ID: 912702412

View in Genome Browser
Species Human (GRCh38)
Location 1:111888135-111888157
Sequence CTGTGGGGTGGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1678
Summary {0: 1, 1: 0, 2: 13, 3: 186, 4: 1478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912702402_912702412 -7 Left 912702402 1:111888119-111888141 CCAGCTGGAGCCCTAACTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG 0: 1
1: 0
2: 13
3: 186
4: 1478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912702412 Original CRISPR CTGTGGGGTGGGAGGGAAGA GGG Intronic
900115355 1:1025721-1025743 CTGCCGGGTGGGAGGGCGGAGGG + Intronic
900148265 1:1167603-1167625 CTGTCCGGCAGGAGGGAAGATGG - Intergenic
900373436 1:2342650-2342672 CTGCGGTGTGGGAGGTGAGAAGG - Intronic
900401678 1:2475332-2475354 CTGGGCAGTGGGTGGGAAGAAGG + Intronic
900402619 1:2478781-2478803 CTGTGGGGTAGGAGGGATCCAGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900819150 1:4872912-4872934 TTGGGGGGTGGGGAGGAAGAGGG - Intergenic
900950264 1:5854656-5854678 CTGGGGGCTGTTAGGGAAGAAGG - Intergenic
900974050 1:6006502-6006524 CTGAGGGGTGGGAGTGGAGTGGG - Intronic
901053224 1:6436122-6436144 CTGTGCGGTGGGAGGGAGGGAGG + Intronic
901325897 1:8364902-8364924 CGGTGGGGTGGGGGGGAGGGGGG + Intronic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
901533531 1:9868075-9868097 CTGTGGACTGGGAGTGGAGAGGG - Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901668449 1:10839629-10839651 CTGTGGGGTGGGAGTGGAGGTGG + Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902360829 1:15941830-15941852 CTGTGGGGTGGGTGGGGAGCTGG - Intergenic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902497466 1:16883702-16883724 TTGGGGGGTGGGAGGGGGGAAGG + Intronic
902568445 1:17331163-17331185 CTGTGGGGTGGCAGTGTGGATGG + Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902659122 1:17889236-17889258 ATGTGTTGTGGGAGGGACGAGGG - Intergenic
902801136 1:18830995-18831017 GTGTGGGGTGGGTGAGAGGAGGG - Intergenic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903455640 1:23484672-23484694 CGGGGGGGTGGTAGGGCAGAAGG - Intergenic
903812369 1:26041860-26041882 GTGCTGGGTGGGAGGGGAGAAGG - Intronic
903832257 1:26182409-26182431 CTGTGGGGTGGGAAGAGAGTGGG + Intronic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903892414 1:26578511-26578533 ATCTGGGGTGGAAGGGAAGCTGG + Intergenic
903913405 1:26745578-26745600 GTTGGGGGTGGGAGGGGAGACGG - Intronic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
904260412 1:29284542-29284564 CTGTGGCGTGGAAGTGCAGAAGG + Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904622902 1:31786046-31786068 CTGGAGGGTGGGAGGGGACACGG - Intergenic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904775429 1:32902998-32903020 TTGTCAGGTGGAAGGGAAGATGG + Intergenic
904810471 1:33160305-33160327 CTTGGGGGTAGGAGGGATGAGGG + Intronic
904876847 1:33661928-33661950 GTGTGTGGTGGGAGGGAGGGGGG - Intronic
904895044 1:33810916-33810938 GTGGGGAGTGGGAGGCAAGAAGG - Intronic
905226054 1:36480079-36480101 CCCTTGGATGGGAGGGAAGATGG + Intronic
905255837 1:36683657-36683679 TTGTGGGGTGGGGGGAAGGAGGG - Intergenic
905361582 1:37424512-37424534 CTGTGGAGTGGGAGAGAGAAAGG - Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905569136 1:38990739-38990761 TTGTGGGGTGGGAGCGAGGGTGG - Intergenic
905587552 1:39132757-39132779 GTGGGGGGTGGGAAGGAAGGAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906567748 1:46812875-46812897 CTTTGGCCTGGGAGGAAAGAGGG - Intronic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
906993023 1:50759295-50759317 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907430811 1:54410192-54410214 AAGTGAGGTGGGAGTGAAGACGG + Intronic
908095962 1:60738873-60738895 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908096400 1:60743313-60743335 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908715317 1:67063638-67063660 ACGTGGGGTGGGAGGGGAGTAGG + Intergenic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
909135997 1:71801019-71801041 TTGTAGGGTGGTAGGAAAGAAGG - Intronic
909252984 1:73381789-73381811 CTGTGGGTTGCCAGGGATGAAGG + Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910118809 1:83761570-83761592 CTGAGGGGTGGGTGGGCAGGGGG - Intergenic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
910432381 1:87171935-87171957 AGGGTGGGTGGGAGGGAAGAGGG - Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911841510 1:102688057-102688079 CTGTGAGGTGGGAAGCAAGATGG - Intergenic
912332237 1:108830397-108830419 CTGTAGGGTGCGAGGGAGGCTGG + Intronic
912380608 1:109246245-109246267 CTGTGGGGTGGGTGGCGTGAAGG - Intergenic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912511208 1:110191360-110191382 CTGTCAGGTGTGAGGGCAGATGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912795205 1:112689175-112689197 CTGCAGGGTGTGAGGGAAGGGGG + Intronic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
913474226 1:119221413-119221435 CTGTAGGGTGTGGGGGAGGAGGG - Intergenic
913596311 1:120381151-120381173 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914090961 1:144497824-144497846 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914307639 1:146436385-146436407 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914401182 1:147321940-147321962 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
914504972 1:148281050-148281072 CGGTGGGGCGGGAGAGAGGAGGG + Intergenic
914507592 1:148303098-148303120 CGGTGGGGCGGGAGAGAGGAGGG - Intergenic
914594469 1:149136753-149136775 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914900431 1:151708621-151708643 CTGTGCAGGGGCAGGGAAGAGGG + Intronic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915327612 1:155088772-155088794 GTGTGGGGTGGGAGAGCAGGTGG + Intergenic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915524256 1:156466542-156466564 CTGTGGGGTGGGAGGGCCTACGG - Exonic
915530814 1:156501036-156501058 CTGCCGGGAGGGAGGGAGGAAGG + Intergenic
915701338 1:157799637-157799659 TTGTGGGGTGCGGGGGAGGAGGG + Intronic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916177442 1:162054342-162054364 GTGTGGGGTGGGAGAGGAGGAGG + Intergenic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916641943 1:166739196-166739218 GTGTGGGGTGGGAGGGCAAGAGG - Intergenic
916652739 1:166846185-166846207 TTCTGGGGTGGGAGGGAATTGGG + Intronic
916686539 1:167152330-167152352 CTCTGCGGTGGGAAGGGAGAAGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917911232 1:179648444-179648466 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918168983 1:181977037-181977059 CTGTGGGGTCGGGGGGAGGCAGG + Intergenic
918672737 1:187240392-187240414 ATGTGGGGTGGGTGGGAAATGGG - Intergenic
919019952 1:192092708-192092730 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919020444 1:192098456-192098478 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919775551 1:201191978-201192000 CTGAGGGGTGGGTGGGATGGGGG + Intronic
919796799 1:201325673-201325695 AGTGGGGGTGGGAGGGAAGAGGG + Intronic
919813192 1:201421822-201421844 GTGAAGGGTGGGAGGGAGGAGGG - Intronic
919900878 1:202043454-202043476 CTGCGTGGTGGGAGGGAGCATGG + Intergenic
920101902 1:203522059-203522081 CTGTCTGGTGGCAGGGAAGGGGG - Intergenic
920112861 1:203599320-203599342 GTGTGGGGTGGGAGGGTCTAGGG - Intergenic
920122687 1:203670616-203670638 CTATAGGGTGGGAAGGGAGAAGG - Intronic
920273946 1:204789967-204789989 CTGGTGGGTGGCAGGGAGGAAGG + Intergenic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920359163 1:205400840-205400862 TTGTGGGGTGGGGGGGGGGAGGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
921337021 1:214098393-214098415 GTGAAGGGTGGGAGGGAAGAGGG + Intergenic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
922129462 1:222762570-222762592 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
922579634 1:226687420-226687442 GTGTGATGTGGGAGGGCAGATGG - Intronic
922905115 1:229168433-229168455 CTGTGTGGGGGGAGGCAAGGGGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923092648 1:230751848-230751870 CTGTGGGGTGGGGGAGGGGAGGG + Intronic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
923283750 1:232470432-232470454 CTGTAGGGTGGGATGTAAAATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923450891 1:234116473-234116495 ATGGGGGGTGGGAGGGAGGGTGG - Intronic
924087829 1:240471710-240471732 GTGGGGGGTGGCAGGGGAGAGGG + Intronic
924140333 1:241016120-241016142 GTGTGGGGTGTGAGGTACGATGG + Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063278552 10:4598611-4598633 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1063908966 10:10810630-10810652 CAGGGGAGTGGAAGGGAAGATGG + Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064193675 10:13228512-13228534 AGGTGGGGTGAGAGGGTAGAAGG + Intronic
1065047460 10:21757252-21757274 CTGTAGGGTGGGATGGAGGTGGG - Intronic
1065344454 10:24735521-24735543 ATGTGGGGTGGGAGAGAAAGAGG - Intergenic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065815848 10:29481729-29481751 CTGTAGGGTGGGAGGGGGGTTGG + Intronic
1066022661 10:31319163-31319185 CGGAGGGGTGGGGGGGAAGGGGG + Exonic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1066711271 10:38237426-38237448 CTGTGAGGTGGGAGTGGAGTAGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067735302 10:48845883-48845905 CTGTGGAGTGGTAGGCAAGAGGG + Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069370769 10:67745506-67745528 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069911475 10:71762333-71762355 CTGTTGGGTGGGAGGCAGGTTGG + Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070611673 10:77937631-77937653 TTGTGGGGTAGGTGGGAACAAGG - Intergenic
1070694116 10:78549097-78549119 CTGAGAGGTAGAAGGGAAGAAGG + Intergenic
1070734929 10:78856827-78856849 CTGTGGGGTGGGAGGGGCCTGGG - Intergenic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071301796 10:84261589-84261611 TTGTGGGGTGAGTGGGAAGGAGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072019152 10:91381429-91381451 CTGAGAGGTGGTAGGGAACAAGG - Intergenic
1072447812 10:95514950-95514972 CTGTAGTGTGGGAGGGGAGTGGG - Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1072831663 10:98664349-98664371 TTGTGGGCTGGCAGGGAAGCAGG + Intronic
1072844629 10:98816024-98816046 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1073137914 10:101229903-101229925 CAGTGGGGTGAGGGGCAAGAGGG - Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073618431 10:105022239-105022261 CTGTGGGGTGACAGGGCATATGG + Intronic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1074241417 10:111643075-111643097 TCGTGGGGTGGGGGGGAGGAGGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074852281 10:117448440-117448462 TTGTGGAGTGGGTGGGTAGATGG + Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075407786 10:122206083-122206105 CTGGGGGGCGGGGGGAAAGAGGG + Intronic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1075618059 10:123905776-123905798 GGGTGGGGTGGGAGGCAGGAAGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076063474 10:127430588-127430610 CTGGGGGGTGGGGCAGAAGATGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076291305 10:129348068-129348090 TTGTGGGGTGGGGGAGAAGCAGG + Intergenic
1076327985 10:129643227-129643249 CTGTGGGGTGGGAGGAGGGCTGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076705106 10:132297203-132297225 GTGTGGGGTGGGAGCCAAGCAGG - Intronic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1076762114 10:132611093-132611115 ATGTGGGGTGGGAGGTGAGGTGG + Intronic
1076794283 10:132791205-132791227 AGGTGGGGTGGGAGGGGAGAGGG + Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076888254 10:133272318-133272340 GGCTGGGGTGGGAGGGAAGTGGG - Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077449889 11:2634322-2634344 TTGTGGGGTGGGGGGGGAGGGGG - Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077696813 11:4400964-4400986 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1077804409 11:5575736-5575758 CTGAGGGGTGGAGTGGAAGAAGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1078042008 11:7874765-7874787 CTGTGGGGTAGGAGAAAAAAGGG + Intergenic
1078115869 11:8449629-8449651 TTGTGGGGTGGGTGGGGGGAGGG + Intronic
1078488911 11:11751248-11751270 GTGTGGGGTGGGTGGGGAGGGGG - Intergenic
1078754513 11:14196307-14196329 CTTGTGGATGGGAGGGAAGATGG + Intronic
1078779348 11:14422376-14422398 CTGTGGGGTGGGGGAGGAGGGGG - Intergenic
1078907877 11:15704364-15704386 CTGGAGGGTGGGAGGGGAGCAGG - Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079377745 11:19908856-19908878 CTGTGGGGTGGGAGTAGAGGAGG + Intronic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1079536599 11:21522565-21522587 GTGCGGGGTGGGAGGGGAGGTGG + Intronic
1079562440 11:21839134-21839156 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079949339 11:26782934-26782956 CAATGGGGTGGGAGGGATGAAGG - Intergenic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1080701450 11:34647791-34647813 ATGTGAGGTGGGTGGGAAGCAGG - Intronic
1080866324 11:36198627-36198649 CTGTCAGGTGAGAGTGAAGAAGG - Intronic
1081428008 11:42946174-42946196 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082791269 11:57348084-57348106 CTGATGGGGGGAAGGGAAGAGGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082803972 11:57435232-57435254 CTGGAGGGTGGAAGGGAAGCAGG - Intergenic
1082864712 11:57888056-57888078 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083273987 11:61586769-61586791 CTTTTGGGTGTGGGGGAAGAGGG + Intergenic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083302301 11:61745499-61745521 ATTGGGGGTGGGAGGGAGGAAGG - Exonic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083712651 11:64558731-64558753 CTGTGAGGTGGCAGGCAAGGTGG - Intronic
1083836276 11:65270619-65270641 ATGTGGGGTGTGAGAGAAAAAGG - Intronic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084359819 11:68661923-68661945 CTGTTGGCTGGGAGGGGAGCTGG + Intergenic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084717324 11:70882288-70882310 CTCCGGGGTGGGACGGGAGAGGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085013838 11:73159604-73159626 CTATGGGGTAGGAGGGTGGATGG - Intergenic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085133596 11:74064041-74064063 TTGTGGGGTGGGACGGGGGAGGG - Intronic
1085475930 11:76788926-76788948 CTGTGGGGTGAGAGGCCAGGAGG + Intronic
1085907845 11:80786046-80786068 CTGTGGTGTGGTAGTGATGATGG + Intergenic
1086046021 11:82533051-82533073 ATGTGGGGTGGGAGAAAAGAAGG + Intergenic
1086244252 11:84732784-84732806 TTGTGGGGTGGGTGGGGGGAGGG - Intronic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087942437 11:104115054-104115076 CTTTGGGGTCTCAGGGAAGAGGG - Intronic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090226405 11:125074620-125074642 GAGTGGGGTGGGAGGGGAAAGGG + Intronic
1090379915 11:126319265-126319287 TTATGGGGTGGGAGGCATGAAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090663234 11:128896428-128896450 GGGTGGGGTGGGATGGAAGTGGG - Intronic
1090844867 11:130522224-130522246 CTGGGGAGTGGGAGGGCAGTGGG + Intergenic
1090977466 11:131689714-131689736 CTGCGGTATGGGAGGGGAGATGG - Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091356396 11:134941036-134941058 CTGTGGGGGGGGGGGGACCAGGG + Intergenic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1092060802 12:5548864-5548886 CTGTGGAGTGAGAGTGAGGAAGG - Intronic
1092128388 12:6091281-6091303 ATGGGGGGTGGGTGGGAGGAGGG + Intronic
1092138770 12:6168184-6168206 TTGCGGGGTGGGGGGGGAGATGG + Intergenic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092273885 12:7044682-7044704 GGGTGGGGTGGGTGGGGAGAGGG - Intronic
1092903018 12:13077415-13077437 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1092967400 12:13657662-13657684 GTGTTGGGGGGCAGGGAAGAGGG + Intronic
1092988818 12:13875069-13875091 CTGTGGGGTGGGGAGGGAGTGGG - Intronic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1093863274 12:24194260-24194282 CTGTGGGGGGTGATGGAAGGTGG + Intergenic
1094149575 12:27268262-27268284 TTGTGGGGTGGGGGGAAAGGGGG - Intronic
1095137463 12:38622927-38622949 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1095400838 12:41813592-41813614 CAGGGGAGTGGGAGGAAAGATGG + Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1095982824 12:47982608-47982630 CCCTGGGGAGGGAGGTAAGAGGG + Exonic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096493035 12:52023375-52023397 GAGTGGGGTGGGAGCGCAGAGGG + Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1096996395 12:55840816-55840838 GTGTGGGGTGGAAGGGTGGAGGG + Exonic
1097465358 12:59917003-59917025 TTGAGGGGTGGGAGGGAGGGTGG - Intergenic
1097534863 12:60855924-60855946 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1097705784 12:62866924-62866946 GTGTGGGGTGGAAGGGAGCAGGG - Intronic
1097751181 12:63354577-63354599 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1098240153 12:68458682-68458704 TTGGGGGGTGGGAGGGAAGGTGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1099456598 12:82870230-82870252 ATTTGAGGTGGGAGGGAAGGAGG - Intronic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101049299 12:100844589-100844611 CTGTGGGGTGGTAAGGTAGAGGG + Intronic
1101105531 12:101436314-101436336 CTGAAGTGTGGGAGGTAAGAAGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101718920 12:107334394-107334416 GTGTGGGGTGTGAGGGAATGAGG + Intronic
1101820596 12:108181238-108181260 CGCCGGGGTGGGAGGGAGGAAGG - Intronic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1102596140 12:113993902-113993924 GTAGGGGGTGGGAGGGAGGAAGG - Intergenic
1102706069 12:114881616-114881638 CTCTGGGGTGAAAGGGAGGAAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102771500 12:115481233-115481255 CTGGGGGCTGGGAGGGCACATGG - Intergenic
1102960427 12:117089340-117089362 CTGTGGGGTGGTAGGGGGAAGGG + Intronic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103023465 12:117555096-117555118 GTGAGGGGTAGGAGGGAGGAAGG - Intronic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103215239 12:119196681-119196703 CTGTAGGGTGGGAGGGAGAAGGG + Intronic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103617187 12:122161809-122161831 CAGGAGGGTGGGGGGGAAGAGGG - Intergenic
1103725546 12:122995812-122995834 CTGGTGGGTGGGAGGACAGAAGG - Intronic
1104251071 12:127094744-127094766 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1104288097 12:127443792-127443814 GTGGAGGGTGGGAGGGGAGAGGG - Intergenic
1104308221 12:127629516-127629538 CTGGTGGGTGGGAGAGAAAATGG + Intergenic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1105882128 13:24614474-24614496 CTGAGAGGTGTGATGGAAGATGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106325797 13:28688244-28688266 CTGGGGGGTGGGAGGGCTGGGGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106650290 13:31683044-31683066 ATTTTGGGTGGTAGGGAAGATGG - Intergenic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107437072 13:40389619-40389641 GTTGGGGGTGGCAGGGAAGAGGG - Intergenic
1107526581 13:41238473-41238495 GTGTGGGGTAGGAGGTGAGAAGG + Intronic
1107800874 13:44107032-44107054 CTGAGGGGTGGCAGAGGAGAGGG - Intergenic
1108624168 13:52211168-52211190 GTGTGGTGTGGGGGAGAAGATGG - Intergenic
1109054962 13:57535144-57535166 CTGCTGGGTGAGAGGGAATATGG + Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109497895 13:63197933-63197955 TTGTGGGGTCGGGGGGAAGGGGG + Intergenic
1109577018 13:64272717-64272739 TTAAGGGGTGGGAGGGCAGAAGG - Intergenic
1109594297 13:64530057-64530079 CTGGGGGGTGGGAGGAAAACAGG - Intergenic
1109833618 13:67826371-67826393 CCGTGGGGTGGGGGGGAGGGGGG + Intergenic
1109846801 13:68003921-68003943 TTGTGAGGGGGGAGGTAAGAAGG - Intergenic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110789746 13:79574673-79574695 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1110983820 13:81938380-81938402 CCTTTGGGTGGGGGGGAAGATGG + Intergenic
1111812429 13:93107734-93107756 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1112060477 13:95734964-95734986 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112075077 13:95904439-95904461 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112699450 13:101988703-101988725 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1113072618 13:106436141-106436163 TTGTGGGGTGGGGCAGAAGAAGG + Intergenic
1113145722 13:107205151-107205173 TTGTGGGGTGGGGGGAAAGGGGG - Intronic
1113337155 13:109387699-109387721 CTGTGGAGTGGGAAGGCAGTGGG - Intergenic
1113913271 13:113854783-113854805 CTGTTGGATGGGAGGGATGCTGG + Intronic
1114055696 14:18965637-18965659 CTTTGGTGTGGGAGGAAAAATGG - Intergenic
1114106851 14:19436127-19436149 CTTTGGTGTGGGAGGAAAAATGG + Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1114726497 14:24943122-24943144 GGGTGGGGTGTGAGGCAAGAAGG + Intronic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115871878 14:37813792-37813814 ATGTGGGGTGTGAGGAAAGAGGG - Intronic
1116201682 14:41805548-41805570 CTGTGGGGTGGGGGGGGTGGAGG - Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118387895 14:65271894-65271916 GTGAGGGGTGGGAGGGAACAGGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118980200 14:70710083-70710105 CTGGGAGGTGGGTGGGCAGACGG - Intergenic
1118989284 14:70783259-70783281 CGGTAAGGTGGGAAGGAAGACGG + Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119410405 14:74426457-74426479 CTCTGGGGTGCGCGGGAGGAGGG - Intergenic
1119660253 14:76446030-76446052 CAATGGCGGGGGAGGGAAGAGGG + Intronic
1119738174 14:76997362-76997384 GTGGGAGGTGGGAGGGGAGAGGG - Intergenic
1119891367 14:78184986-78185008 CTGAGGAGTGAGAGAGAAGAAGG + Intergenic
1120849806 14:89159689-89159711 CTGTGGGGTGGGATGAAGGTGGG + Exonic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120898648 14:89556994-89557016 CTGTGGGGTGGGAAAGAACTTGG + Intronic
1121001872 14:90456839-90456861 ATGTGGAGTGGGGAGGAAGAGGG + Intergenic
1121077890 14:91084530-91084552 CTAGGGGGTGGGAGGGATGGAGG - Intronic
1121080970 14:91108088-91108110 CTGTGGGGTGCCGGGGGAGAAGG + Intronic
1121209066 14:92193003-92193025 ATGTGGGATGGGAGGGGAGGCGG + Intergenic
1121227733 14:92333806-92333828 TTGTGGGGTGCGGGGGGAGAGGG + Intronic
1121321699 14:92995273-92995295 CTGTGGAGTGGGTGAGCAGAGGG - Intronic
1121335143 14:93073325-93073347 CACAGGGGTGGCAGGGAAGAAGG + Intronic
1121341189 14:93106170-93106192 CTGTGGGGTGGTGGGGTGGATGG - Intronic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1121457384 14:94047059-94047081 CTGTGGGCTGGCCGGCAAGATGG + Exonic
1121475015 14:94191209-94191231 CTGTGGGGTGTGAGGAGAAAGGG + Intronic
1121829891 14:97042142-97042164 CAGTGGGGTGCCAGAGAAGAAGG - Intergenic
1122029336 14:98901210-98901232 ATAAGGGCTGGGAGGGAAGAGGG - Intergenic
1122078655 14:99252059-99252081 CTGGTGGGTGGTGGGGAAGAGGG - Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122567498 14:102671251-102671273 CTGTGGAGTCGAGGGGAAGAGGG - Intronic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1123423541 15:20149805-20149827 CTGTTGGGTGGCAGGGTAGGGGG + Intergenic
1123532763 15:21156326-21156348 CTGTTGGGTGGCAGGGTAGGGGG + Intergenic
1124022824 15:25939592-25939614 CAGTGGGGTGGGGCGGAAGGAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124115694 15:26841755-26841777 CTCTGCAGTGGCAGGGAAGATGG + Intronic
1124243798 15:28053330-28053352 AGGAGGTGTGGGAGGGAAGAGGG + Intronic
1124845984 15:33290412-33290434 GTGTGTGGTGGGAGGAGAGAGGG - Intergenic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1124965357 15:34429269-34429291 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1124981975 15:34575471-34575493 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1126058609 15:44756603-44756625 CTGTAGGGTGGAAAGGAATATGG + Intronic
1126574689 15:50185195-50185217 CTGTTAGCTGGGTGGGAAGAGGG - Intronic
1126842773 15:52733543-52733565 CTGTTGGGTGGGAAGGCAGAGGG + Intergenic
1126949983 15:53870411-53870433 GTGGGGGGTGGGAAGGAAAAAGG - Intergenic
1127165615 15:56243291-56243313 CAGAGGGGTGGGAGGGAGGGAGG + Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127710468 15:61592131-61592153 CTGTGGGGTGGAGGGCAAAATGG + Intergenic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1127873331 15:63091144-63091166 GGGTGGGGTGAGAGGGAAGCCGG - Intergenic
1128451900 15:67810714-67810736 CTGTGGTGTGGGACGGTAGGAGG + Intergenic
1128650933 15:69413162-69413184 CAGAGGGGTGGGAGACAAGAGGG + Intergenic
1128852881 15:70978736-70978758 TTATGGCGTGGGAGGCAAGAGGG + Intronic
1128888847 15:71312745-71312767 CTGTGGGGTGGTGGGGAAGTGGG - Intronic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129170701 15:73805836-73805858 CTGGTGGGTGGGAGGGTGGATGG - Intergenic
1129210559 15:74065631-74065653 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129391016 15:75220966-75220988 CCTTGGGGCGGGAGGGATGAGGG + Intergenic
1129403452 15:75299698-75299720 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129570834 15:76682260-76682282 CTGTGGGGTGGGGGGGGGAAGGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129702246 15:77774624-77774646 CTGTGTGGTGGGTGGGCTGATGG - Intronic
1129727759 15:77910268-77910290 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129840118 15:78738592-78738614 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130264694 15:82389811-82389833 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131197128 15:90364559-90364581 CTGAAGGGTGGCAGTGAAGATGG - Intronic
1131224067 15:90609324-90609346 GAGTGGGGTGTGTGGGAAGAGGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132185218 15:99797656-99797678 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1132244600 15:100284589-100284611 CTGAGGGGTGGGAGGCTAGAGGG + Intronic
1132260773 15:100422932-100422954 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1132291306 15:100705628-100705650 CAGCTGTGTGGGAGGGAAGAGGG + Intergenic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132431770 15:101766899-101766921 GTGGGGGGTGGGAGGGATGGAGG - Intergenic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133826205 16:9280443-9280465 CTGGATGGTGGGTGGGAAGAGGG + Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134239451 16:12494600-12494622 CTGTGAGCTGGTAGAGAAGATGG - Intronic
1135235901 16:20755777-20755799 CTGTGGGGTGGGGGGGGGGGAGG - Intronic
1135502425 16:23008183-23008205 ACGTGGGGTGGGAAGAAAGATGG + Intergenic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135738290 16:24951286-24951308 CTGAGGCTTGGGAGGGAACAGGG - Intronic
1135774303 16:25242945-25242967 CCGTGGTGTGGTAAGGAAGATGG + Intronic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1135860510 16:26051752-26051774 GTGTGGGGTGGGGAGGAAGGAGG - Intronic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136518119 16:30780066-30780088 GTGTGGTGTGGGAGGTGAGATGG + Exonic
1136554688 16:31001051-31001073 CTGTGGGGTGGGAGGAGAAGGGG - Intronic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1137454069 16:48604938-48604960 AAGTGGGGTGGTCGGGAAGAGGG - Intronic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137890344 16:52155006-52155028 TTGTGGGGTGGGGAGGGAGAGGG - Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138214588 16:55191946-55191968 CTGGAGGGTGGGAGGGAATTTGG + Intergenic
1138307912 16:55995108-55995130 CTGTTGGGTGGGTGGGGAGGAGG + Intergenic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138512463 16:57516477-57516499 GGATGGGGTGGGAGGGAGGAGGG + Intronic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1138810933 16:60149524-60149546 GTTTGGGGTGGGAGGGACTAGGG + Intergenic
1138989870 16:62378001-62378023 AAGTGGGGTGGGAGAGAGGAGGG - Intergenic
1139002596 16:62531229-62531251 ATGTGGGGTGGGAAGGGTGACGG + Intergenic
1139019531 16:62730079-62730101 CTGTGCAGTGGGAGAGAATATGG - Intergenic
1139486622 16:67260572-67260594 CTGAGCGGTGGGAAAGAAGAGGG + Intronic
1139591367 16:67935107-67935129 GTTTGGGGTGGGATGGAAGCAGG - Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140128810 16:72139530-72139552 CTGTGGGGTAGGTAGGGAGAAGG + Intronic
1140274518 16:73496799-73496821 CTGGGGGGTGGGAGTGAGGGAGG + Intergenic
1140469361 16:75205853-75205875 CGGTCGGGTGGGAGGGGAGCAGG - Intronic
1140472423 16:75223086-75223108 CGGTCGGGTGGGAGGGGAGCAGG + Intronic
1140580278 16:76223255-76223277 CTGGGGGGTGGGGGGGCAGGGGG + Intergenic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141039204 16:80656801-80656823 CAGTGGGGTGGGAGAGGGGAGGG + Intronic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141157916 16:81609970-81609992 CAGTGTGGTGGCAGGGCAGAGGG + Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141651848 16:85397031-85397053 CAGCTGGGTGGGTGGGAAGAGGG + Intergenic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1141984288 16:87570145-87570167 CTGGGGGGCGGGAGGGGACAAGG + Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142155686 16:88531979-88532001 CTGTGGGGTGGGAAGCAGGCGGG - Intronic
1142183999 16:88685928-88685950 GTGGTGGGTGGGAGGGAAGGAGG - Intronic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142399756 16:89852633-89852655 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399771 16:89852673-89852695 CCGGGGGGTGAGAGAGAAGACGG - Intronic
1142399781 16:89852713-89852735 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399796 16:89852753-89852775 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399811 16:89852793-89852815 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399841 16:89852873-89852895 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399870 16:89852953-89852975 CCGGGGGGTGAGAGGGAGGATGG - Intronic
1142912129 17:3103131-3103153 CTGATGGGAGGGAGGGTAGAGGG + Intergenic
1143037455 17:4007505-4007527 CTGTGGGGGGGGTCAGAAGAGGG + Intronic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143402905 17:6657435-6657457 CTCTGGGGTGCGAGAGAAGCTGG + Intergenic
1143570853 17:7757454-7757476 CAGTGGGGTGGGAGGGGACCTGG - Intronic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143620090 17:8075747-8075769 CTGAGGAGTGGGAGGGGAGGAGG - Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144576823 17:16434827-16434849 CTCCGGGGTGGGAGGGGAGGCGG + Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144717925 17:17447133-17447155 CTGAGGGGTGGTATGTAAGAGGG + Intergenic
1144766297 17:17734596-17734618 CAGGTGGGTGGGAGGGAAAAGGG - Intronic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1145014338 17:19386966-19386988 GGGTGGGGGGGCAGGGAAGAGGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145278763 17:21453623-21453645 ATGTGGGCTGGGAGGGGACACGG - Intergenic
1145878419 17:28336650-28336672 CTTTGAGGTGGGCGGGAAAAGGG + Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1147155401 17:38542207-38542229 CTCTGGGGAGGGAGGGACTAGGG + Intronic
1147261526 17:39212048-39212070 GGGTGGGGTGGGAGGGAATGAGG - Exonic
1147335146 17:39723260-39723282 GTTTGGGGTGGGAGGGACAAAGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1147782855 17:42956166-42956188 CTGTGGAGTGGCTGAGAAGAGGG - Intronic
1147988649 17:44320438-44320460 TGGTGGGGTGGGCGGGGAGAGGG + Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148380536 17:47193654-47193676 GTGTAGGGTGGGTGAGAAGAAGG - Intergenic
1148397843 17:47324168-47324190 CAGTAGGGTGCGAGGGAGGAAGG + Intronic
1148477829 17:47940984-47941006 CGGTGAGGTGAGAAGGAAGATGG - Intergenic
1148785530 17:50144384-50144406 CTGTGGCGTGGACAGGAAGATGG - Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148850040 17:50550156-50550178 CTGTGGGGTGGGGCAGAAGCTGG + Intronic
1148935317 17:51160479-51160501 CTGATGGGTGGGAGGGAAGTTGG + Intronic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151424843 17:74024358-74024380 CTGCGGGGTGGCAGGGAGAAAGG - Intergenic
1151509609 17:74550200-74550222 CTCTGGGGTCTGGGGGAAGAGGG - Intergenic
1151518675 17:74613530-74613552 CTGTGGGGTCTGTGGGGAGATGG - Intronic
1151569179 17:74917578-74917600 CTCTGGGGTGGACGGGAGGAGGG + Exonic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1151999923 17:77638784-77638806 GGGTGGGGTGGGGGGGAAGCGGG + Intergenic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152410514 17:80120450-80120472 AGGTGGGGTGGGAGGGGAGGTGG - Intergenic
1152422958 17:80203914-80203936 CACTGGGGTGGGCTGGAAGAGGG + Intronic
1152525809 17:80887653-80887675 CTCTGGGGTGGGAGAGAGGAGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152630396 17:81408382-81408404 CTGGGGGGTGGGAGGCAGGTGGG - Intronic
1152868270 17:82736914-82736936 CGTGGGGGTGGGAGGGAAGGAGG - Intronic
1152909991 17:82997882-82997904 GTGGGTGGTGGGAGGGAAGTAGG + Intronic
1153185119 18:2477914-2477936 GGGTGGGGTGGGGGGAAAGAAGG - Intergenic
1153240168 18:3024065-3024087 TTGTGGGGTGGGAGGGGGGGAGG + Intergenic
1153408459 18:4766763-4766785 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1153539561 18:6139622-6139644 CTGAGAGCTGGGAGGGGAGAAGG - Intronic
1153746756 18:8187334-8187356 GTCTGTGGTGGGAGGGAATATGG + Intronic
1154046770 18:10913313-10913335 CTATGAGGTGGGAGAGATGAGGG + Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1155059839 18:22218853-22218875 TTATGGGGTGGGAGTGAGGAAGG + Intergenic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156395107 18:36692099-36692121 CTTTGGGCTGGCAGGGAAAAGGG + Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157226628 18:45871771-45871793 CTGTGGGGTGTCAGGGGAAAAGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157385116 18:47253821-47253843 CTGTAGGGTGGGAGGGCACTGGG - Intergenic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157497939 18:48169976-48169998 GTGAGGGGTGGGAGAGTAGATGG - Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157650881 18:49329281-49329303 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1157762778 18:50276414-50276436 CTGTGCTGTGGGGAGGAAGAGGG + Exonic
1157781195 18:50440754-50440776 TTGGGGGGTGGGGGGGCAGAAGG - Intergenic
1158212226 18:55064672-55064694 CTGGGTGGTGGGAGGAAGGAAGG + Intergenic
1158602250 18:58864576-58864598 CTGTGGGGTGGAGGGGAGGGGGG + Intronic
1158780854 18:60648791-60648813 TTGTGGGGTGGGAGGAGGGAGGG + Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1159934300 18:74350068-74350090 CTGTGGGGTGTGGGGGTAGGAGG + Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160319261 18:77875102-77875124 TTTGGGGGTGGGAGGGCAGACGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160479310 18:79224393-79224415 CTGTGGGGTGGAAAGCAAGTGGG + Intronic
1160543114 18:79636139-79636161 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1160706086 19:531083-531105 CTGAGGGGTGGGAGGGGCGAGGG - Intergenic
1160718177 19:585796-585818 CACTGGGGTGGGGGGTAAGAGGG - Intergenic
1160745102 19:707765-707787 CAGGGGGGTGGGGGGGAATAAGG + Intergenic
1160970403 19:1765364-1765386 CTGCTGGCTGGGAGGGAGGATGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161313482 19:3607333-3607355 GGGTGGGGTGGGAGGACAGAGGG + Intergenic
1161366256 19:3881428-3881450 CTGTGGGGTGGGGAGGAAGGGGG + Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161424252 19:4193830-4193852 CCGTCGGGAGGGAGGGAGGAAGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162100693 19:8336837-8336859 CCCTGGGGTAGGAGGGAGGAGGG + Intronic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162549372 19:11350077-11350099 CCTTGGGGTGGGAGGAAGGAGGG - Intronic
1162565773 19:11445321-11445343 CTGTGGGGTGCGGGGGCTGATGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1162866097 19:13548153-13548175 ATGGTGGGTGGGATGGAAGAGGG + Intronic
1162954535 19:14090868-14090890 CGTGGGGGTGGGAGGGAGGAAGG - Intronic
1163107296 19:15132346-15132368 GTGGGGGGTGGGACGGAAGTGGG - Intergenic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1163129803 19:15265363-15265385 CTGTGGGGTGGCCGCGATGATGG + Exonic
1163620616 19:18357624-18357646 CTGTGGGGTGGGAGTGAGTGGGG + Intronic
1163741250 19:19014390-19014412 TTGTGGGGTGTGAGGGTGGAAGG + Intronic
1163741706 19:19018102-19018124 TTGTGGGGTGTGAGGGTGGAAGG - Intronic
1163779552 19:19239383-19239405 GGGAGGAGTGGGAGGGAAGATGG - Intronic
1164467861 19:28503228-28503250 TTGTGGGGTGGGCTGGAAAATGG + Intergenic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165221018 19:34316956-34316978 CTGTGGGGTGGCAGTAAGGAGGG - Intronic
1165249117 19:34515524-34515546 CGGGGGGGGGGGGGGGAAGAAGG - Intergenic
1165311042 19:35029838-35029860 GAGTGGAGTGGGAGGAAAGAGGG + Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1165834086 19:38743883-38743905 CTCTGGGGTCTGAGGGAGGAGGG - Intronic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166040306 19:40198352-40198374 CTGTGGGGTGGGAAGAAAGGTGG - Intronic
1166047695 19:40238995-40239017 GTGGGAGGTGGGAGGGAGGAGGG + Intronic
1166117290 19:40663621-40663643 CCTGGGCGTGGGAGGGAAGATGG + Intergenic
1166193188 19:41189514-41189536 ATCTACGGTGGGAGGGAAGAGGG - Intergenic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166744110 19:45131900-45131922 CTGTGGGGTCGCAGGCAACAAGG - Intronic
1166824059 19:45598499-45598521 AGGAGGGGTGGGAGGGAGGAGGG - Intronic
1166975629 19:46603515-46603537 ATGAGGTGGGGGAGGGAAGAGGG - Intronic
1167044198 19:47040421-47040443 CTGGGGGGTGACAGAGAAGAGGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167158685 19:47754504-47754526 CTGAGGGGCGGGAGTGAGGATGG - Intronic
1167248814 19:48390263-48390285 CTCTTGGGTCTGAGGGAAGAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167685330 19:50952552-50952574 CTCTGGGGTGGGAGGGTTGTGGG - Intronic
1167744867 19:51344858-51344880 CAGTGAGGTGGGTGAGAAGAAGG - Intergenic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168328773 19:55553894-55553916 GGGAGGGGTGGGAGGGAAGGAGG - Intergenic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
1202715065 1_KI270714v1_random:37869-37891 CTGTGCGGTGGGAGGGAGGGAGG - Intergenic
925089059 2:1138506-1138528 CTGTGGGGTGGGGGCGGAGGTGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925604994 2:5650515-5650537 CTGTGGAGTGATATGGAAGAAGG + Intergenic
926119269 2:10232738-10232760 CTGTGTTGTGGGAGAGAAGGTGG + Intergenic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
927004208 2:18831108-18831130 ATGTGGGGTGGCAGTGAACAGGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927316017 2:21683937-21683959 TTTTGGGGTGGGATGGAATAGGG + Intergenic
927675632 2:25103830-25103852 CTGGGGGGTGGCAGGGGAGAGGG + Intronic
927726165 2:25424967-25424989 CTGTGGGATGGGAGATAATAGGG - Intronic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927827551 2:26319121-26319143 AGATGGGATGGGAGGGAAGAGGG + Intronic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928314955 2:30237838-30237860 CTGTGGGGTGGGTGAGTAAATGG + Intronic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
928894397 2:36243996-36244018 CTGTGGCGTGGTAGGCAAGATGG - Intergenic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
929010946 2:37443528-37443550 ATTTGGGGTGGGAGTGAGGAAGG + Intergenic
929310039 2:40413043-40413065 GTGTGAGGTGAGAGGGAGGAGGG - Intronic
929317162 2:40493342-40493364 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929688571 2:44055870-44055892 CTGAGGTGTGGGAGCCAAGACGG - Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930393458 2:50790120-50790142 GTGTGTGGTGGGAGGGAATAAGG - Intronic
931232100 2:60383607-60383629 CGTTGGGGAGGGAGGGAACACGG - Intergenic
931241972 2:60461792-60461814 CCGGGGGCTGGGAGGGAGGAGGG + Exonic
931288191 2:60850081-60850103 CTGTGGTGTGGGAGGGATCCAGG - Intergenic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
931846788 2:66212213-66212235 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
931929938 2:67120837-67120859 TTGTGGGGTGGGGGGGATGGGGG - Intergenic
932010902 2:67976495-67976517 GTCAGGGGTGGGAGGGGAGATGG + Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932224108 2:70025527-70025549 CCATGGGGTGGGAGGAAAGGAGG + Intergenic
932234916 2:70113166-70113188 CAGTGGGGTGGGAGTGGAGGTGG - Intergenic
932283599 2:70514913-70514935 CTGTTGGGTGGAGGAGAAGAGGG + Intronic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932417844 2:71584421-71584443 CTGTGGGGTGGGATGGAATGGGG - Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932572643 2:72946057-72946079 CTGTGGGGTGGGAGGAGGGCAGG - Intronic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
932892975 2:75611985-75612007 ATGAGAGGTGGGAGGGAAGACGG - Intergenic
933037201 2:77414800-77414822 CTATTGTGTGCGAGGGAAGATGG - Intronic
933648467 2:84830787-84830809 CTCTGGGGTGAGGGGGAACAGGG + Intronic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
933743263 2:85551725-85551747 CCATGTGGTGGGAGGGGAGAGGG - Intronic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
934237228 2:90243626-90243648 CTGTTGGGTGGCAGGGTAGGGGG - Intergenic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934571255 2:95374667-95374689 AGGTGGGGTGAGAGGGAGGAGGG - Intronic
934706433 2:96484837-96484859 GTGGAGGGTAGGAGGGAAGATGG - Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
935131660 2:100265311-100265333 CTGTGGGGAGGGAGGGCTTAGGG - Intergenic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935626249 2:105174492-105174514 ATGGGGGCTGGGAGGGAAGGAGG + Intergenic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936080415 2:109429098-109429120 CTGAGAGGTGGGAGGGAGGCAGG + Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
938218189 2:129541044-129541066 TTGTAGGGTGGGGGGGAGGAGGG + Intergenic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938473866 2:131590237-131590259 CTTTGGTGTGGGAGGAAAAATGG - Intergenic
938493096 2:131776197-131776219 CTGTGGGCTGGGACGGCAGCTGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
938837092 2:135115940-135115962 CTGTGGGGTTGGGGGGAATGGGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939261809 2:139820429-139820451 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
941135683 2:161715492-161715514 CTGAGGGGTGTGTGAGAAGAGGG - Intronic
941377483 2:164749964-164749986 CTGAGGAGTGGCAGTGAAGAAGG - Intronic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
942042642 2:172081162-172081184 GTGTGGGGTGGGTGGGGGGAGGG - Exonic
942326055 2:174778076-174778098 CTTGGGGATGGCAGGGAAGAAGG - Intergenic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942545417 2:177058264-177058286 CTTTGGGGTGGGAGGGTGGCGGG + Intergenic
942850244 2:180475732-180475754 CTGAGTGGTGGAAGAGAAGAGGG - Intergenic
943195109 2:184736577-184736599 CTGTTGGGTGGTGGGGACGAGGG + Intronic
943208998 2:184938607-184938629 CTAGGGGGTGGGAGGGCAGCTGG - Exonic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943665324 2:190602867-190602889 CTGAAAGGTGGGAAGGAAGAGGG + Intergenic
943896779 2:193372877-193372899 AGGTGGTGTGGGAGGGAAGTTGG - Intergenic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
945760548 2:213908918-213908940 TTGTGTGGTGGGGGGGAGGAGGG - Intronic
945869862 2:215215316-215215338 ATGTGGGGTGGGAGAGGAAAGGG + Intergenic
946045820 2:216820064-216820086 GTGTGGGGTGGGCAGGATGATGG + Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946180671 2:217947158-217947180 CATTGGGGTGGGAGGGAGGGAGG - Intronic
946242377 2:218364589-218364611 TTGGGGGGTGGGAGGTAAGGTGG - Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946317607 2:218928094-218928116 CCCTGGGGTGGGAGGGAGCATGG + Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946954806 2:224917554-224917576 GTTAGGGGTGGGAAGGAAGAAGG + Intronic
947429143 2:230010377-230010399 CAGTGGGGTGGGGGTGAAGGTGG + Intronic
948024411 2:234765383-234765405 CTGTAGGGTGTGAGGGGAGGAGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948375733 2:237519180-237519202 TTTTGGGGTGGGAAGCAAGAAGG + Intronic
948660820 2:239505540-239505562 CTGAGGGGTGGAGGGGCAGAGGG - Intergenic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1169955917 20:11102520-11102542 CTGTGGGGTGGGAGAAAACCAGG + Intergenic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170508428 20:17052895-17052917 TTTGGGGGTGGGAGGGTAGAAGG + Intergenic
1170792064 20:19516603-19516625 ATGTGGGGTGGGATGGCTGAAGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171395308 20:24829264-24829286 CTGTGGGGTGGCTGGGAGGAGGG + Intergenic
1171411988 20:24953671-24953693 ATGCGGGGTGGGAGGGGAGGTGG - Intronic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172179009 20:32989402-32989424 GGGTGGGGTGGGAGGGAACACGG - Intronic
1172274872 20:33673998-33674020 CTGAGGGGTGGGAGGCAGCAGGG + Intronic
1172429385 20:34876909-34876931 CTGAGGGGTGGGTGAGGAGATGG + Intronic
1172834215 20:37862658-37862680 CAGAGGGGTGGGAATGAAGATGG - Intronic
1172904472 20:38358650-38358672 CTGGGGGCTGGGAGGGCAAAGGG - Intronic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173826878 20:46053471-46053493 GTGAGGAGTGGGTGGGAAGAGGG + Intronic
1174177398 20:48653609-48653631 CTCTGGGGTGGGAGGGGTGGAGG - Intronic
1174460409 20:50678397-50678419 CTGTGGGGTGGGGTGGGAGGTGG - Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175257247 20:57654933-57654955 GTGTGGGGTGGGGGGCATGAGGG - Intronic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175953872 20:62598068-62598090 CTGCTGGGGGGGATGGAAGATGG + Intergenic
1175983751 20:62754163-62754185 AGCTGGGGTGGGAGGGAGGAAGG + Intronic
1176062873 20:63179898-63179920 CTGGGGTGGGGGTGGGAAGATGG - Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176373772 21:6077351-6077373 CAGAGTGGTGGGTGGGAAGAAGG + Intergenic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177649248 21:23939443-23939465 TGGTGGGGTGGGAGGAAGGAGGG - Intergenic
1177708235 21:24736979-24737001 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1177925938 21:27215319-27215341 GTTTGGGGTGGGAGTGGAGAAGG + Intergenic
1178242637 21:30920364-30920386 TTGGGAGGTGGGAGAGAAGAGGG + Intergenic
1178337782 21:31759341-31759363 CTTTGAGGCGGGAGGGAAAAAGG - Intergenic
1178640577 21:34342281-34342303 CAGCGAGGTGGGAGGGAAGGAGG + Intergenic
1178788161 21:35673606-35673628 CTGTGGGGTGGGTCAGAGGAGGG + Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179357383 21:40673204-40673226 CTGTGAAGTGGAAGGAAAGATGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179452713 21:41476473-41476495 TGGGGGCGTGGGAGGGAAGAAGG - Intronic
1179578272 21:42321277-42321299 CTTTCTGGTGTGAGGGAAGAGGG + Intergenic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179749705 21:43460892-43460914 CAGAGTGGTGGGTGGGAAGAAGG - Intergenic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180125687 21:45788538-45788560 CCGTGGGGTGGGAAAAAAGAGGG - Intronic
1180474174 22:15688188-15688210 CTTTGGTGTGGGAGGAAAAATGG - Intergenic
1180624231 22:17183402-17183424 CTGTGGGGTCAGAGAGACGAAGG - Intronic
1180694827 22:17744924-17744946 GAGAAGGGTGGGAGGGAAGATGG + Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181062136 22:20286609-20286631 CTGTGGGGTGGGGGTGCAGCTGG + Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181356546 22:22299535-22299557 CTGTTGGGTGGCAGGGTAGGGGG + Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181782710 22:25204753-25204775 CTGCGGGGTGTGAGTGAAGCAGG - Intronic
1181938693 22:26458009-26458031 TCATGGGGTGGGAGGGCAGAAGG - Intronic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182045884 22:27273911-27273933 CGGTGGGGTGGGGGGGAGGGGGG - Intergenic
1182146572 22:28000457-28000479 CTGTGGGGTATTAGGGCAGATGG + Intronic
1182420956 22:30248345-30248367 GTGTGGGGTGAGAGGCAGGAAGG - Intergenic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183101389 22:35586211-35586233 CTATGGGGTTGGAGGGATTAAGG - Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1184112324 22:42402543-42402565 CTATGGGGTGGGACAGAACAAGG + Intronic
1184156379 22:42670164-42670186 TTGGGGGGTGGGAGTGAAGGGGG + Intergenic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184595903 22:45514159-45514181 CTGAGGGGTGGGAGTGGAGTTGG + Intronic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1184742997 22:46439920-46439942 GTGAGGGGTGGGAGGGCGGACGG - Intronic
1184840665 22:47050751-47050773 CCTTGGGGTGGGTGGGATGAGGG + Intronic
1184843394 22:47065853-47065875 GCGTGGGGTGGGAAGGAAGGAGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185342220 22:50296798-50296820 CGGTGGGGTGGGAGGAGAGTGGG - Intronic
949606800 3:5662267-5662289 CAGTGGGGTGGGGTGGAAGGAGG - Intergenic
949608969 3:5684186-5684208 AGGTGGGGTGGGAGGGCAGGTGG + Intergenic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950610484 3:14123904-14123926 CTTTGGGGTGGGAGGTAGGCAGG + Intronic
950761682 3:15235550-15235572 CTGGGGGGTGGGTGGGAGCATGG + Intronic
950950816 3:16996376-16996398 CTGGAGGCTGGAAGGGAAGAGGG - Intronic
951095672 3:18626987-18627009 CTGTTGGTTGGGAGGTAAAATGG + Intergenic
951485499 3:23204130-23204152 AAGTGGGGTGGGCGGGAAGGGGG - Intronic
951831174 3:26928907-26928929 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
951889610 3:27556129-27556151 GTGGGGGGTGGGAGGGAGGGAGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952261738 3:31746820-31746842 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952887227 3:38019158-38019180 CTGAGGTGTGGGTGGGGAGATGG - Intronic
953026690 3:39149325-39149347 TTCTGGGGTGGGAGGTAGGAAGG + Intronic
953216599 3:40924183-40924205 TTGGAGGGTGGGAGGGAGGAGGG + Intergenic
953291574 3:41669372-41669394 CTTTGGGGTGGGAGTGGGGAGGG - Intronic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953462262 3:43090815-43090837 CACTGGGGTGGCAGGGAGGAAGG + Intronic
953935371 3:47037275-47037297 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
954291417 3:49652028-49652050 CTGGGGGCTGGGGTGGAAGAGGG - Exonic
954295987 3:49674662-49674684 CACTGGGGTGGGAAGGAAGGGGG + Intronic
954519747 3:51214261-51214283 CTTGGGGCTGGGAAGGAAGATGG + Intronic
954710094 3:52501343-52501365 CTGTGGGGTGGCAGGGACTCGGG + Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954784714 3:53084411-53084433 ATGTGGGGTGGGAGAGCAGGGGG - Intronic
954835014 3:53458818-53458840 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
955618381 3:60833784-60833806 GGGTGGAGTGGGAGGGAAGTGGG - Intronic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
956191241 3:66610341-66610363 CTGGTTGGTGGGAGTGAAGAGGG + Intergenic
956305420 3:67819125-67819147 GTGTGGGGTGGGCGGGAAGCAGG + Intergenic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956588867 3:70892623-70892645 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
956754067 3:72368167-72368189 CTGTGGAGTGCGAGGTAGGAAGG + Intergenic
956976785 3:74589954-74589976 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957084466 3:75667730-75667752 AGGTGGGGGGGGAGGGAGGAAGG + Intergenic
957150314 3:76478172-76478194 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957367299 3:79242977-79242999 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958635582 3:96739950-96739972 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
959119657 3:102217572-102217594 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
959254524 3:103992059-103992081 CAGTGGGGTGGGGGTGGAGATGG + Intergenic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960209171 3:114938666-114938688 CTGTCGGGTGGTGGGGAAGTAGG + Intronic
960486866 3:118263295-118263317 ATGTGGGGTGTGGGGGATGAAGG - Intergenic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961384583 3:126516503-126516525 CTGGGGGGTGGGAGGGTAGGTGG - Intronic
961414797 3:126749394-126749416 CTGTGGGGTGAGAAAGAAGGAGG + Intronic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961810598 3:129519545-129519567 CTGCAGGGTGGGCGGGAAGGAGG - Intronic
961816206 3:129551753-129551775 CTGAGGGGTGGGATGAAAGGAGG + Intergenic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962973499 3:140426274-140426296 CTGTCAGGTGGCAGGGAGGAGGG - Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964271358 3:154959704-154959726 CTATGGGATGGGATGGGAGAAGG + Intergenic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965728159 3:171742169-171742191 GACTGGGGTGGGAGGAAAGATGG + Intronic
966159391 3:176951980-176952002 GTTTGGGGTGGGAGGGAGTAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966914726 3:184578391-184578413 CTGTAGGGTGGCAGGGTGGAGGG - Intronic
967345355 3:188449331-188449353 CTGTGAGGTGGAAGGGAGAATGG - Intronic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
968262337 3:197335388-197335410 GTGGGGAGTGGGAGGCAAGAGGG + Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968373377 4:15948-15970 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968702954 4:2065331-2065353 CCTTGGGCTGGGTGGGAAGAGGG + Exonic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969278048 4:6150278-6150300 AGGTTGGGTGGGAGGGAAGCTGG - Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969421786 4:7101857-7101879 GTGTGGGGTGGGAGTGGGGAAGG + Intergenic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
969520713 4:7676275-7676297 AGGTGGGGTGAGAGGGCAGAGGG - Intronic
969569550 4:8000635-8000657 CTGTGGGGTGGGGGACATGAAGG - Intronic
969658022 4:8509217-8509239 GAGTGGGGTGGGAGGGAGGGAGG + Intergenic
969680004 4:8637599-8637621 CTGTGTGGTGGGCGGGGAGCTGG + Intergenic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970609212 4:17709684-17709706 CTGGGGTGTGGGAGGGCTGAGGG + Intronic
970714305 4:18904138-18904160 GTGGGGGGTGGGGGAGAAGAAGG - Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
972503536 4:39698706-39698728 CTGTGGGGTGGGGAGGGAGCAGG + Intronic
972676146 4:41261433-41261455 GAGTGAGGTGGGAGGGAAAAAGG + Intronic
972726048 4:41746995-41747017 TTGGGGGGCGGGAGGGGAGAAGG + Intronic
972843513 4:42959424-42959446 GTGGGGGATGGAAGGGAAGAAGG + Intronic
972960755 4:44448852-44448874 CCGTGGGGAGGGCGGGAGGAGGG + Intergenic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
973856818 4:55019740-55019762 GTGTGGGCTGGGAGGTGAGAAGG - Intergenic
973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG + Exonic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
973903159 4:55498703-55498725 CTGTGGAGTGGCAGGGGAGATGG + Intronic
974646832 4:64705172-64705194 TTGTGGGGTGTGAGGGGGGAGGG + Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975515307 4:75240834-75240856 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
975767789 4:77687188-77687210 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
975923582 4:79422193-79422215 TTGTGGGGTAGGAGGGAGAATGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977463489 4:97355773-97355795 GTGTCAGGTGGGAAGGAAGAGGG - Intronic
977643412 4:99383458-99383480 TTGTGGAATGGGAGGGAAAAAGG - Intergenic
977828285 4:101559183-101559205 TTATGGGGTGGGAGAGAGGAGGG + Intronic
977918377 4:102618148-102618170 TTGTGGGGTGGGGGGGGAGGGGG + Intergenic
977955240 4:103019024-103019046 GTTTGGGGTGGGGGGCAAGATGG - Intronic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
978174808 4:105716987-105717009 TTGAGGGGTGGGAGAGAATAAGG + Intronic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978859534 4:113431600-113431622 CACTGGAGTGGGAGGGGAGACGG + Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
980850754 4:138378482-138378504 CTGTTGGGTGGGGGGACAGAAGG + Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981830256 4:148991549-148991571 CTGGGGGGTGGTTGGGAAGTGGG + Intergenic
982233908 4:153234303-153234325 TTCAGGGGTGGGAGGAAAGAAGG + Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982994353 4:162322255-162322277 CTGCGAGGTGGAAGGGAAGATGG - Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984906338 4:184630286-184630308 ATGTGGAGTGGGAGAAAAGAAGG - Intronic
985073348 4:186190426-186190448 CTATGGAGTGGGAATGAAGATGG - Intergenic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985151864 4:186955401-186955423 GTTAGGGGTGGGAGTGAAGATGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985308276 4:188568347-188568369 TTGTGGGGTGGGAGGGAGTGGGG - Intergenic
985462019 4:190116620-190116642 TTGTGGGGTGGGGGGGGAGGGGG - Intergenic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
985672417 5:1213424-1213446 ATGTGGGATGGGCGGGAAGTTGG - Intronic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986323221 5:6650787-6650809 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987750285 5:22030110-22030132 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
987893826 5:23918545-23918567 TTGTGGGGTGGGGGGAAGGAGGG + Intergenic
987948316 5:24644514-24644536 TTGAGGGGTGGGGGGGGAGAGGG - Intronic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988086567 5:26481897-26481919 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989192111 5:38680694-38680716 CTTTGGGGTGGGATGGGGGATGG - Intergenic
989254196 5:39349018-39349040 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
990236427 5:53772830-53772852 ATGTGGGATGGGCGGGAGGAGGG + Intergenic
990304036 5:54477523-54477545 CTGTTGGGTGGGGGGAAAGGGGG + Intergenic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
990771819 5:59255399-59255421 CTGTGGGGTGGAAGGGAGGCAGG + Intronic
991436796 5:66604430-66604452 ATGGTAGGTGGGAGGGAAGATGG + Intronic
991592147 5:68264656-68264678 CTGTGGGGTGGGAGGAGTTAGGG - Intronic
991611568 5:68454982-68455004 CTTCAGAGTGGGAGGGAAGACGG + Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
991724141 5:69519294-69519316 CTGAGAGGTGGGAGGGCAGGAGG - Intronic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992397063 5:76378120-76378142 CTGCGTGGTGGCAGGGAAGAGGG + Intergenic
992526355 5:77614643-77614665 TTGTGGGGTGGGGGGGGAGGGGG + Intronic
992874072 5:81034796-81034818 TTGTGGGGTGGGAGGGGGGTAGG + Intronic
992950413 5:81852297-81852319 CTGTGGGGTGGGCGGGGGGGTGG + Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993223747 5:85137966-85137988 TGGTGGGGTGGGAGGGGGGACGG - Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994369831 5:98955437-98955459 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994526227 5:100908423-100908445 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994793684 5:104265666-104265688 GGGGTGGGTGGGAGGGAAGATGG - Intergenic
995029723 5:107466432-107466454 CTGAGGTGTGGGAGTGGAGAAGG - Intronic
995723608 5:115163482-115163504 CTGTGGGCTGGGATGGTAGTGGG - Intronic
996045223 5:118864377-118864399 TTGTGGGGTGGGGGGAAGGAGGG + Intronic
996241438 5:121208109-121208131 CTGTCGGGTGGGGGGGAGGGGGG - Intergenic
996299502 5:121964340-121964362 CTGTCGGGTGGGGGGAAAGGGGG - Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997321816 5:132983941-132983963 CCGTGGGGGGGGGGGGGAGAGGG + Intergenic
997719920 5:136070100-136070122 CTCTGGGCTGGGAGGAAAGGGGG + Intergenic
997879286 5:137574954-137574976 ATGTGTGGTGGGATGGTAGAGGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998247509 5:140520776-140520798 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
998309325 5:141111507-141111529 TTGTGTGGTGGGAGGGGGGAGGG - Intronic
998326012 5:141280420-141280442 GGGTGGGGTGGTAGGGGAGAGGG - Intergenic
998368067 5:141644059-141644081 CTATGGGGGGGCAGGGAAAAGGG - Intronic
998383380 5:141741734-141741756 CTGGGAGGTGGGAGGGAGGGAGG + Intergenic
999093521 5:148958158-148958180 CAGTGGGGTGAGAGTCAAGAAGG + Intronic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
999548115 5:152654104-152654126 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1000400290 5:160818999-160819021 CTGGGGGGTGGGAGTGGGGACGG + Intronic
1000929661 5:167236009-167236031 TTGTGAGGTGGGAGGAAGGAAGG - Intergenic
1001157235 5:169283320-169283342 TGGCGGGGTGGGAGGGAAGCAGG + Intronic
1001203575 5:169741435-169741457 TTGTGGGGTGGGAGGGAGAGAGG + Intronic
1001382297 5:171312483-171312505 CTGGGGGGTGGGAGGCAGGGTGG + Intergenic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1002073937 5:176697051-176697073 CTGTGTGGTGGGAGTGAGCATGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1003121699 6:3323541-3323563 CCGTGGGGTGGGTAGCAAGAAGG + Intronic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003456977 6:6292355-6292377 GTGAGGGGTGGAAGGGAGGAGGG - Intronic
1003458440 6:6306660-6306682 AGGTGGGGTGGGAGGGTAGAAGG + Intronic
1003487072 6:6588949-6588971 AGTTGGGGTGGGAGGGGAGAGGG + Intronic
1003829181 6:9987817-9987839 CTGAGGTGGGGGAGCGAAGATGG + Intronic
1004176055 6:13341145-13341167 AGGTGGGGTGTGAGAGAAGATGG + Intergenic
1004459019 6:15818227-15818249 CTGTGGGGTGGCAGGCCAGAGGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004717712 6:18234184-18234206 TTGTGGGGTGGGGGGGACGGGGG + Intronic
1004757482 6:18628538-18628560 ATTAGGGGTGGGTGGGAAGAGGG + Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005177642 6:23064813-23064835 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005419599 6:25635251-25635273 CTATGGGCTGGGAAGAAAGATGG - Intergenic
1005487823 6:26317943-26317965 CTGTGAGGTGAGAAGCAAGACGG + Intergenic
1005856312 6:29865632-29865654 CTGTACACTGGGAGGGAAGATGG + Intergenic
1005980280 6:30831241-30831263 CTGGGGAGTGGGAGGGGAGGAGG - Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006136523 6:31899522-31899544 TTGGGGGGTGGGTGGGAACAGGG - Intronic
1006173259 6:32107590-32107612 CTGTGGGGAGGGTGCCAAGAGGG - Intronic
1006294712 6:33165037-33165059 GGGAGGGCTGGGAGGGAAGAGGG - Intronic
1006401482 6:33820487-33820509 CTGTGGGGTGACAGGGATCACGG + Intergenic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006735556 6:36270343-36270365 CTCCGGGGTGGCAGGGAAGCTGG + Intronic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006909698 6:37555849-37555871 AGGTGGGGTGGGTGGGGAGACGG + Intergenic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007697792 6:43744636-43744658 CGCTGGGGTGTGAGGGAGGAAGG + Intergenic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007867376 6:44987290-44987312 GCGGGGGGTGGGTGGGAAGAGGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008503233 6:52204418-52204440 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1008596949 6:53052046-53052068 TTGTGGGGTAGGTGGGACGAGGG - Intronic
1008649213 6:53546046-53546068 CTCTGTAGTGCGAGGGAAGAGGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009054223 6:58316167-58316189 CAGAGGGGTGGGTGGCAAGATGG + Intergenic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009869770 6:69439685-69439707 TTGTGGGGTGGGTGGGAGGGGGG - Intergenic
1009970057 6:70616178-70616200 TTGTGGGGTGGGAGTGGAGTGGG - Intergenic
1010444957 6:75939344-75939366 TTGTGGGGTGGGGGGGAGCAGGG - Intronic
1010782521 6:79960077-79960099 TTGTGGGGTGGGTGGGGGGAGGG + Intergenic
1010877296 6:81123392-81123414 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012380325 6:98613252-98613274 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1012807895 6:103918026-103918048 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012840558 6:104324314-104324336 CTTTGGGGTGGCAGGGGGGAGGG - Intergenic
1012939961 6:105404911-105404933 AGATGGAGTGGGAGGGAAGATGG + Intergenic
1013032986 6:106354464-106354486 TTGTGTGGTGGGGGGGAAGGGGG - Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014015884 6:116529448-116529470 CTGTAGGGTGGGAAGCAGGAGGG - Intronic
1014973445 6:127848063-127848085 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1015080521 6:129219824-129219846 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015975077 6:138782075-138782097 CTCAAGGGTAGGAGGGAAGAAGG - Intronic
1016608305 6:145960388-145960410 ATGGGGGGTGGAAGGGTAGAGGG + Intronic
1017193242 6:151675486-151675508 CGGTGGGGAGGAGGGGAAGAAGG - Intronic
1017198029 6:151723219-151723241 CTGAGGGGTGGGAGGGGAAGAGG + Intronic
1017910509 6:158788324-158788346 CTTTTGGGTGAGTGGGAAGAGGG - Intronic
1018093989 6:160368636-160368658 CTGTGGTGTGGCGGGGATGATGG - Intronic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018207263 6:161447097-161447119 GTGTGGGGTGAGAAGGAAAATGG - Intronic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018826357 6:167410328-167410350 CTGTGGTGTGGATGGAAAGAAGG - Intergenic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018923766 6:168193149-168193171 CCGTGGGGTGGGAGAGAGGACGG + Intergenic
1019049135 6:169169966-169169988 CTGTGGGGTAGGAGGGGTGGGGG - Intergenic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020270050 7:6589658-6589680 CTGGGGGGTACGGGGGAAGATGG - Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020438913 7:8196614-8196636 TTGTGGGGTGGTTGGGAAGCGGG + Intronic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1020875935 7:13693841-13693863 CTGAGGGGTGGGAGTGGTGAAGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021223779 7:18004689-18004711 ATGTAGGGTGGTTGGGAAGACGG + Intergenic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1021907296 7:25347695-25347717 CTGTGAGGTAGGAGGGAATTGGG + Intergenic
1022013383 7:26328538-26328560 GTGTAGAGTGGAAGGGAAGAGGG + Intronic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022340524 7:29463421-29463443 CTGTGGGGTGGGTGGAAGCATGG - Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022585330 7:31603396-31603418 CTGTGGAGTGGGTGGGGAGGGGG - Intronic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1024020332 7:45362555-45362577 CTATGGGGTGGGAGTGGGGATGG + Intergenic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1024208608 7:47184821-47184843 CTCTGGGGTGGGAGAGGAGGAGG + Intergenic
1024482966 7:49884166-49884188 ATGGAGTGTGGGAGGGAAGAAGG + Intronic
1024847347 7:53662377-53662399 CTGTGGGGTTAGAGTGAAGGAGG - Intergenic
1025886273 7:65597043-65597065 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1026033547 7:66815634-66815656 CTAGGGGGTGGGAGGGTACAGGG - Intergenic
1026189628 7:68112961-68112983 GTGTGGTGTGGGAGGGTTGAAGG + Intergenic
1026461892 7:70621582-70621604 TTGAGGGGTGGGAGGGTAGGAGG + Intronic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1026994365 7:74606172-74606194 CTAGGAGGTGGGAGGGAGGAAGG - Intergenic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1027846590 7:83385626-83385648 CTATGGGGTGGGACAGAAGTAGG + Intronic
1027967943 7:85038043-85038065 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029045984 7:97629228-97629250 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029426038 7:100494451-100494473 CTGTGGGGTGGCATGGACGGCGG - Exonic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029459690 7:100687661-100687683 CTGTGGGGTGGGGGTGGAGGTGG - Intronic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029909368 7:104128669-104128691 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030590157 7:111470721-111470743 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1030621400 7:111795002-111795024 TTGAGGGGTGGAAAGGAAGAGGG + Intronic
1031651652 7:124298848-124298870 ATGGGGGGTGAGAGGGAGGAGGG - Intergenic
1031808893 7:126341201-126341223 GTGTGCTGTGGGAGGGAGGAGGG - Intergenic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1032926619 7:136613397-136613419 TTGTGGGGTGGGGGGAAAGGGGG + Intergenic
1032969239 7:137139614-137139636 TTGTGGGGTGGGAGGAGAGGGGG + Intergenic
1033220610 7:139524291-139524313 GGGTGGGGTGGGAGGGAACCGGG + Intronic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1034108938 7:148517525-148517547 CTGTTGGGTGGTAGGGGGGAAGG - Intergenic
1034277166 7:149829047-149829069 GTGTGGGGTGGCAGGGGAGAAGG - Intergenic
1034286607 7:149887768-149887790 CTGTGTTGTGGGAGGGACCAGGG + Intergenic
1034297831 7:149990058-149990080 GTGTGGGGAGGGATGGATGAAGG - Intergenic
1034429790 7:151035558-151035580 CTAGGGAGTGGGAGGGAAGGCGG - Intronic
1034628692 7:152514056-152514078 GTGGAGGGTGGGAGGGAAGGAGG - Intergenic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035058169 7:156050659-156050681 CTGTGAGGTGGGACAAAAGAAGG + Intergenic
1035292019 7:157845361-157845383 CTGTGGCGTGGCCGGGAACATGG - Intronic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1036663699 8:10725635-10725657 CTGAGCGGTGGGAGGAAAGCTGG + Exonic
1036707169 8:11054707-11054729 CTGGTGGGTGGGAAGGAGGAAGG + Intronic
1036723816 8:11201380-11201402 CGGCGGGGGGGGGGGGAAGAAGG + Intergenic
1036748553 8:11428247-11428269 CTGTGGGGTAGCAGGAAGGAAGG + Intronic
1036769026 8:11566094-11566116 CTGTGGGGTGGGGCTGAGGAGGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037427281 8:18770111-18770133 CTGTGAGGTTGGAGGGAAACTGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038271680 8:26080865-26080887 TTGGGTGGTGGCAGGGAAGATGG - Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038539987 8:28384357-28384379 CTGTGAGGTGGGAATGAACATGG - Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1038691094 8:29764333-29764355 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1038699180 8:29834231-29834253 CTGTTGAGGGGGTGGGAAGAGGG - Intergenic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1039533205 8:38283397-38283419 GTGGGGGGTGGGAGGGAGAATGG - Intronic
1039539823 8:38356042-38356064 CTGGGGAGTGGGAGTGGAGAAGG - Intronic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1039679204 8:39710673-39710695 GGGTGGGGTGGGAGGAAAAAGGG + Intronic
1039913534 8:41843404-41843426 GTGTGGGGTGGGCGGGGAGTGGG - Intronic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041547414 8:59061557-59061579 CTATGGGGTGGGGGAAAAGAGGG - Intronic
1041696351 8:60741226-60741248 GTTTGGGGTGGGGGAGAAGAAGG - Intronic
1041698524 8:60762828-60762850 CAGAGGAGTGGGAGCGAAGAGGG + Intronic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041791114 8:61697285-61697307 CTGTGGGGTGAGAGTACAGAAGG - Intronic
1041992033 8:64005000-64005022 CTGAGGGGTGGGAGAGAAAATGG - Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042586848 8:70349008-70349030 GTGGGGGATGGGAGGGAAAAGGG + Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043171586 8:76972827-76972849 CAGTGGGGTGGGGGCCAAGATGG - Intergenic
1043403503 8:79906914-79906936 TTGTGGGGTGGTAGAGATGAGGG + Intergenic
1044144260 8:88692048-88692070 TTGTGGGGTGGGAGGAGGGAGGG - Intergenic
1044281317 8:90360478-90360500 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1044444093 8:92253548-92253570 TTGTGGGGTGGGCGGGGGGAGGG + Intergenic
1044624957 8:94227841-94227863 TTGTGGGGTGGGTCGAAAGAGGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044880471 8:96718137-96718159 CTGAGGGGTGAGTGGGAAGTGGG - Intronic
1045420093 8:102005875-102005897 TTGTGGGGTGGGGGGGCAGGGGG + Intronic
1045491319 8:102671393-102671415 GGGTGGGGTGGGAGGGAACCTGG - Intergenic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1045974065 8:108111397-108111419 TTGTGGGGTGGGGGGGATGGGGG - Intergenic
1046047413 8:108980773-108980795 CTGTTGGGGGGTAGGGAACAAGG - Intergenic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046323226 8:112605617-112605639 GTGAAGGGTGGGAGGGCAGAGGG + Intronic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047540640 8:125762310-125762332 TTCTGGGGTGGGAGGGATGCGGG + Intergenic
1047661579 8:127043037-127043059 CCTTGTGGTGGGAGGGAACATGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048837789 8:138537628-138537650 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1048987676 8:139743739-139743761 CTGTGGGGTGGGGGGCAGGCAGG + Intronic
1049048933 8:140176315-140176337 CTTTGGGGTGGGACGTTAGATGG - Intronic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1049090791 8:140511963-140511985 CAGTGGGGTGGGCGGGGCGAAGG - Intronic
1049298540 8:141856598-141856620 CTGTGGGCTGGAAGGGCAGGAGG + Intergenic
1049396749 8:142404460-142404482 CACATGGGTGGGAGGGAAGAGGG + Intergenic
1049436269 8:142587548-142587570 CTGTGGAGTGGGAGGGAGTGGGG + Intergenic
1049436288 8:142587597-142587619 CTGTGGAGTGGGAGGGAGTGGGG + Intergenic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049469101 8:142767447-142767469 GTGGGGGGTAGCAGGGAAGATGG + Intronic
1049582286 8:143418227-143418249 CTGAAGGGTGGGTGGGAGGATGG - Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049696663 8:143987304-143987326 CTGAGGGGTGAGTGGGAAGTAGG - Intronic
1049806933 8:144545310-144545332 CTTGGGGGTGGGCGGGAAAAAGG + Exonic
1049871204 8:144978756-144978778 CACTGGTGTGGGAAGGAAGAAGG + Intergenic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050388139 9:5111644-5111666 CTGCTGGGCGGGAGGGACGAGGG - Intronic
1050650161 9:7767293-7767315 TTGTGGGGTGGGAGGAAGGGGGG - Intergenic
1050664654 9:7921776-7921798 GGGTGGGGTGGGAGTGAGGAGGG + Intergenic
1050800863 9:9612327-9612349 TCGTGGGGTGGCAGGGCAGAGGG - Intronic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053364143 9:37511114-37511136 CTGTTGGGTGGGATGGGAGGGGG - Exonic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053551063 9:39079876-39079898 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053815173 9:41899957-41899979 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054615423 9:67287484-67287506 CGGTGGTGTGGGAGGGAGGGTGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1054820391 9:69515956-69515978 CCACGCGGTGGGAGGGAAGATGG - Intronic
1054938522 9:70714635-70714657 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1054940213 9:70732628-70732650 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1055638475 9:78300155-78300177 GCGTGGGGTGGGCAGGAAGAAGG - Intronic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1056246465 9:84700391-84700413 ATGTGTGGTGGGAGGAGAGAAGG + Intronic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057949290 9:99356912-99356934 GAGGGAGGTGGGAGGGAAGAGGG + Intergenic
1058826496 9:108779658-108779680 CTGTGGTGTGGAAGGGAGCAGGG + Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058906734 9:109488065-109488087 GTGTGGGGTCGGGGGGAGGAGGG + Intronic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059299285 9:113299189-113299211 GGGTGGGGTGGGGAGGAAGATGG + Exonic
1059496185 9:114711256-114711278 TTGTGGTGGGGGCGGGAAGAGGG - Intergenic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1060610456 9:124959679-124959701 TTGTGGGGTGGGGGGGATGGGGG - Intronic
1060702671 9:125772000-125772022 CAGTGGGGTGGGAGGTAGGTAGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060817487 9:126642808-126642830 CCCTGGGGTGGAAGGGAAAATGG + Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060946939 9:127575190-127575212 CTGTGAGGTGGGATGGAGCAGGG - Intronic
1061093278 9:128439035-128439057 TGGAGGGGTGGGAGGGGAGATGG + Intergenic
1061132276 9:128714725-128714747 CTGTGGGGTGGCAGGCCTGAAGG + Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061507793 9:131041430-131041452 ATGTGTGGTGGGTGGGAAGATGG + Intronic
1061539524 9:131270566-131270588 CTTTGGGGTGGGAGGAAGTAGGG - Intronic
1061630314 9:131868072-131868094 CTGTGGGGTGCCAGGGTGGAGGG + Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061766902 9:132887262-132887284 ATGTAGGGTGGGAGGGAGTAGGG + Intronic
1062010293 9:134263490-134263512 CCGGGGGGTGGGAGGGCAGCTGG - Intergenic
1062127372 9:134870803-134870825 AGGTGGGGTGGGAGGGAGGTGGG + Intergenic
1062130463 9:134889897-134889919 CTGTCGGGAGGGCTGGAAGAAGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062588647 9:137263281-137263303 CCGGGGAGTGGGAGGGAAGGAGG - Intronic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1185894609 X:3846397-3846419 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185899727 X:3884821-3884843 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185904843 X:3923250-3923272 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186406929 X:9312856-9312878 GTGATGGATGGGAGGGAAGAAGG + Intergenic
1187466462 X:19531960-19531982 CTATGGGGTGGGTGGGAACAGGG + Intergenic
1187533058 X:20113960-20113982 CTGGGGGGTGGGAAGGAGGTAGG - Intronic
1187840689 X:23484327-23484349 CAGTGGGGTGGCTGGCAAGATGG + Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188760161 X:34017799-34017821 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1188851758 X:35140821-35140843 TTGTGGGGTGGGGGGGGAGGGGG + Intergenic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1189573158 X:42321181-42321203 CAGGAAGGTGGGAGGGAAGAAGG + Intergenic
1189939813 X:46109842-46109864 TTGTGGGGTGGGGGGAAGGAGGG + Intergenic
1190020230 X:46867637-46867659 CAGTGGGGTGGGGGGGAATGTGG - Intronic
1190538231 X:51450095-51450117 CTGTGGGGTGAGAGTTAATATGG + Intergenic
1190642844 X:52496402-52496424 CTTTGGGGTGGGGGGGAAGTGGG + Intronic
1190644829 X:52516465-52516487 CTTTGGGGTGGGGGGGAAGTGGG - Intronic
1190686881 X:52882734-52882756 TCATGGGGTGGGAGGGAGGAGGG - Intergenic
1190699101 X:52973058-52973080 TCATGGGGTGGGAGGGAGGAGGG + Intronic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191092263 X:56636005-56636027 CCGGGGGGTGGGAGCCAAGATGG + Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191852803 X:65598233-65598255 AGGTGGGGTCGGGGGGAAGAGGG + Intronic
1192018027 X:67352962-67352984 CTGGGAGGTGGTAGAGAAGAGGG - Intergenic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192597578 X:72427594-72427616 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1193365786 X:80630968-80630990 TAGTGGGGTGGGAGGGAATGAGG - Intergenic
1193659954 X:84245512-84245534 CGGGGGGGTGGAAGTGAAGATGG - Intergenic
1193846888 X:86482987-86483009 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
1194363260 X:92981405-92981427 CTGTGTGGTGGGAGATATGATGG + Intergenic
1194556838 X:95370069-95370091 TTGTGGGGTGGGGGGGGTGAGGG - Intergenic
1194820678 X:98502881-98502903 CTGTGGGGTGTGAGTGAAAAGGG - Intergenic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195409204 X:104550617-104550639 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195578799 X:106478884-106478906 ATATGGGGTGGAGGGGAAGAAGG + Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195724420 X:107899459-107899481 CTTTGGGCTGGGAGGTAATAGGG + Intronic
1195730967 X:107966948-107966970 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1195756135 X:108200602-108200624 GTGTGGGGTGGGGGGAGAGATGG + Intronic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1195950186 X:110262850-110262872 CTTTGGGGTGGGAGGATAAAAGG + Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1196337835 X:114559281-114559303 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1196359000 X:114830841-114830863 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1196621291 X:117827592-117827614 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1196768111 X:119268074-119268096 CTGGGGGGTAGCAGCGAAGATGG - Intergenic
1196777065 X:119348151-119348173 CAGAGTGGTGGGAGTGAAGATGG + Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197395922 X:125927511-125927533 TTGTGGGGTGGGACGGGGGAGGG - Intergenic
1197727840 X:129788122-129788144 GGTGGGGGTGGGAGGGAAGAGGG + Intronic
1197857957 X:130937877-130937899 GTTGGGGGTGGGAGTGAAGAAGG + Intergenic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198071070 X:133148994-133149016 TTGGAGGGTGGGAGGGAAGGAGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198652100 X:138874000-138874022 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1198980083 X:142385736-142385758 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1199253527 X:145692670-145692692 CTGTGGGGTGAAAAAGAAGAAGG - Intergenic
1199336367 X:146622486-146622508 CTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200141986 X:153907000-153907022 CTGAGGAGTGGCAGGAAAGAGGG + Exonic
1200671502 Y:6097654-6097676 CTGTGTGGTGGGAGATATGATGG + Intergenic
1201119887 Y:10864810-10864832 GTGTGGGGTGGAATGGAATAGGG - Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201249802 Y:12045357-12045379 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201438541 Y:13985329-13985351 GTGTGGGGTGGGAGGGAGGGAGG - Intergenic
1201446032 Y:14057379-14057401 GTGTGGGGTGGGAGGGAGGGAGG + Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201570927 Y:15413598-15413620 CAGTAGGGTGAGAGAGAAGAAGG + Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202370994 Y:24195303-24195325 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1202499790 Y:25474814-25474836 GTGGGGGGTGGGAGGGATGGCGG - Intergenic