ID: 912698897

View in Genome Browser
Species Human (GRCh38)
Location 1:111861583-111861605
Sequence AGGAGGGGGCCCACCGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912698887_912698897 5 Left 912698887 1:111861555-111861577 CCTGTGTTTACGGAGGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698880_912698897 29 Left 912698880 1:111861531-111861553 CCAGGCCCACTGCAGGACCTTGT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698881_912698897 24 Left 912698881 1:111861536-111861558 CCCACTGCAGGACCTTGTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 248
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698879_912698897 30 Left 912698879 1:111861530-111861552 CCCAGGCCCACTGCAGGACCTTG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698882_912698897 23 Left 912698882 1:111861537-111861559 CCACTGCAGGACCTTGTTCCTGT No data
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267
912698884_912698897 12 Left 912698884 1:111861548-111861570 CCTTGTTCCTGTGTTTACGGAGG No data
Right 912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912698897 Original CRISPR AGGAGGGGGCCCACCGGCAG TGG Intronic
900150677 1:1178038-1178060 ACGAGGAAGCCCACGGGCAGGGG - Intronic
900154845 1:1199766-1199788 AGGAGGGTGCACGCTGGCAGTGG + Intergenic
900763046 1:4485768-4485790 AGGATGGAGCCCACCACCAGGGG - Intergenic
900997236 1:6129215-6129237 GGGAGGGAGCCCAGCTGCAGTGG - Intronic
901201805 1:7471475-7471497 AGGATGGGTGCCACCAGCAGAGG - Intronic
901250035 1:7771218-7771240 AAGAGGGGGCGCGCCGGAAGTGG - Intergenic
901756763 1:11446130-11446152 AGGAGGGGTCCCAGGAGCAGGGG - Intergenic
901811075 1:11766994-11767016 AGGAGGGGGCCCCGAGGGAGCGG + Exonic
902287369 1:15415353-15415375 AGGAGGGGGCACAGAGGCAGGGG - Intronic
902511968 1:16971604-16971626 GGGAGCGGGCCCACCGCCAGAGG + Exonic
902870816 1:19312540-19312562 AGGTGGGGGGCCACTGGCTGCGG - Exonic
903192662 1:21665737-21665759 AGGAGGGTACCCAAGGGCAGTGG - Intronic
903365091 1:22801333-22801355 AGCAGAGGGCCCACAGGAAGGGG - Intronic
904345675 1:29867254-29867276 GGGAGGGGGGCCCCAGGCAGGGG - Intergenic
904822898 1:33256679-33256701 GGGAGCGGGCCCAGCGGCGGCGG + Intronic
905224857 1:36472378-36472400 GGGAGGGGGCCCACCTGGTGAGG + Exonic
907317039 1:53579167-53579189 AGGAAAGGGCCCAAAGGCAGAGG + Intronic
910981302 1:92961761-92961783 GGGAGGGGGCGCCGCGGCAGCGG + Intergenic
911145632 1:94550006-94550028 AGGAGGGAGCTCATCTGCAGAGG - Intergenic
912698897 1:111861583-111861605 AGGAGGGGGCCCACCGGCAGTGG + Intronic
915083161 1:153365920-153365942 AGGAGGGTGGCCACCAGCAGGGG + Intergenic
916379079 1:164188684-164188706 AGGAGGGGGCCTGCAGGGAGGGG - Intergenic
917944437 1:179954777-179954799 AGGAGCGGCGCCAGCGGCAGCGG - Exonic
918099985 1:181364892-181364914 AGGAAGGGGGCCATGGGCAGGGG - Intergenic
919678341 1:200409430-200409452 AGGGGGGGGCTCAGCGGCCGGGG + Exonic
921273364 1:213492022-213492044 GGGAGGGAGCCCACTGACAGTGG - Intergenic
922584815 1:226725653-226725675 AGGAGGGGGCCCCAAAGCAGGGG - Intronic
922979474 1:229813502-229813524 AGGAGTGGGCTGACCTGCAGTGG + Intergenic
923603533 1:235423641-235423663 AGGTGTGGGCCCAAGGGCAGAGG + Intronic
1062961423 10:1576057-1576079 AGGAGGGGGCCCAGGGTCACAGG + Intronic
1063309806 10:4941493-4941515 AGGAGTGGGGCCACCGGCTGTGG - Intronic
1063317486 10:5020609-5020631 AGGAGTGGGGCCACCGGCTGTGG + Intronic
1063375847 10:5553738-5553760 AGGAGGGGGTGCACCTGGAGGGG + Intergenic
1063378223 10:5566786-5566808 AGGAACGGGCCCACATGCAGGGG + Intergenic
1064021739 10:11814584-11814606 AGGAGGCGGCCCATCGGAAAGGG - Intergenic
1064032992 10:11894765-11894787 GGGAGGGGGCCCACCGGAAGTGG + Intergenic
1064712414 10:18140681-18140703 AGGAGGGGACCCGCCGCCGGGGG + Exonic
1069172442 10:65249387-65249409 AGGAGGTGGTACACAGGCAGGGG + Intergenic
1070290648 10:75111463-75111485 AGGCGGGGCCCTACCGGCCGGGG - Intronic
1070647698 10:78212875-78212897 AGGCTGGGGCCCAGAGGCAGAGG + Intergenic
1073466632 10:103698088-103698110 AGGAGAGGTCACACCAGCAGCGG + Intronic
1075090982 10:119444114-119444136 AGCAGGAGGCCCACGGGCAGGGG - Intronic
1075424329 10:122329635-122329657 AGGTGGGGCTCCCCCGGCAGTGG - Intronic
1075856955 10:125637930-125637952 TGGAGGGGGCCCGGCAGCAGGGG - Intronic
1076070607 10:127485315-127485337 AGGATGGGGCCCAGGGACAGAGG - Intergenic
1077138263 11:1012346-1012368 AGCAGTGGGCTCACGGGCAGCGG + Intergenic
1077530584 11:3092959-3092981 TGGAGGAGGCACAGCGGCAGCGG - Exonic
1080766939 11:35305820-35305842 AGGAGGGAGCTCACCGTCATTGG - Intronic
1081869814 11:46378236-46378258 AGGAGGGGCCCCAGAGGGAGAGG - Intronic
1082735055 11:56846107-56846129 GGAAGGGGACCCAGCGGCAGTGG - Intergenic
1084410791 11:69004998-69005020 AGGAGGGGCCCCACCACCTGGGG + Exonic
1084453208 11:69252170-69252192 AGGAGGGTGCCCACTGCCACTGG + Intergenic
1085205611 11:74730570-74730592 AGGAGGGGCACCAAGGGCAGCGG - Intronic
1085314289 11:75535032-75535054 GGGAGGGGACCCACCTGCATGGG - Intergenic
1088522167 11:110712059-110712081 CGGAGGGCGCGCGCCGGCAGTGG + Intronic
1088748284 11:112822673-112822695 GGGAGGGGTCCCTCCTGCAGAGG - Intergenic
1089145924 11:116329698-116329720 AGGGGAGGCCCTACCGGCAGTGG - Intergenic
1090471880 11:126988403-126988425 AGGAGGGGACCCACCGGCCAGGG + Intronic
1091274738 11:134342563-134342585 AGCACGGGGCCCCGCGGCAGGGG - Intronic
1091609717 12:1995621-1995643 AGGAGGGAGCTCAGCTGCAGGGG - Intronic
1091769603 12:3142372-3142394 AGGAGGGGGCCCACACAGAGGGG - Intronic
1091784343 12:3233395-3233417 AGAAGGGTGCCCTCCGCCAGGGG - Intronic
1092042618 12:5397785-5397807 AGGAGGGGGTCTCCAGGCAGAGG - Intergenic
1093176451 12:15918301-15918323 AGGAGGGTATCCACCTGCAGAGG - Intronic
1096102485 12:48978257-48978279 AGGCGGGGGCCACCGGGCAGGGG + Intergenic
1096652940 12:53071056-53071078 AGGAGGGCGGATACCGGCAGGGG - Intronic
1096782323 12:53998441-53998463 AGGAGGGGACCAAACGCCAGGGG - Intronic
1100765862 12:97864895-97864917 AGGAGGTGGCCAACCTGCAGGGG + Intergenic
1102298655 12:111756057-111756079 AGGAGGCGGCCCCCCTGCATGGG - Intronic
1103080081 12:118016895-118016917 AGGAGGAGGCCGAGCGGCGGCGG + Intronic
1103318649 12:120077315-120077337 AGGAGGGGGCACACCACCACAGG - Intronic
1103339167 12:120212113-120212135 AGGAGGGGGCCCAGAGGCTCTGG + Exonic
1103520987 12:121537078-121537100 AGGAGGGGCCTCTCCGGGAGAGG - Intronic
1103613571 12:122138497-122138519 AGGAGGAGGCCCGGCGGCTGCGG + Exonic
1103779675 12:123389936-123389958 AGGAGGGGCCCCACGCCCAGAGG + Intronic
1106046989 13:26151905-26151927 AGGAAGGGGTCCACGGGTAGAGG - Intronic
1108579725 13:51818175-51818197 AGGATGTGGCCGACTGGCAGAGG + Intergenic
1114485054 14:23057333-23057355 AGGAGGGGGCCCGCAGCCTGCGG - Intronic
1114540811 14:23456914-23456936 AGGATGGGGCTGACTGGCAGAGG + Intergenic
1117133270 14:52707080-52707102 AAGACGGGGCCAACCGGAAGGGG + Intergenic
1117909175 14:60619977-60619999 GGGAGGGAGACAACCGGCAGTGG - Intergenic
1119478601 14:74946255-74946277 AGGAGGAGACCCAAGGGCAGGGG - Exonic
1122088958 14:99325560-99325582 TGGAGGAGGCCCACCTGCATTGG + Intergenic
1122548526 14:102538128-102538150 AGCAGGAGCCCCACTGGCAGGGG + Intergenic
1122997155 14:105271486-105271508 GGGAGGGGGACCACCTTCAGAGG + Intronic
1124002641 15:25771688-25771710 AGGAGGAGGCACACAGGAAGAGG - Intronic
1124109210 15:26772114-26772136 AGCTGGGAGCCCACGGGCAGCGG + Intronic
1125887008 15:43236670-43236692 AAGAGTGGGCCCACAGGCTGAGG + Intronic
1127141784 15:55985387-55985409 AGAAGGGTGCCCACTGGCAAGGG + Intronic
1128527463 15:68422236-68422258 TGGAGGTGGCCCTCAGGCAGTGG - Intronic
1129179338 15:73862398-73862420 AGGAGGTGGACCCCAGGCAGGGG + Intergenic
1129265619 15:74391776-74391798 GGGAGGGGGAACACAGGCAGAGG - Intergenic
1130656379 15:85794609-85794631 GGGAGGGGGCCCCGCGGCTGGGG - Intronic
1131250175 15:90825305-90825327 AGGAGGCGGCCGGTCGGCAGCGG + Intergenic
1131640064 15:94283075-94283097 GGGTGGGTGCACACCGGCAGAGG + Intronic
1132501935 16:288372-288394 GGGAGGGGGCGCACATGCAGTGG - Intronic
1132747428 16:1442859-1442881 AGGTGGGCGCCCACCGCCCGTGG - Exonic
1132868946 16:2107059-2107081 GGGAGTGAGCTCACCGGCAGTGG - Intronic
1133149766 16:3818876-3818898 AGGAAGGGGCCCCCCGGAAAGGG + Intronic
1134250158 16:12568687-12568709 AGGTGAGGGGCCAGCGGCAGTGG - Exonic
1136370680 16:29834102-29834124 AGGAGGGGTCCCCACTGCAGGGG + Intronic
1137273712 16:46919585-46919607 AGGAGGGGGCACGGGGGCAGTGG + Intronic
1139911989 16:70403208-70403230 AGGAGGGGGCCCATGGGGAAGGG + Intronic
1142689123 17:1594288-1594310 AAGAGGGGGCCCACCTGAACAGG + Intronic
1142833478 17:2566684-2566706 TGGAAGGGGGCCACCAGCAGAGG + Intergenic
1143539734 17:7561941-7561963 AGCCCCGGGCCCACCGGCAGCGG - Exonic
1144235845 17:13259529-13259551 AGAGGGGGGCCCTCCGGCAGAGG - Intergenic
1146500507 17:33360492-33360514 AGGAGGTGGGCTACAGGCAGAGG - Intronic
1146578221 17:34013151-34013173 AGACGGGGGCCAACTGGCAGTGG + Intronic
1146739118 17:35265795-35265817 AGGAGTAGCCCCACCGGCTGGGG + Exonic
1147393519 17:40123483-40123505 AGGAGGTTGGCCACCGGCAAAGG + Intronic
1147689064 17:42304433-42304455 AGGACGGGGCCCACCCTCGGAGG + Intronic
1148127023 17:45242226-45242248 AGCAGGAGGCCCCCAGGCAGAGG - Intronic
1148612547 17:48973986-48974008 AGGAGGGGGCGCAAGGGTAGGGG - Intergenic
1148791129 17:50173599-50173621 AGGAGGGGGCCCACTGACTGAGG + Intronic
1150107013 17:62469675-62469697 AGGAGGTGGCCCAGAGGCCGAGG + Intronic
1150289358 17:63972719-63972741 AGGAGGAGGCCCGGCTGCAGCGG - Exonic
1150922526 17:69498478-69498500 AGCAGGGGACCCACCTGCATGGG + Intronic
1151947528 17:77327688-77327710 ATGAGGGCGTCCACAGGCAGAGG - Intronic
1151948091 17:77330253-77330275 AGGTGGGGGCCCGCCCCCAGAGG - Intronic
1152161543 17:78671411-78671433 AGGAGGGGGACCCCTGGCTGAGG + Intergenic
1152926173 17:83088774-83088796 TGGAGGGGGCTCATCGGCAGGGG - Intronic
1152944279 17:83190678-83190700 AGGGTGGAGCCCACCGGGAGAGG - Intergenic
1154097658 18:11432725-11432747 CAGAGGGGTCCCACAGGCAGCGG + Intergenic
1159956096 18:74519506-74519528 AGGAGGGGCCCACCAGGCAGGGG + Intronic
1160499675 18:79395667-79395689 AGGGGGGGGCGCACGGGGAGGGG - Intergenic
1160842839 19:1154206-1154228 AGGAGGCTGCCCGCCGGCGGGGG + Exonic
1161041053 19:2110984-2111006 AGCAGGGGTCCCACAGGCACAGG + Intronic
1161101418 19:2423822-2423844 ATGAGAGGGGCCTCCGGCAGGGG + Intronic
1161346118 19:3769646-3769668 AGGAGGGGGCCCTGAGGCATGGG - Exonic
1161428478 19:4217355-4217377 TGGAGGAGGCTCTCCGGCAGCGG + Exonic
1161513208 19:4683086-4683108 AGGAGGAGGCAGACGGGCAGTGG - Intronic
1161531212 19:4791256-4791278 GGCAAGCGGCCCACCGGCAGGGG - Intergenic
1161977702 19:7615510-7615532 AGGAGGTGGGCCCCCGGAAGGGG + Exonic
1162022061 19:7872549-7872571 AGGAGGCGGCCCAGCGCCGGTGG - Exonic
1162739541 19:12766171-12766193 AGGAGGCGGCCGACCGGGAGCGG - Exonic
1162829259 19:13274422-13274444 AGGAGGGAGCCTAGAGGCAGAGG + Intronic
1163152900 19:15425327-15425349 AGGAGGCGGTCCTCCTGCAGGGG + Exonic
1163220465 19:15914701-15914723 AAGAGGGGTCCCTCAGGCAGGGG - Intronic
1163650701 19:18516077-18516099 AGGGGGGTGCCCACCGGGAAGGG + Intronic
1165426154 19:35746541-35746563 AGGAGGGAGGCCAGTGGCAGGGG + Intronic
1165772086 19:38385868-38385890 AGCGGGGGAGCCACCGGCAGCGG + Exonic
1165806672 19:38584669-38584691 AGGATGGGGGGCACAGGCAGAGG - Intronic
1166676628 19:44745309-44745331 TGGAGGGCCCCCACCCGCAGGGG - Intergenic
1166685339 19:44793240-44793262 AGGAGGGGGCACACAGGCCAGGG - Intronic
1167102967 19:47415410-47415432 AGCTGGGGGCCAACAGGCAGAGG - Intronic
1167147539 19:47692063-47692085 GGGAGGTGGCCCACATGCAGCGG - Intronic
1168343929 19:55641362-55641384 AGGAGGGGCCCCAGGGCCAGGGG + Intronic
1168697005 19:58409190-58409212 ATGAGGGGGCCCACCAGGTGGGG + Intronic
927216571 2:20670840-20670862 CGGAGGGGGCTCTGCGGCAGAGG + Exonic
927854038 2:26516827-26516849 AGGAGTGGAACCACCAGCAGCGG - Intronic
927896539 2:26786271-26786293 AGGAGGGGCCCCGCCGGGAGGGG - Exonic
929081794 2:38128730-38128752 AGGAGAGGGCCCAGAAGCAGAGG + Intergenic
932196644 2:69789666-69789688 AGGAGGGGGCTCATGAGCAGAGG + Intronic
932201260 2:69830110-69830132 AGGAGGGGGACGAGCAGCAGCGG + Exonic
932624116 2:73284420-73284442 AGGAGGGGGCGCGCGGGCCGAGG + Exonic
934564296 2:95329958-95329980 GGGAGAGGGGCCTCCGGCAGAGG - Intronic
935570602 2:104656886-104656908 CGGCGGGCGCCCACCGGCATTGG - Intergenic
936370530 2:111898754-111898776 AGGAAGAGGCCCAGCAGCAGCGG - Exonic
937261031 2:120586982-120587004 AGAAGGGGGCCGACAGGAAGAGG - Intergenic
938070239 2:128304586-128304608 GAGAGGGGACCCACGGGCAGAGG - Intronic
938683033 2:133711578-133711600 GGGAGGGGGGCCGCAGGCAGTGG - Intergenic
938954085 2:136282579-136282601 AGGAGGGGGCCGCCCAGCACTGG - Intergenic
941779476 2:169428420-169428442 AGGAGGGGGCCCAACGGATCTGG + Intergenic
945850017 2:214994203-214994225 GGAAGGGGGCCCACCGAGAGCGG + Intronic
946405454 2:219489762-219489784 AGGAGGGGGCTCAGGGGCTGGGG - Exonic
947749773 2:232526103-232526125 AGGAGGGGGTCAACGGGAAGAGG - Intronic
948516830 2:238509474-238509496 AGGAAGGGGGCCACATGCAGAGG - Intergenic
948610467 2:239163390-239163412 GGGAGTGGGCCCCCCTGCAGAGG - Intronic
948709230 2:239815187-239815209 AGGAGGGAGGCCAGCTGCAGTGG - Intergenic
1168790656 20:573690-573712 AGGAGGGAGCCCACCTGCCCAGG + Intergenic
1169432077 20:5545533-5545555 AGGAGAGGGCTCCCAGGCAGAGG + Exonic
1169853756 20:10080939-10080961 AGCATGGGGCCCACTGGCACTGG + Intergenic
1171134468 20:22684358-22684380 AGGAAGGGGGACACTGGCAGTGG + Intergenic
1171486828 20:25491429-25491451 GGGAGCAGGCCCACAGGCAGAGG - Exonic
1172151387 20:32792803-32792825 AGAAGTGGTCCCACCAGCAGAGG - Intronic
1173312963 20:41916829-41916851 AGGAGGAAGCACACCGGGAGAGG - Intergenic
1174111689 20:48201844-48201866 AGGAGGGGGCCCACCTGAGCTGG - Intergenic
1174142536 20:48425902-48425924 GGGAGGGGGCAGACCAGCAGGGG - Intergenic
1175390410 20:58623923-58623945 AGGATGGGGCGCTCAGGCAGAGG - Intergenic
1175883536 20:62274419-62274441 ATGACGGGGTCCACGGGCAGTGG - Intronic
1176109358 20:63404435-63404457 AGGCGGGGTCACACCTGCAGGGG + Intergenic
1177243537 21:18492678-18492700 AGGAAGAGGCCCACAGCCAGTGG - Intergenic
1178544343 21:33480260-33480282 CGGCGGCCGCCCACCGGCAGGGG - Intergenic
1179842066 21:44083226-44083248 AGGAGGGTGCCCACGTGCTGAGG + Exonic
1180757535 22:18173005-18173027 TGGAGGGTGCCCACTGGCTGTGG + Intronic
1180832225 22:18912165-18912187 AGGAAGGGGCCCCCAGGTAGAGG - Intronic
1181067617 22:20314177-20314199 AGGAAGGGGCCCCCAGGTAGAGG + Intergenic
1181074242 22:20364440-20364462 TGGAGGGTGCCCACTGGCCGTGG - Intronic
1181422291 22:22810484-22810506 AGGAGGGGGCCCAGTGGGAGAGG + Intronic
1181592631 22:23894606-23894628 AGGGGGGTGCCCACCGGACGAGG + Exonic
1182430479 22:30295924-30295946 GGGAGGGGGCCCTCCACCAGGGG + Intronic
1182762779 22:32735921-32735943 AGGAAGAGGCCCAGAGGCAGGGG + Intronic
1183319550 22:37156739-37156761 AGTAGAGGGCACACGGGCAGGGG + Intronic
1183571568 22:38656885-38656907 AGGAGGGCGGCCACCGCCCGGGG - Intronic
1183695201 22:39417841-39417863 AGGAGGGGGCTCACCGACATTGG - Exonic
1184372840 22:44093527-44093549 AGGACGCAGCCCCCCGGCAGAGG + Intronic
1184620225 22:45671564-45671586 AGGAGGGTGCCCGCGGACAGAGG - Intergenic
1184679492 22:46062387-46062409 GGGAGGGAGCCCACGTGCAGAGG - Intronic
1184857794 22:47156046-47156068 GGGAGGGGGCTCACCAGCAGGGG - Intronic
1185178748 22:49347364-49347386 GGGTGGGGGCCCACAGGCGGGGG + Intergenic
1185255395 22:49828333-49828355 AGTGGGGGGCCCACAGGCGGGGG + Intergenic
1185281730 22:49972569-49972591 AGGTGGGGGCGCAGCGCCAGAGG - Intergenic
1185409861 22:50676180-50676202 AGGGGGGTGCCCAACTGCAGTGG + Intergenic
1203282310 22_KI270734v1_random:137470-137492 AGGAAGGGGCCCCCAGGTAGAGG - Intergenic
950125230 3:10506328-10506350 AAGAAGGTGCCCACCAGCAGGGG + Intronic
950706134 3:14783718-14783740 AGGATGGGGCCCCTCTGCAGAGG + Intergenic
952491957 3:33881846-33881868 AGGCGGGGGCCTACCGGTGGGGG + Intergenic
952813002 3:37422007-37422029 AGCAGGGGGTCCACCTGCGGAGG + Intronic
955201520 3:56856048-56856070 AGCAGGGGGCCCTGCCGCAGAGG + Intronic
961664656 3:128488070-128488092 GGGAGGGGGCCCGCCGGCTGAGG - Intronic
961825577 3:129597470-129597492 GGGGGGGGGCCCGCAGGCAGAGG - Intronic
963605014 3:147406140-147406162 AGGAGGGGGCCCTTCCGCAAAGG - Intronic
963851848 3:150217307-150217329 AGGAGGGAGGCCACAGACAGAGG + Intergenic
967832808 3:193935402-193935424 AGGAGGGGGCGCACAAGCAGAGG + Intergenic
968356149 3:198109122-198109144 TGGAGGGCTCCCACCTGCAGAGG + Intergenic
968660862 4:1798205-1798227 GGGTGGGGGCCCACCCACAGGGG - Intronic
968926971 4:3554199-3554221 AAGAGGTGGCCAAACGGCAGCGG - Intergenic
969608969 4:8216614-8216636 AGGAGGGGGCCTGCCAGCAGTGG + Intronic
969676214 4:8615768-8615790 AGGAGGGGGCTCATGGACAGAGG - Intronic
969690969 4:8703976-8703998 AGGAGGGGACCCACTGGCCTTGG + Intergenic
974715764 4:65668565-65668587 TGGAGGGGACCCAAAGGCAGAGG + Intronic
975342586 4:73258599-73258621 AGAAGGGAGCCCCCCGGCGGTGG - Exonic
979318521 4:119296696-119296718 AGGGGTTGGCCCACCCGCAGTGG + Intergenic
980134143 4:128844291-128844313 AGAAGGGGGCCCAGCAGCACGGG + Intronic
984675749 4:182545586-182545608 AGGAGAAGGCCCAAGGGCAGAGG - Intronic
985884270 5:2664334-2664356 AGGAGGATGCCCACAGGGAGAGG - Intergenic
986588263 5:9341479-9341501 AGGAGGGGGTCCACAGCAAGTGG + Intronic
989710339 5:44389491-44389513 GGGAGGGGGTCAACCGGCGGTGG + Intronic
994083262 5:95731312-95731334 AGGAGGAGGAGCAGCGGCAGCGG + Exonic
997831603 5:137155347-137155369 AGAAGGGGACTCACCAGCAGGGG - Intronic
998365237 5:141626180-141626202 AGGAGAGTGCTCACCAGCAGCGG + Exonic
999200797 5:149814860-149814882 AGAAGGGGGGCCCACGGCAGGGG + Intronic
1001516186 5:172356729-172356751 CGGCGGCGGCCCACCGGCCGGGG + Intronic
1001617652 5:173056292-173056314 AGGCGGGGGCCCGCCGGCCTCGG - Intergenic
1002177198 5:177407824-177407846 AGGAGGGGGACCTTAGGCAGGGG + Intronic
1002425574 5:179172580-179172602 GGCAGGGGGTCCACCTGCAGCGG - Intronic
1002612829 5:180432483-180432505 AGCAGGGGGCGCACCTGTAGGGG - Intergenic
1003030821 6:2599076-2599098 AGGGGCAGGCCCACCTGCAGGGG - Intergenic
1004660455 6:17705709-17705731 ACGAGGAGGGCCACAGGCAGGGG + Intronic
1006162964 6:32048614-32048636 AGGCGGGGCTCCACCGGCAGTGG + Intronic
1006614912 6:35319561-35319583 AGGAGGAGGCTGCCCGGCAGCGG + Exonic
1007730545 6:43942825-43942847 GGCAGGGGTCCCACTGGCAGAGG + Intergenic
1009798444 6:68502498-68502520 AGGAGGGTGGCCAGCGGCACTGG + Intergenic
1017925811 6:158910834-158910856 AGGTGGAGGTCCCCCGGCAGGGG + Intergenic
1018395787 6:163377163-163377185 AGGAGGTGGCCCAAGGGCACAGG - Intergenic
1018788860 6:167130991-167131013 AGGAGGGGTCCCAAAGGGAGGGG - Intronic
1019112007 6:169724201-169724223 TGGAGGAGGCCCAGCGGCGGCGG + Intronic
1020106155 7:5423261-5423283 GGGAGGGGGCGCCCCGGGAGGGG - Intronic
1022527001 7:31044558-31044580 AGGAGGGGATCCATCTGCAGTGG - Intergenic
1026827970 7:73595874-73595896 AGGAGGAGGCCCAGCAGCTGCGG - Exonic
1027046594 7:74995134-74995156 AGGAGGTGGCCCAATGGCAGGGG + Intronic
1029591684 7:101511250-101511272 AGGTGGTGGCGCACGGGCAGAGG + Intronic
1033832301 7:145269563-145269585 AGGACGAGGCCCACACGCAGTGG + Intergenic
1034267954 7:149790236-149790258 GGGAGGGCGCTCGCCGGCAGAGG + Intergenic
1036784482 8:11677055-11677077 AGGAGGGGACTCACCCGCGGTGG - Intronic
1037494764 8:19428053-19428075 AGGATGGAGGCCACCTGCAGGGG - Intronic
1041020554 8:53633865-53633887 AGGAGGGGATCCACCTGCATGGG - Intergenic
1046812341 8:118546435-118546457 GAGAAGGGGCCCACCGGGAGGGG + Intronic
1047925289 8:129676834-129676856 GGGATGTGGCCCACAGGCAGAGG - Intergenic
1049069981 8:140349047-140349069 AGGAGAGGGACGTCCGGCAGAGG + Intronic
1049097504 8:140557705-140557727 AGGGGGAGGCCCACAGGCACAGG + Intronic
1049218276 8:141417629-141417651 GGGAGGGCGCGCACCGGGAGAGG + Intronic
1049651503 8:143771859-143771881 AGGAGGCGGCGCAGCGGGAGCGG + Intergenic
1049682105 8:143923917-143923939 AGGAGGAGGCCGCACGGCAGCGG - Exonic
1049682297 8:143924868-143924890 AGGAGCAGGCCGTCCGGCAGCGG - Exonic
1049693628 8:143973365-143973387 AGGAGCGGCCCGACAGGCAGCGG + Intronic
1049787750 8:144459169-144459191 AGGAGGTGCCCCATGGGCAGAGG + Intronic
1049955518 9:689392-689414 AGGAGGGTGTGCCCCGGCAGAGG - Intronic
1052055860 9:23906748-23906770 AGGAGGGGTCCCACTTGCACAGG - Intergenic
1053135340 9:35647178-35647200 ATGCGGGGAACCACCGGCAGCGG - Intergenic
1053801894 9:41769590-41769612 AAGAGGTGGCCAAACGGCAGCGG - Intergenic
1054463086 9:65476581-65476603 AAGAGGTGGCCAAACGGCAGCGG + Intergenic
1054648192 9:67606849-67606871 AAGAGGTGGCCAAACGGCAGCGG + Intergenic
1055514879 9:77023990-77024012 AGGAGGGGGTTCCACGGCAGGGG - Intergenic
1057220825 9:93256993-93257015 TGGAGGGGGACCACGGGCTGTGG - Exonic
1057390589 9:94639108-94639130 AGGACGGGGCCCACCGCCCAAGG + Intronic
1058357029 9:104094574-104094596 GGGAGGGGGACCAGTGGCAGAGG + Intronic
1060106742 9:120877291-120877313 AGGAAGGGGCCCCCCGGGCGCGG + Exonic
1060629515 9:125143315-125143337 GGGAGCGGGCCCAGGGGCAGCGG - Intronic
1061377540 9:130235206-130235228 AGCAGGGAGCCGACTGGCAGGGG - Exonic
1061902733 9:133681183-133681205 AGGATGGGGCCCACAGGGATGGG + Intronic
1062031204 9:134362824-134362846 AGGAGGGGGCCCACTTGGACGGG + Intronic
1062249668 9:135587836-135587858 AGGAAGCTGCCCACCGGCAGAGG + Intergenic
1062402742 9:136379599-136379621 AGCATGGGGCCCAGAGGCAGGGG - Intronic
1062431579 9:136528935-136528957 GGGAGGGGTCCCAGGGGCAGGGG - Intronic
1062583837 9:137240295-137240317 AGGTCGGGGCCCACCCGCCGAGG + Intergenic
1189322307 X:40094418-40094440 GGTAGGGGGCCCACAGGCACTGG + Intronic
1189794126 X:44631311-44631333 AGGTGGGGGCCCACCTGTTGAGG - Intergenic
1190112731 X:47605191-47605213 AGGAAGGGTGCCACTGGCAGAGG - Intronic
1195727781 X:107935709-107935731 AGGAGGCGGCCCAGAGGGAGGGG - Intergenic
1198313044 X:135438580-135438602 GGGAGCGGGCCCACCGCCAGAGG + Intergenic