTGCCCGCGGG - Intergenic
1116197674 14:41750786-41750808 GGTGGCAGAAGAGAGCACACAGG + Intronic
1116282637 14:42928500-42928522 GCTGGCAGGAGAGGGCCCTCAGG + Intergenic
1118866878 14:69711271-69711293 GCTGGCTGGAGGGGACCCAGAGG - Exonic
1118942327 14:70349225-70349247 GGTGGCCGGAGGGAGCCCTGGGG - Intronic
1119730340 14:76947290-76947312 GGTGGCAGGCGAGGCCCCGCCGG + Intergenic
1119797200 14:77409381-77409403 GGTGGCAGGAGAGAGCACACAGG - Intronic
1120995977 14:90419113-90419135 TGGGGCAGCAGGGGGCCCTCAGG + Intergenic
1121105502 14:91276853-91276875 GGTGGCAGGAGGTTGTCAACAGG + Intronic
1121275833 14:92666970-92666992 GGTGGGACGTGGGGGCCAACCGG + Intronic
1122080383 14:99263028-99263050 GGTGTCAGGAGGATGTCCACAGG + Intronic
1122267150 14:100552056-100552078 GCTGGGAGGAGGAGGCCCATGGG - Intronic
1122556019 14:102580516-102580538 GGGGGCAGGAGGGAGCCCAAGGG + Intergenic
1122597257 14:102902327-102902349 GGTGGCAGGAAAGGGCCCCAAGG - Intronic
1122748549 14:103915828-103915850 GGTGGGAGGAGGGGGCCCTGGGG - Intronic
1122858614 14:104572142-104572164 GGTGGCAGGAGGGCTCCCAGAGG - Intronic
1122972570 14:105158368-105158390 GGTGGCAGGAGGGGCCCTTGCGG + Intronic
1123007789 14:105332761-105332783 GGGGGCAGGAGAGGGACCAGAGG - Intronic
1123043251 14:105499228-105499250 GGTGGCAGGGGGAGGGCCAGCGG - Intronic
1123085856 14:105717246-105717268 GGAGGCTGGTGGGGGCCCCCAGG - Intergenic
1202854598 14_GL000225v1_random:42797-42819 GGTGTCAGGAGGGGCAACACGGG - Intergenic
1123684411 15:22786896-22786918 GGTCGCAGGTGGGGGCGCCCGGG + Intronic
1126023737 15:44426829-44426851 GGTCGCAGGTGGGAGCCCACTGG + Intergenic
1126315448 15:47364740-47364762 GGTGGCAGTAGGGGGACGAGGGG - Intronic
1127353029 15:58171481-58171503 GGAGGGAGGAGGGGGCACACAGG - Intronic
1128337467 15:66796492-66796514 GGGGGCACTAGGGAGCCCACTGG - Intergenic
1128455168 15:67827909-67827931 GGTGGCGGAAGGGGGTCCAGTGG - Intronic
1128569823 15:68726087-68726109 GGTGGTAGGCGGGGGTCCTCAGG - Exonic
1129295771 15:74599279-74599301 GATCCCGGGAGGGGGCCCACTGG + Intronic
1129600363 15:76995040-76995062 GGTGGCAGGCGGGGCTGCACAGG + Intronic
1130233320 15:82113118-82113140 GGTGGGAGGAGGGGGCAGAGAGG - Intergenic
1132263940 15:100449499-100449521 GGTGGCAGCAGTGGGCCAAATGG - Intronic
1132344727 15:101101304-101101326 AGGGGCAGGAGGGGGACCCCAGG - Intergenic
1132515994 16:366342-366364 GGTGGCAGGATGGGGTGAACTGG - Intergenic
1132601306 16:774395-774417 GGAGGTAGGAGGGGGCCCCGGGG - Exonic
1132604231 16:787053-787075 TGTGGCAGGCAGGGACCCACCGG - Intronic
1132654682 16:1036859-1036881 GATGGCAGGTGGGGCCCCACGGG - Intergenic
1132668174 16:1091235-1091257 GGGGGCAGGAGAGCCCCCACAGG - Intronic
1132769173 16:1551448-1551470 GGTGGCAGAAGGGCGGCCGCAGG + Intronic
1132877512 16:2146946-2146968 GCTGGCAGGACGGGGTCCACTGG + Intronic
1132937375 16:2488009-2488031 CGGGGCAGGAGGGGCCCCAGCGG - Intronic
1132951922 16:2567663-2567685 GGTGCCAAGAGAGGCCCCACAGG - Intronic
1132962428 16:2632507-2632529 GGTGCCAAGAGAGGCCCCACAGG + Intergenic
1134633745 16:15776818-15776840 GGTGGCAGGAGGGAGAGCAGAGG + Intronic
1135758655 16:25118682-25118704 GGGGGCAGGAGTGAGCCCTCTGG + Intronic
1135986778 16:27189854-27189876 GGTGGCAGCAGGAGGCAGACAGG + Intergenic
1135988595 16:27203125-27203147 GGTGGCAGGAGTGTGTCCCCTGG + Intergenic
1136102140 16:28004102-28004124 GGGGGCAGGAGAGAGCCCACAGG + Intronic
1136479130 16:30530786-30530808 GGTGACAGGTGAGGGCGCACAGG + Intronic
1136710654 16:32234197-32234219 GGTGGGAGATGGGGACCCACTGG - Intergenic
1136757257 16:32695214-32695236 GGTGGGAGATGGGGACCCACTGG + Intergenic
1136810851 16:33175161-33175183 GGTGGGAGATGGGGACCCACTGG - Intergenic
1136817327 16:33285241-33285263 GGTGGGAGATGGGGACCCACTGG - Intronic
1136823890 16:33341770-33341792 GGTGGGAGATGGGGACCCACTGG - Intergenic
1137053933 16:35734618-35734640 GCTGGCGGGATGGGTCCCACAGG - Intergenic
1137572333 16:49574998-49575020 GGTGGCAGGAGGGGCTCCATGGG - Intronic
1138267352 16:55669246-55669268 TGTGCCAGGAGGGGGATCACAGG - Intronic
1138433031 16:56981592-56981614 TGTTACAGGAGGGGGCCCAATGG + Intronic
1138738723 16:59281502-59281524 GGTGGCAGCAGTGGGCCAACAGG - Intergenic
1139250643 16:65492212-65492234 TGTGGCAGGAGGGGCTCCATTGG - Intergenic
1139852890 16:69961521-69961543 GGTGGCAGGAAGGGGCAGCCTGG + Intronic
1139881861 16:70184429-70184451 GGTGGCAGGAAGGGGCAGCCTGG + Intronic
1139911986 16:70403202-70403224 GGTACAAGGAGGGGGCCCATGGG + Intronic
1140370649 16:74411077-74411099 GGTGGCAGGAAGGGGCAGCCTGG - Intronic
1140978260 16:80081763-80081785 GGTGGAAGGAGGGGACACAAAGG + Intergenic
1141177907 16:81732826-81732848 GGCAGCGGGAGGTGGCCCACAGG - Intergenic
1141613502 16:85197251-85197273 AGTGGACGGAGGGGGCTCACTGG - Intergenic
1141697816 16:85628380-85628402 TGGGGCTGGAGGGGGCCCATGGG + Intronic
1142401167 16:89859407-89859429 GGTGGAGGGATGGTGCCCACAGG - Intronic
1203059407 16_KI270728v1_random:955565-955587 GGTGGGAGATGGGGACCCACTGG + Intergenic
1142564306 17:829616-829638 GTTGGCAGGTGGGGGCCTAGGGG - Intronic
1142688403 17:1591029-1591051 GAGGCCAGGAGGGGGCCCTCGGG + Intronic
1142982072 17:3678143-3678165 GTGGGCGGGAGGGGGCGCACAGG + Intronic
1143473827 17:7192017-7192039 GGTGGGCGGAGGGGGGCCAGCGG + Intronic
1143945902 17:10591815-10591837 GATAGCAGGAAGGGGCACACAGG - Intergenic
1144537314 17:16103529-16103551 AGAGGCTGGAGGGGGCCCACTGG - Intronic
1144601405 17:16617885-16617907 CGTGGCGGGCGGGGGCCCAAGGG + Intergenic
1144708996 17:17388232-17388254 GCAGCCAGGAGGGAGCCCACAGG - Intergenic
1144723048 17:17485541-17485563 GCTGGAAGAAGGGGGCACACAGG + Intronic
1145014474 17:19387475-19387497 GGGGGCGCCAGGGGGCCCACAGG - Intergenic
1145159194 17:20563068-20563090 GGAGGCAGGAGGTGGGCCTCGGG + Intergenic
1147150418 17:38510768-38510790 GCTGGGCGGAGGGGGCCCCCCGG + Exonic
1147217261 17:38908170-38908192 GGTGCCAGCAGGGGGCCTGCAGG - Intronic
1147360128 17:39925119-39925141 GGGGGCAGGAGGGAGGCCACAGG - Intronic
1147403607 17:40195322-40195344 GGGAGCAGAAGGGGGCCCATGGG - Exonic
1148027426 17:44598434-44598456 GGTGGGAGGAGTTTGCCCACAGG - Intergenic
1148127024 17:45242232-45242254 GGAGGCAGCAGGAGGCCCCCAGG - Intronic
1148555481 17:48576632-48576654 GGGGACAGGAGGGGGCCCTGGGG - Exonic
1148612550 17:48973992-48974014 AGGGGCAGGAGGGGGCGCAAGGG - Intergenic
1149916416 17:60613884-60613906 GGTGGCGGGGGGGGGGCCTCAGG - Intronic
1150239646 17:63621857-63621879 GGCGGCTGCAGGGGGCCCTCAGG - Intergenic
1150512790 17:65774507-65774529 GGGGGCAGTGGGGAGCCCACAGG - Intronic
1151541859 17:74768650-74768672 GGTGGCAGCAGGGCGCTCAGAGG - Exonic
1151768047 17:76142129-76142151 GGTGACAGGAGGGAGGCCAGGGG - Intergenic
1152011889 17:77724010-77724032 GGAGGCAGGAGAGGGCACAGTGG - Intergenic
1152115780 17:78386154-78386176 GGTGGCTGGAGCCGGGCCACGGG + Intronic
1152470204 17:80487007-80487029 GGTGGAAGGAGGGGGCCCGGAGG - Intergenic
1152629490 17:81403894-81403916 GGTGGCAGCACGAGCCCCACTGG - Intronic
1152716183 17:81901952-81901974 GGCAGCAGGGGAGGGCCCACGGG - Intronic
1152815306 17:82404322-82404344 GGAGGCAGAAGGGGGCCTGCAGG + Intronic
1154339846 18:13493869-13493891 GGAGGAAGCAGAGGGCCCACGGG - Intronic
1155409491 18:25526872-25526894 GGTAGCAGGAGGGAGTCCTCTGG - Intergenic
1156242432 18:35267185-35267207 AGTGGCAGGAAGGAGCCCATTGG + Intronic
1156350425 18:36297634-36297656 AGGGGAAGGAGGGGGCCCGCCGG + Intergenic
1157209216 18:45727154-45727176 GGGGGCTGGAGCGCGCCCACTGG - Exonic
1157606342 18:48928227-48928249 GAAGGCAGAAGGGGGCCCATGGG - Intronic
1158648825 18:59269161-59269183 GGTTGCAGGCCGGGGCCCAACGG + Exonic
1159005232 18:63004913-63004935 TGTGGCTGGAGTGGGCCCTCTGG + Intergenic
1160514150 18:79469426-79469448 GGTGGGAGGTGGCGGCCCCCAGG + Intronic
1160780718 19:876872-876894 CGTGGCAGGTGGGGGCCCCGTGG - Intronic
1160780735 19:876907-876929 TGTGGCAGGTGGGGGCCCCGTGG - Intronic
1160780743 19:876925-876947 CGTGGCAGGTGGGGGCCCTGTGG - Intronic
1160868278 19:1265721-1265743 GGTGGCGGGGGGGGGCGCGCGGG + Intronic
1160904449 19:1445896-1445918 GGGGGCACGAGAGGTCCCACGGG - Intergenic
1161041052 19:2110978-2111000 AGAGGCAGCAGGGGTCCCACAGG + Intronic
1161080199 19:2306767-2306789 GGTGGCAGGAAGGGGGCAGCCGG - Intronic
1161666173 19:5578344-5578366 CGCGGCAGGAGGGGCCCAACCGG + Intergenic
1161703760 19:5808336-5808358 GCTGGCAGGAGGGGGGTCCCCGG - Intergenic
1161726532 19:5932573-5932595 GGGGGCAGGCAGGGGTCCACGGG - Intronic
1162015956 19:7846587-7846609 GGGAGCAGGTGGGGGCCGACAGG - Exonic
1162033053 19:7925624-7925646 GGCGGCAGGAGGGGGCGAAGCGG - Intronic
1162739543 19:12766177-12766199 GCAGGCAGGAGGCGGCCGACCGG - Exonic
1162769135 19:12938525-12938547 AGTGGCAGGGGCGGGCCCAAGGG + Intergenic
1163220468 19:15914707-15914729 GGTAGCAAGAGGGGTCCCTCAGG - Intronic
1165319557 19:35076877-35076899 GGTGGCAGGAGGGGCCACGAGGG - Intergenic
1165409602 19:35651192-35651214 GGTGTCAGCAGGGGCCCCAGGGG - Intronic
1165775767 19:38403505-38403527 GGTGGCAGGGGGGCCGCCACGGG + Intronic
1165845106 19:38812993-38813015 GCTGGCAGGGGAGGGTCCACAGG + Exonic
1166123577 19:40700348-40700370 GCTGGCTGGAGGGGTCCCCCTGG - Exonic
1166126191 19:40716804-40716826 GGTGGAGGGAGGGGGCCCACTGG + Exonic
1166231637 19:41428236-41428258 GGTGACGGGGTGGGGCCCACGGG + Intronic
1166685341 19:44793246-44793268 GAGGTCAGGAGGGGGCACACAGG - Intronic
1166691058 19:44821324-44821346 GGGGGCAGGAGTGGGACCAGGGG - Exonic
1166745354 19:45139478-45139500 GGCGCCAGGCCGGGGCCCACAGG - Intronic
1166750033 19:45160186-45160208 TGAGGCAGGAGGGAGCACACAGG + Intronic
1166781292 19:45344981-45345003 GGTGGGAGGAGAGGGCCGAGGGG - Intronic
1167000315 19:46741889-46741911 GCTGGCAGGAATGGGCCCCCAGG + Intronic
1167013523 19:46824557-46824579 GGTGGCTGGATGGAGCCCTCAGG - Intergenic
1167040360 19:47020015-47020037 GCTGGCAGGAGGGGGACTTCTGG + Intronic
1167594248 19:50418867-50418889 GGGGGGAGGAGGGTGCCCGCTGG - Intronic
1167609652 19:50500980-50501002 GGTGGCAGGGAGGGGCCCAGGGG + Intergenic
1167621423 19:50563134-50563156 GGAGGCAGGCGGGAGCCCAGGGG - Intronic
1167640821 19:50680406-50680428 GGGGGCACGAGGGAGCCCTCGGG + Intronic
1167743648 19:51339042-51339064 GGAGGCAGCAGGGGCCCCGCCGG + Exonic
926045830 2:9708958-9708980 GGGGGCAGGAGGAGCCACACAGG - Intergenic
926246395 2:11124647-11124669 GGAGGCAGCAGGGGGCACCCTGG - Intergenic
926317769 2:11724188-11724210 GGTTTCAGGAGGGGGCACGCAGG - Intronic
927174027 2:20392756-20392778 GGCTGCAGGAGGGGTGCCACAGG + Intergenic
927210303 2:20635020-20635042 GGTGGGAGGAGTGGGCCCTGAGG + Intronic
927707388 2:25304886-25304908 GATGGGAGGAGGGGGCCTAGGGG - Intronic
927885680 2:26717197-26717219 GGGGGCAGGGCGGGGCCCAGAGG - Intronic
928174017 2:29022083-29022105 GGTGGCAGGAGCGGCCACTCGGG + Intronic
929208572 2:39326834-39326856 GGTGGCAGGAGAGAGCACTCGGG - Intronic
930721932 2:54646366-54646388 GGCGGCTGGAGGAGGCGCACAGG + Exonic
931393178 2:61862289-61862311 GGTGGTGGGGGGGGTCCCACAGG + Intergenic
932300454 2:70663393-70663415 GGAGGCAGGAGGGAGCCCAAGGG + Exonic
932571018 2:72938452-72938474 GCTGGCTGGAGAGGGCCCCCAGG + Intergenic
933714509 2:85350212-85350234 GATGGCATGAGGGGCTCCACTGG + Exonic
934523788 2:95036095-95036117 GATGGCATGAGGGGTCCCTCTGG + Intronic
935294791 2:101639464-101639486 GCGGGAAGGAGTGGGCCCACGGG + Intergenic
935582851 2:104773845-104773867 GGCAGCAGGAAGGGGCCCAGAGG + Intergenic
935717653 2:105953066-105953088 GGTGGCAGCAGGAGACCCAGTGG - Intergenic
936401380 2:112166995-112167017 TGTGGCTGGAGAGGGCCTACTGG + Intronic
936477767 2:112854888-112854910 GGTGGGAGGATGGGCCCCAGAGG + Intergenic
937662185 2:124444131-124444153 GTTGGCAGGAGGTGGCCTCCAGG - Intronic
937993161 2:127675185-127675207 GGTGGCAGGGTGGGGCCCGCGGG + Intronic
937993631 2:127677597-127677619 GGTGGCAGGTGGAGGGGCACGGG + Intronic
938287045 2:130127690-130127712 AGTGGTAGGAGGGTGCCCGCGGG - Intronic
938428548 2:131211180-131211202 AGTGGTAGGAGGGTGCCCGCGGG + Intronic
941735952 2:168977757-168977779 GGTGGCAGGAGAGAGCGCATAGG + Intronic
942097905 2:172550786-172550808 TGTGGCAGGAGGGGGCTTCCAGG - Intergenic
943422233 2:187680456-187680478 GGTGGAAGGAGGGGGAAGACTGG + Intergenic
945045259 2:205776242-205776264 CCTGGCAGGAGGGTGCCCCCTGG - Intronic
945142312 2:206699803-206699825 GGTGGCAGGTCGGGAGCCACAGG + Exonic
946307639 2:218865246-218865268 GCTGGCAGGAGGGTGGCCGCAGG + Intronic
946507133 2:220313889-220313911 GGTGGAGGGAGGGGGCCAAATGG - Intergenic
947564902 2:231187497-231187519 GATGGCATGAGGGGTCCCACAGG + Intergenic
947667965 2:231918944-231918966 GGGGGAGGCAGGGGGCCCACAGG - Intergenic
948179538 2:235968763-235968785 GGTGGCACGAGAGGGCCCTTGGG + Intronic
949000470 2:241610247-241610269 GGAGGCTGGAGGGGGCCGCCCGG - Intronic
1169228746 20:3872899-3872921 GGTGGTGGGAGGGGGCTCATCGG - Exonic
1169392979 20:5205062-5205084 GGGGCCAGGAGGGAGCCCTCTGG + Intergenic
1170289110 20:14747656-14747678 GGTGGAAGGAGGGAGGCCAAGGG + Intronic
1170328171 20:15179148-15179170 GGTGGCATGAAGGGGCTCTCTGG + Intronic
1170410325 20:16082311-16082333 TCTGTCAGGAGTGGGCCCACAGG - Intergenic
1171481834 20:25460417-25460439 GGTGGCAGGCGTGGCCCCAGGGG + Intronic
1172643353 20:36455073-36455095 AGAGGCAGGAGGGGGCAGACTGG - Intronic
1172656434 20:36541349-36541371 GCTGGCAGGCGGGGGCGCTCTGG - Intergenic
1173671251 20:44800579-44800601 ACTGGCAGGAGGGGGCGCTCTGG + Intronic
1173916011 20:46709449-46709471 GATGGCGGGTGGGGGCCCCCGGG + Intergenic
1174222964 20:48972128-48972150 GCTGGCAGGGTGGGGCCCACTGG - Intronic
1174971528 20:55281256-55281278 GGTGGGAGGAGGGGGGGCAGGGG - Intergenic
1175047032 20:56116624-56116646 GCTGGGAGGAGGGGTTCCACAGG + Intergenic
1175077999 20:56392153-56392175 GGTCGCAGGTGGGAGCCGACGGG - Exonic
1175381729 20:58568512-58568534 GGTGGCAGGTGAGGGCTCTCTGG - Intergenic
1175504248 20:59470592-59470614 CGTGGCAGGAGTGTGCCCACAGG - Intergenic
1175889708 20:62310749-62310771 GGAGCCAGGAGGGGCCGCACCGG - Exonic
1176120771 20:63453589-63453611 GGAGGCAGGAGGGGCGCCGCGGG + Intronic
1176157340 20:63628139-63628161 GGGGGCTGGAGGAGGGCCACAGG - Intergenic
1176379332 21:6104006-6104028 GGTGGCCGGAGCTGGCTCACAGG - Intergenic
1177782732 21:25638425-25638447 GGTGGGAGGAGAGGACCCAGGGG - Intergenic
1179253707 21:39697027-39697049 GATGGCAGAGGGGGTCCCACTGG + Intergenic
1179438713 21:41379064-41379086 GGTGGCAGCAGGGAGGCCAGGGG - Intronic
1179744141 21:43434231-43434253 GGTGGCCGGAGCTGGCTCACAGG + Intergenic
1179885570 21:44312899-44312921 GGTGGCAGGAGAGGGGTCTCTGG + Intronic
1179954069 21:44728082-44728104 AGTGGCAGGAAGTGGCCCACAGG + Intergenic
1179980485 21:44893237-44893259 GGGGGCAGGGAGGGGCACACAGG - Intronic
1179994596 21:44968083-44968105 GGGGGGTGGAGGGGCCCCACTGG - Intronic
1180064646 21:45406110-45406132 GGAGGCAGGAAGGTCCCCACGGG - Intronic
1180231138 21:46427363-46427385 TGTGGCATCAGGGTGCCCACAGG + Intronic
1180469886 22:15644148-15644170 AGTGGTAGGAGGGTGCCCGCGGG + Intergenic
1180714687 22:17863971-17863993 TGTGGCAAGAGGGGGCCAGCAGG - Intronic
1180928738 22:19574316-19574338 GGTGGCAGGAGTGGGAGCAGAGG + Intergenic
1181020680 22:20100604-20100626 GGTGCCAGGAGAGGGCCCAGCGG + Intronic
1181025417 22:20124734-20124756 GTTGCCAGAAGGGAGCCCACTGG - Intronic
1181050937 22:20237905-20237927 TGTGGCTGGAGGCGGCCCAAAGG + Intergenic
1183066720 22:35368537-35368559 GCTGGCAGGACGGGGCCCCTGGG - Intergenic
1183353111 22:37344493-37344515 GGGGGCAGCAGGGGGGCCTCTGG - Intergenic
1183359520 22:37376172-37376194 AGAGGCAGGAGGGGGCCCAGGGG + Intronic
1183641804 22:39097363-39097385 AGTGGCAGCAGAGGGCCCAGTGG - Intronic
1184060424 22:42078015-42078037 GTTGGCAGAAGAGGGCCCAGGGG + Exonic
1184254873 22:43281075-43281097 GGTGACAGGAGGGTGGCCAAGGG - Intronic
1184254902 22:43281193-43281215 GGTGACAGGAGGGTGGCCAAGGG - Intronic
1184340692 22:43884292-43884314 AGTGCCAGAAGCGGGCCCACCGG + Exonic
1184403993 22:44289661-44289683 GGTGGCAGGCGGGGACGCCCAGG + Intronic
1184649394 22:45912724-45912746 GGGGACAGGAGGGGACCCAGGGG + Intergenic
1184651307 22:45920579-45920601 GGTGGCATCAGGGGCCCCAAGGG + Exonic
1184651788 22:45922663-45922685 GGTGGCAGGAAGGAGCCCCAGGG + Exonic
1184747580 22:46465185-46465207 GGTGGCAGGTGAGGGCCCCTGGG - Intronic
1184790302 22:46695912-46695934 GGAGGCAGGAGAGGGGCCCCAGG + Intronic
1184985661 22:48131681-48131703 TGAGGCAGGAGGGGGACCAGAGG - Intergenic
1185009013 22:48302801-48302823 GCTGGCATGAGGGGACCCTCCGG - Intergenic
1185243038 22:49756516-49756538 GGTGCCTGCATGGGGCCCACAGG - Intergenic
1185349281 22:50326245-50326267 GGTGGAGGGACGGGGCCCATGGG + Intronic
949375274 3:3382079-3382101 GGGGGCAGGAGGGGACTCAGTGG + Intergenic
949404001 3:3695705-3695727 TGTGGCAGGGGGGTGCACACTGG + Intergenic
949611910 3:5711496-5711518 GGTGGCAGGAGGGGGAGAGCAGG + Intergenic
950196906 3:11015684-11015706 GGTGGCAGAAGGAGGCCTTCTGG + Exonic
950565321 3:13766526-13766548 GGTAGCTGGAGGGGGCCGAGTGG + Intergenic
950618074 3:14178403-14178425 GGTGGGCGGAGGAGGCCCAGAGG - Exonic
950723172 3:14898989-14899011 GGTGGCAGGAGGTGGTTCAGAGG - Intronic
952491953 3:33881840-33881862 TGTGGGAGGCGGGGGCCTACCGG + Intergenic
952823548 3:37506046-37506068 TGTGGTAGGAGGTGCCCCACAGG + Exonic
952857460 3:37784084-37784106 TGGGGCAGGAGGGGCTCCACAGG - Intronic
954079812 3:48207035-48207057 GGTGACAGGATGGGTCCCAGAGG + Intergenic
954465819 3:50654179-50654201 GGTGGCAGCAGGGGAGGCACTGG + Intergenic
954635926 3:52070863-52070885 GGTGGCAGGAGAGAGCCGGCAGG + Intergenic
954647481 3:52140439-52140461 GGTGGCAGGAGGGTGCAGAAGGG + Intronic
954698851 3:52441431-52441453 GCTGGGTGGAGGGGCCCCACAGG + Intronic
954791434 3:53136143-53136165 GGCGTCAGAAGGGGGCACACGGG + Intergenic
954923477 3:54212342-54212364 GGTGGCAGGAGGGAGCTTCCAGG + Intronic
955498926 3:59564776-59564798 GTTGGCAGGTGGGGGCCTAATGG - Intergenic
958807047 3:98823910-98823932 GGTGGCAGGATGGGGCTCTTAGG + Intronic
959389750 3:105759438-105759460 GGTGGCAGCAGGAGGCAGACAGG - Intronic
960333609 3:116391591-116391613 GGTGGCAAGGAGGGGCCCAGAGG + Intronic
961551259 3:127671828-127671850 GGTGCCAGGGAGGGGCCCCCTGG - Intronic
962259944 3:133895834-133895856 GCAGGCGGGAGGGGGCCGACTGG - Intronic
963310017 3:143699868-143699890 GGTTGAAGGAGGGGTCACACAGG - Intronic
964177418 3:153840792-153840814 GGTGGAAGGATGGGGTCCTCTGG + Intergenic
964297168 3:155246380-155246402 GGTGGTAGGAGTGGGCCCTGAGG - Intergenic
964476034 3:157098449-157098471 GGTGCCAGGTGAGGTCCCACTGG - Intergenic
964917580 3:161854989-161855011 GGAGGCAGCAGGGAGGCCACGGG - Intergenic
965114962 3:164477420-164477442 GGGGGCAGGAGGGGGCTTCCTGG - Intergenic
965622539 3:170655694-170655716 GGTGGGAGGAGGAGGGCAACTGG - Intronic
966866240 3:184260471-184260493 GGTGGCAGGAGGGCTCGCACTGG - Intronic
967621775 3:191642538-191642560 GGTAGAAGGTGGGGGCTCACAGG - Intergenic
967706447 3:192656539-192656561 GGTGGGAGGAGGGGTGCTACTGG + Intronic
968549121 4:1213429-1213451 GCTGGCAGGAAGGGACCCCCAGG + Intronic
968569998 4:1334297-1334319 GGTGGCAGGTGGGGGCTGCCGGG - Intronic
968611939 4:1561164-1561186 GGCGGCAGGAGGGTGGCCAGTGG + Intergenic
968646264 4:1742211-1742233 TGTGGCAGCAGAGTGCCCACCGG + Intronic
969331228 4:6474358-6474380 GATGGCAGGAGTGGCCCCACTGG + Intronic
969486575 4:7475538-7475560 AGTGGCAGGAGGGGGGCAGCTGG - Intronic
969691156 4:8704935-8704957 GCTGGCAGGAGGGGGCCTGTGGG + Intergenic
971391985 4:26194611-26194633 GGTGATAGGTGGGGGCCTACAGG - Intronic
972245808 4:37244678-37244700 CGTGGGAGGAGGGGGCCGCCAGG - Exonic
972354713 4:38269553-38269575 TGGGTCAGGAGGGGGCCCTCTGG - Intergenic
977809799 4:101346434-101346456 GGTGGTGGGAGGGGGCGCCCGGG - Intronic
979010771 4:115365793-115365815 GATGGCAGCAGGAGGCTCACAGG + Intergenic
982091864 4:151886988-151887010 GCTGGCTGGATTGGGCCCACGGG - Intergenic
984701353 4:182820652-182820674 GGGGCCATGAGGGAGCCCACTGG - Intergenic
984825236 4:183918618-183918640 GTTGGCAGGAGAGAGCCTACTGG - Intronic
985538184 5:475901-475923 GGTGGCTGGAGGGTCCCCAGAGG + Intronic
985673339 5:1217683-1217705 GCAGGCAGGAGGGGCCCAACAGG + Intronic
985783665 5:1883383-1883405 AGTGGCAGGAAGGGGCTCGCAGG + Intronic
986233519 5:5887057-5887079 GGAGGCGGGAGCGGGCACACGGG - Intergenic
986430300 5:7674366-7674388 GGTGCGGGGAGGGCGCCCACAGG + Intronic
987332168 5:16866928-16866950 GCTGGCAGGAGGGGACCACCTGG - Intronic
991587484 5:68215562-68215584 GGTGGCAGGAAGGGTCCGCCAGG + Intergenic
996262459 5:121490469-121490491 GGTGGGAGGAGGGGGCCACGGGG - Intergenic
996823262 5:127653949-127653971 GGTGTGAACAGGGGGCCCACTGG - Intronic
997200244 5:132005680-132005702 GTGGGCAGGAGGAGTCCCACGGG + Intronic
997530572 5:134579054-134579076 GGTGGCCGGAGCCGGCCCAAAGG - Exonic
998095689 5:139394536-139394558 GGCGGCAGGACTTGGCCCACGGG + Exonic
998483732 5:142484213-142484235 GGTGGGAAGAGGGGGCACAGAGG + Intergenic
998532587 5:142899635-142899657 GGGGGCAGGATGAAGCCCACGGG - Intronic
999175700 5:149630374-149630396 GGTGGCAGGGGGTGTACCACAGG + Intronic
999249900 5:150176386-150176408 TTTGGCAGGAGGGGGCTCAGGGG - Intronic
1000303798 5:159977740-159977762 GGGGTGAGGAGGGGGCACACAGG + Intergenic
1001241637 5:170075887-170075909 GGTGCCAGGCTGAGGCCCACCGG + Intronic
1001601911 5:172934455-172934477 GGTGGCAGGGCGGGGCCTTCTGG + Intronic
1001617653 5:173056298-173056320 GGAGGGAGGCGGGGGCCCGCCGG - Intergenic
1001963087 5:175892389-175892411 GGAGGCAGGAGAGGGAACACTGG - Intergenic
1002259683 5:177984616-177984638 GGGTGCAGGAGGGGCCCCGCGGG + Intergenic
1002314516 5:178334396-178334418 GTGGGCAGGAAGGGGGCCACCGG + Intronic
1002365045 5:178703239-178703261 GGTGTGCGGAGGGCGCCCACGGG + Intergenic
1003673638 6:8182455-8182477 GGAAGCTGGAGGGGGCTCACTGG + Intergenic
1005927056 6:30452878-30452900 TGCAGCAGGAGGGGGCCCGCTGG - Intergenic
1005930578 6:30481285-30481307 TGCGGCAGGAGGGGGCGCACGGG - Intergenic
1005962550 6:30704314-30704336 GGTGGTAGGATGGGGCTCAGGGG + Exonic
1006022077 6:31123213-31123235 GGTGGCAGGATGGGGTGGACAGG - Intronic
1006375652 6:33670451-33670473 GGTGGCAGAAGGAGGCGCGCAGG - Exonic
1006397136 6:33794917-33794939 GGAGGGAGGAGGGGGCACAAGGG + Intronic
1006407748 6:33855180-33855202 GAGGGCAGGAAGGAGCCCACAGG - Intergenic
1006442663 6:34061861-34061883 GGTGGCAGCAGGGTGGGCACCGG - Intronic
1006509884 6:34515953-34515975 GGGGGCTGGAGGGGGCCCACAGG + Intronic
1007790728 6:44306687-44306709 GGTGGCAGAAGGGGGTCCTGAGG + Intronic
1008065939 6:47048207-47048229 GCTGGCCAGATGGGGCCCACAGG - Intergenic
1008418110 6:51266788-51266810 GGTGCCTGGTGGGGGACCACAGG + Intergenic
1010340625 6:74747984-74748006 GGTGGCAGAAGGGGTCCCCAGGG - Intergenic
1010560002 6:77337635-77337657 GGAAGCAGGAGGGGGCTTACAGG - Intergenic
1015717864 6:136210662-136210684 GGTGGAAGGAGGGGGCCGTGGGG + Intergenic
1018021190 6:159763208-159763230 GCTGGAAGAAGGGGGCCAACAGG - Intronic
1018395788 6:163377169-163377191 GTGGGCAGGAGGTGGCCCAAGGG - Intergenic
1018655505 6:166031477-166031499 GGTGGCAGGATGTGGCCCAGGGG + Intergenic
1018815053 6:167324390-167324412 GCTGGAAGGAGGGGTCCAACTGG + Intergenic
1019287176 7:229456-229478 GCAGGCAGGAGGGGCCCCATTGG - Exonic
1019298195 7:290001-290023 GGGGGCAGGCGGGGGACCCCAGG + Intergenic
1019305615 7:333013-333035 GGTGGGAGGAGGGGGCTCCAGGG - Intergenic
1019381731 7:727491-727513 GGTGGGAGGAGGGGGCCGGGCGG - Intronic
1019577931 7:1746491-1746513 GCTGGCACGAGGGGGCCCGGCGG - Exonic
1019629861 7:2043292-2043314 GCTGTCAGGAGGGGAACCACAGG - Intronic
1021247627 7:18283240-18283262 GGTGGCAGGAGGGAGCAAAGGGG + Intronic
1022610604 7:31867673-31867695 GGTGGCAGCAGTGGGCCAAGTGG - Intronic
1023082915 7:36542490-36542512 GGGGGCAGAAAGGGGCCCCCAGG + Intronic
1023835482 7:44065048-44065070 GGAGTCGGGTGGGGGCCCACTGG - Intronic
1023867591 7:44245605-44245627 TCTGGGAGGAGGGGGCCCCCAGG - Intronic
1023892886 7:44406154-44406176 GGTGGCAGAAGGCTGCCCACTGG + Intronic
1024318292 7:48041517-48041539 CAGGGCAGGAGGGGGCTCACCGG - Exonic
1026159290 7:67854435-67854457 GGCGGCAGGAGGAGGCTCTCAGG + Intergenic
1026253262 7:68689317-68689339 GGTTGTAGGAGGGGACCAACTGG + Intergenic
1026573642 7:71554084-71554106 GGGGACAGGAGGGTACCCACTGG - Intronic
1026740314 7:72975065-72975087 GGTGGCAGGGTGAGGCCCCCAGG + Intergenic
1026797621 7:73376574-73376596 GGTGGCAGGGTGAGGCCCCCAGG + Intergenic
1027103417 7:75390005-75390027 GGTGGCAGGGTGAGGCCCCCAGG - Intergenic
1029138890 7:98395496-98395518 GGTGGCACGAGGGGGACTTCAGG + Intronic
1029707715 7:102284601-102284623 CCTGGCAGGCGGGGGCCCATGGG - Intergenic
1030490964 7:110233952-110233974 GCTTGCAGGAGGTGGCCCATAGG + Intergenic
1031749291 7:125550819-125550841 GGTTGCAGGAGGGGACCAAACGG + Intergenic
1032284714 7:130531533-130531555 GGTGGCAGGGAGGGGCACAAAGG + Intronic
1032395493 7:131586455-131586477 AGAGGCAGGAGGGGGCCCTTTGG + Intergenic
1034498435 7:151435499-151435521 GAGGGCAGGAGGGGGCACACAGG + Intronic
1035171465 7:157019572-157019594 GCTGGCAGGAGTGAGCCCATCGG + Intergenic
1035567085 8:648640-648662 GGTGCCAGGCCGGTGCCCACAGG - Intronic
1035625328 8:1066937-1066959 GGTCGCAGCAGGCGGCCCAGTGG + Intergenic
1036626301 8:10475034-10475056 GGTGACAGTAGGGGGGCCTCTGG - Intergenic
1036727395 8:11231927-11231949 GGTGGAAGGTGTGGGGCCACTGG - Intergenic
1037046114 8:14305883-14305905 GGTGGCAGAATGGTGCCCAGCGG - Intronic
1037827596 8:22168518-22168540 GGTGGTAGCAGGGGCCTCACTGG - Intronic
1037852794 8:22346396-22346418 GGAGGAAGGATGGGGCCCAGGGG - Intronic
1038306925 8:26413349-26413371 AGTGGCAGGAGGGCGCTCACGGG + Intronic
1038428304 8:27479659-27479681 GGTGGGGGGAGGGGTCTCACAGG - Intronic
1038454432 8:27663393-27663415 GGTAGCAGGAGCGGGACCCCTGG + Intronic
1038840230 8:31177814-31177836 GGTGCAGGGAGGGGGCCCACTGG + Intergenic
1039476672 8:37842463-37842485 GATGGCTGGAGGAAGCCCACAGG + Exonic
1039735775 8:40330957-40330979 GGTGAAAGGAAGAGGCCCACAGG - Intergenic
1039786813 8:40841375-40841397 GGTGGCAGGGGGGCGGCCTCTGG - Intronic
1039804587 8:40987387-40987409 GGAGTCAGGAGGGGACCCTCAGG - Intergenic
1043396241 8:79840587-79840609 GTTGGCAGGTAGGGGCACACAGG + Intergenic
1044857929 8:96494664-96494686 GGTGGCAGGAGGGGGGAGCCTGG + Intronic
1045040423 8:98218842-98218864 TGTGGCTGGAGGGGGCTCACTGG + Intronic
1045040552 8:98219798-98219820 TGTGGCTGGAGGGGGCTCACCGG - Intronic
1045524457 8:102929957-102929979 GCTTGGAGGAGGGGCCCCACGGG + Intronic
1046806127 8:118480825-118480847 GGTGGCATGAAGGGGCCTTCAGG - Intronic
1048209676 8:132444257-132444279 GAGGGCAGGAGGGAGCACACAGG - Intronic
1048878735 8:138856782-138856804 GCTGGCAGGAAGGGACCCACTGG - Intronic
1048981179 8:139703938-139703960 GGCGGCGGGAGGGGTCCCGCGGG + Intergenic
1049202138 8:141345656-141345678 GGTGGCAGCAGGTGGCCTGCGGG + Intergenic
1049410346 8:142471208-142471230 GATGGCAGGATGGGGCCCCATGG + Intronic
1049522675 8:143102275-143102297 GGTGACAGGACAGGACCCACAGG - Intergenic
1049691942 8:143965377-143965399 GGTGGAAGGAGGGTGCCAGCTGG - Intronic
1049733790 8:144192628-144192650 GGTGGCAGGAGTGGGTGCCCAGG + Intronic
1049851847 8:144836814-144836836 GGTGCCAGGTGGGCCCCCACAGG + Intronic
1050628741 9:7536571-7536593 GGTGGCAGCAGGAGGCTCAGCGG + Intergenic
1050690869 9:8224801-8224823 GGAGGCAGGAGGAGGCCCCATGG - Intergenic
1051604498 9:18906856-18906878 GTTGGCAGGCCGGGGCCCCCAGG - Exonic
1053148322 9:35727083-35727105 GGAGGCAGCAGGTGGCGCACAGG + Intronic
1054527846 9:66152612-66152634 GGGGGTGGGAGGGGGCCCCCAGG - Intronic
1056430013 9:86518111-86518133 GGTGGCAGGAGGGAGAGCGCTGG + Intergenic
1057220834 9:93257017-93257039 GGTGGCAGGTGGGGGGGAACCGG - Exonic
1057439259 9:95070770-95070792 AGTGGCCGGTGGGGGCACACTGG + Intronic
1057553169 9:96066904-96066926 GGTGGCAGGAAGGAGGGCACCGG - Intergenic
1057563743 9:96149954-96149976 GGCGTCAGGAAGGGTCCCACTGG - Intergenic
1058467705 9:105245157-105245179 ACTGGGAGGAGGGGGCCGACTGG - Intronic
1059345099 9:113623065-113623087 GGTGGCATCAGGGGGCCCAGTGG - Intergenic
1060537415 9:124401589-124401611 GAGGGCAGGAGGGGACCCAAGGG - Intronic
1060656153 9:125374147-125374169 GGAGGCAGGAGGGGGCACCTGGG - Intergenic
1061034080 9:128103764-128103786 GGTGGCAGGAGGTGGGGCAGGGG + Exonic
1061237811 9:129352379-129352401 GGGGGCGGGAGGGGGCTCCCTGG + Intergenic
1061290931 9:129649890-129649912 AGTGGCTGGAGGGGCCCCAGCGG - Intergenic
1061682472 9:132249878-132249900 GGTGGCAGCGAGGGGCCCACCGG - Intergenic
1061713440 9:132503395-132503417 GGTGGCAGGAGAGGGGCCCTGGG + Intronic
1061801179 9:133114138-133114160 GCTGGCAGAAGAGGGCCCCCCGG - Intronic
1061902730 9:133681177-133681199 GGTGTCAGGATGGGGCCCACAGG + Intronic
1061908919 9:133712666-133712688 GTGGGCAGGAGCTGGCCCACTGG - Exonic
1062133604 9:134913218-134913240 GGAGGGAGGAGGAGGGCCACAGG + Intronic
1062288729 9:135785259-135785281 GGGGGCAGGGGTGCGCCCACAGG + Intronic
1062291765 9:135798502-135798524 GGAGGCAGGAGGGTGTCCTCAGG - Intergenic
1062370977 9:136238558-136238580 GGTGGGAGGAGGCTGCCCGCCGG - Intronic
1062428125 9:136515445-136515467 GGTGGCCGGCGGGGGGCCAGTGG - Intronic
1062432145 9:136530992-136531014 GGTGGCAGGAAGGGGCTCCCCGG + Intronic
1203760677 EBV:12070-12092 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203761606 EBV:15142-15164 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203762535 EBV:18214-18236 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203763464 EBV:21286-21308 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203764393 EBV:24358-24380 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203765322 EBV:27430-27452 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203766251 EBV:30502-30524 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1203767180 EBV:33574-33596 GGTGGCAGGAGGGGAGCAGCAGG - Intergenic
1186455597 X:9707783-9707805 GGAGGGTGGAGGGGGCCGACTGG - Intronic
1189320868 X:40086443-40086465 GGTGGCGGGAGAAGGCCCACGGG - Intronic
1189322306 X:40094412-40094434 GGTGGGGGTAGGGGGCCCACAGG + Intronic
1192343428 X:70282068-70282090 GCTGCCAGGAGGGGGCCGAGGGG + Intergenic
1192881056 X:75284696-75284718 GGTGGCAGGGGGGGGTGCAGTGG + Intronic
1193136351 X:77975218-77975240 GGTGGCAGGGGGTGGCCAAAAGG - Intronic
1199650916 X:149945489-149945511 GGTTTCAGGAGAGGGCCCAGAGG - Intergenic
1199760250 X:150899128-150899150 GGTGTCTGGAGGGGCCCCAAGGG - Intergenic
1199980517 X:152918014-152918036 GGAGGCAGGAGGGAGCCTGCAGG + Intronic
1200111829 X:153744455-153744477 GGTGGGAGCCGGGGCCCCACGGG - Exonic
1200135801 X:153874011-153874033 GGAGGGAGGAGGGGGCTCCCTGG + Intronic
1200235711 X:154466863-154466885 GGCTCCAGGAGGGGCCCCACCGG - Intronic
1200684136 Y:6245059-6245081 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1200686761 Y:6265377-6265399 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1200989639 Y:9336293-9336315 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1200992308 Y:9356626-9356648 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1200994959 Y:9376904-9376926 GGTGGCAGAAGGAGGGCCAGCGG - Intronic
1200997624 Y:9397250-9397272 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1201000136 Y:9465786-9465808 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1201002795 Y:9486096-9486118 GGTGGCAGAAGGAGGGCCAGCGG - Intronic
1201005451 Y:9506379-9506401 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1201008114 Y:9526709-9526731 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1201010724 Y:9546899-9546921 GGTGGCAGAAGGAGGGCCAGCGG - Intergenic
1201048499 Y:9909327-9909349 GGTGGCAGAAGGAGGGCCAGCGG + Intergenic
1201063479 Y:10068858-10068880 AGTGGCAGGAGGAGGCCCAGCGG - Intergenic