ID: 912703301

View in Genome Browser
Species Human (GRCh38)
Location 1:111894495-111894517
Sequence TCTTACATGCTGGTGATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912703301_912703306 1 Left 912703301 1:111894495-111894517 CCCACTATCACCAGCATGTAAGA No data
Right 912703306 1:111894519-111894541 CAGGAACTTGGTCTTATTTTTGG 0: 1
1: 0
2: 3
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912703301 Original CRISPR TCTTACATGCTGGTGATAGT GGG (reversed) Intronic
No off target data available for this crispr