ID: 912703908

View in Genome Browser
Species Human (GRCh38)
Location 1:111897954-111897976
Sequence CCGTGTTTATGGAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912703908_912703916 10 Left 912703908 1:111897954-111897976 CCACCTTCCTTCCATAAACACGG 0: 1
1: 0
2: 0
3: 10
4: 160
Right 912703916 1:111897987-111898009 TCTCCAGCCTCATTGGTCCTTGG 0: 1
1: 0
2: 0
3: 26
4: 203
912703908_912703917 11 Left 912703908 1:111897954-111897976 CCACCTTCCTTCCATAAACACGG 0: 1
1: 0
2: 0
3: 10
4: 160
Right 912703917 1:111897988-111898010 CTCCAGCCTCATTGGTCCTTGGG 0: 1
1: 0
2: 2
3: 17
4: 186
912703908_912703913 3 Left 912703908 1:111897954-111897976 CCACCTTCCTTCCATAAACACGG 0: 1
1: 0
2: 0
3: 10
4: 160
Right 912703913 1:111897980-111898002 CTCTCCCTCTCCAGCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912703908 Original CRISPR CCGTGTTTATGGAAGGAAGG TGG (reversed) Intronic
901423889 1:9168969-9168991 CCCTGTGGATGGAAGGAAGTAGG - Intergenic
902498937 1:16895392-16895414 CCATGTTTATGAAAGTAAAGAGG - Intronic
902763395 1:18599141-18599163 CCGGGTTCATGGAAGGCAGTTGG - Intergenic
903455305 1:23483522-23483544 CCGCGTTTGTGGAATGAATGCGG - Intronic
904906759 1:33902981-33903003 CCCTGTGTCTGGCAGGAAGGAGG - Intronic
909512366 1:76468875-76468897 ACATGTGAATGGAAGGAAGGAGG + Intronic
911186255 1:94908025-94908047 GCGTGTTTAAGAAAGGAAGGTGG - Intronic
911951424 1:104177820-104177842 CCCTGTGAATGGAAGCAAGGTGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913567265 1:120084998-120085020 CAGTGTTGATGGAAGATAGGAGG + Intergenic
913630867 1:120708548-120708570 CAGTGTTGATGGAAGATAGGAGG - Intergenic
914288016 1:146245704-146245726 CAGTGTTGATGGAAGATAGGAGG + Intergenic
914549051 1:148696450-148696472 CAGTGTTGATGGAAGATAGGAGG + Intergenic
914617631 1:149375269-149375291 CAGTGTTGATGGAAGATAGGAGG - Intergenic
915166763 1:153952201-153952223 CCGTGTTCATGGCAGGTGGGAGG + Exonic
917278699 1:173358138-173358160 ACGTGATGATGGAAGGAAGTTGG + Intergenic
918251183 1:182704759-182704781 CCTTGATTATGGCAGGGAGGTGG + Intergenic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
919669857 1:200328844-200328866 CCGTGTTCCTGGAAGTAAGAAGG - Intergenic
919776560 1:201198075-201198097 CCATGTTCAAGGTAGGAAGGTGG + Intronic
921250373 1:213291811-213291833 ACGTGTTTAAGAAAGGAAGCTGG - Intergenic
921820914 1:219616424-219616446 CCATATTTCAGGAAGGAAGGAGG + Intergenic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
1066443534 10:35461101-35461123 TCCTGTTTATGGAAGCAAGTGGG + Intronic
1067280643 10:44869474-44869496 CCTTGTGGAAGGAAGGAAGGAGG + Intergenic
1067725951 10:48771093-48771115 CCATGTGTTTGGAAGGCAGGCGG + Intronic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1070057527 10:72950023-72950045 GAGTGTTTCTGGGAGGAAGGAGG - Intronic
1070908031 10:80091734-80091756 CCATGTTTATTGAACAAAGGAGG + Exonic
1071478117 10:86042184-86042206 CCATCTTTCTGGAAGGAAGGTGG - Intronic
1072214578 10:93277314-93277336 CCATGTTTATGGAAGCCAAGAGG + Intergenic
1074086372 10:110210991-110211013 CCTGGTTTCTGGAAGGAAGCAGG + Intronic
1077762615 11:5119442-5119464 GGGTGTTTGTGGAAGGCAGGTGG + Intergenic
1079391299 11:20024217-20024239 GCTTGTTTCTGGAAGGAAGAGGG + Intronic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1081093133 11:38897931-38897953 CCGTGTTTATGTAAGTAATATGG + Intergenic
1082976812 11:59080821-59080843 CCGTGTTTATGGTGTGCAGGGGG - Intergenic
1084001811 11:66299735-66299757 GCTGGTTTAAGGAAGGAAGGTGG + Intergenic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1088662683 11:112063750-112063772 CCTTTCTTTTGGAAGGAAGGAGG + Exonic
1094643148 12:32296073-32296095 CAGTGCTTACGGAAGGAATGAGG - Intronic
1096822402 12:54247045-54247067 CTGTGTTTATGGAAGAATAGAGG + Intronic
1100591047 12:96029943-96029965 TGGAGTTTAAGGAAGGAAGGAGG - Intronic
1101406429 12:104433132-104433154 GTGTTTTTAGGGAAGGAAGGCGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1107967646 13:45612239-45612261 AAATGTTTATGGAAGGAAAGAGG - Intronic
1110309954 13:74037307-74037329 CCATGTTTATGTAAGCAAGGTGG - Intronic
1114039909 14:18668179-18668201 CCATGTTTATTGAACAAAGGAGG + Intergenic
1114044952 14:18866727-18866749 CCATGTTTATTGAACAAAGGAGG + Intergenic
1114119270 14:19652795-19652817 CCATGTTTATTGAACAAAGGAGG - Intergenic
1114490697 14:23099960-23099982 CAGTGCTTAAGAAAGGAAGGGGG + Exonic
1114498840 14:23153380-23153402 CTGTGTATAATGAAGGAAGGCGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1122745786 14:103896568-103896590 CCATGTGGCTGGAAGGAAGGCGG - Intergenic
1124116654 15:26849711-26849733 CCGTGTTCATCCAAGTAAGGGGG - Intronic
1124725263 15:32150929-32150951 ATGTGTTTTTGGAAGTAAGGGGG + Intronic
1127718001 15:61669361-61669383 GCATGTGTATGGAAGGAATGAGG + Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1134036539 16:11035754-11035776 GAGTGTCTTTGGAAGGAAGGAGG - Intronic
1134193245 16:12138705-12138727 CTGTGTTTATGGATGAGAGGAGG + Intronic
1134244187 16:12527707-12527729 CCGTGTTTTTGGGATGGAGGTGG + Intronic
1136231196 16:28886500-28886522 GCATGTTTCTGGGAGGAAGGGGG - Intronic
1138668780 16:58596083-58596105 CAGTGTTTATTGAACAAAGGAGG - Intronic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1142903277 17:3026515-3026537 CCGTTTTAATGCAAGGAGGGTGG - Intronic
1145087736 17:19956902-19956924 CCTGGTTGAGGGAAGGAAGGAGG + Intronic
1145270163 17:21400556-21400578 ACTTGTTTATGGAATGAACGGGG + Intronic
1145308392 17:21688007-21688029 ACTTGTTTATGGAATGAACGGGG + Intergenic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1151374790 17:73680126-73680148 CTGTGTTTATGGCAGGTGGGAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1154281309 18:13005562-13005584 CCTTGTTGATGGAAGACAGGAGG + Intronic
1155710634 18:28873668-28873690 CCTTGTTTATAGTAGGTAGGTGG + Intergenic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1160912059 19:1479063-1479085 CCGTGTTTTTGGGCGGAGGGAGG - Exonic
1161934597 19:7363896-7363918 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934655 19:7364241-7364263 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1162265066 19:9566076-9566098 CCGTATATATGTAAGGAATGTGG - Exonic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167231442 19:48286867-48286889 CCCTGTGAATGAAAGGAAGGTGG + Exonic
1167248063 19:48385716-48385738 CTTGGTTTGTGGAAGGAAGGTGG + Intronic
1167779305 19:51587331-51587353 CCCTGTATATGCAAGGAATGTGG + Exonic
925333866 2:3078724-3078746 GGATGTTTATGGAAGGAAGAAGG - Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930969377 2:57377029-57377051 CCTTTTTTTTGGAAGGACGGAGG + Intergenic
933293967 2:80469360-80469382 CCGTGTTTCTGGCAGGTTGGAGG + Intronic
933617343 2:84496123-84496145 CCATGTAGATGGAAGAAAGGTGG - Intergenic
933647621 2:84825331-84825353 CCGTGTGTGAGGAAGGGAGGAGG + Intronic
934960898 2:98671801-98671823 GCGTCTTTATGAAAGGAAGGAGG + Intronic
938270640 2:129967414-129967436 CCGTGTTTATTGAACAAAGGAGG - Intergenic
938550942 2:132381963-132381985 CCTTCTTTATGAAAGGCAGGAGG - Intergenic
943228500 2:185212383-185212405 CCATGTTAATGGTAGGAATGTGG + Intergenic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1177229616 21:18302755-18302777 ACGTATTTTTGGTAGGAAGGAGG - Intronic
1177955143 21:27589028-27589050 CTGTTTTTATGGAAGTAAAGAGG + Intergenic
1178074897 21:29005912-29005934 TGGTGTTTATGGCAGTAAGGGGG + Exonic
1179173798 21:38992611-38992633 CCCTGATGATGGAAGGAAAGAGG - Intergenic
1180463475 22:15589287-15589309 CCATGTTTATTGAACAAAGGAGG + Intergenic
1183775353 22:39960506-39960528 GAGTATTTGTGGAAGGAAGGAGG + Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184566991 22:45298030-45298052 CCGTGTTCATGGGAGGAATGAGG + Intergenic
951356359 3:21671753-21671775 AGGTTTTTATGAAAGGAAGGTGG + Intronic
951874578 3:27407764-27407786 CCAGATTTATGGAATGAAGGAGG - Intronic
952708521 3:36405471-36405493 CCAATTTTATGGTAGGAAGGTGG + Intronic
956596493 3:70973032-70973054 CCCTTTTTATGGGAGGTAGGTGG - Intronic
956664319 3:71627874-71627896 CCCTGTTTTGGGAAGGAGGGTGG + Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
961550532 3:127668396-127668418 CCGTGTTCAGTGAAGGAAAGGGG - Intronic
963526911 3:146426314-146426336 CGATTTTGATGGAAGGAAGGAGG - Intronic
963752085 3:149191342-149191364 TAGTGTATATGGGAGGAAGGAGG - Intronic
964450757 3:156810549-156810571 CCGTGATTATGGAAGAAACAGGG - Intergenic
969234765 4:5858109-5858131 GCGAGTTTAAGGAAGGAGGGAGG - Intronic
979639401 4:122996249-122996271 CCATGTGTATGGAAGGCATGAGG - Intronic
984715026 4:182917359-182917381 CCGTGCTCAGGGAAGGAAGTCGG + Exonic
985989097 5:3540274-3540296 CCAAGTTTATGAATGGAAGGAGG - Intergenic
992479511 5:77136608-77136630 CAGTGTGTATGGCAGTAAGGTGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994981497 5:106880537-106880559 CCATGTTTATGGAAAGAACAAGG - Intergenic
995387135 5:111600485-111600507 ACGTGATTATGGAAGGTATGTGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
999378515 5:151103783-151103805 CCCTGTTTTTGGAAGGAACAAGG - Intronic
999479235 5:151930367-151930389 CAGTGTCATTGGAAGGAAGGAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001034796 5:168290118-168290140 TGGTATTTATGGAATGAAGGAGG + Intergenic
1001378579 5:171286760-171286782 CAGGGTTTGTGGAAGTAAGGGGG - Intronic
1002587372 5:180258136-180258158 CCCTGTGAATGGAAGAAAGGTGG + Intronic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003961514 6:11213393-11213415 CCCTGATTTTGGTAGGAAGGTGG + Exonic
1007284876 6:40740505-40740527 CCGAGTTTGGTGAAGGAAGGTGG - Intergenic
1009297510 6:61971790-61971812 ATGTGTTTAAGGAAGGATGGTGG - Intronic
1011419470 6:87155996-87156018 CCGAGTTCAGGGAAGGAAAGGGG - Intronic
1013101712 6:106992710-106992732 GCATGTTTATGAAAGGAAAGGGG - Intergenic
1013689001 6:112617698-112617720 CCGTGATTATGGAAGAAACAGGG - Intergenic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1016845985 6:148569081-148569103 CCGGGGTTATGGAAGCAGGGAGG + Intergenic
1019728106 7:2614113-2614135 CCTTTTTTTTGCAAGGAAGGGGG - Exonic
1026513053 7:71043442-71043464 CCATGTTTAGGGAAGACAGGAGG + Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG + Intergenic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1033207517 7:139435711-139435733 TCGTGTTAAGGGAAGGAAGTCGG - Intergenic
1033360977 7:140638923-140638945 TGGTGTTCCTGGAAGGAAGGGGG + Intronic
1033907355 7:146221977-146221999 AAGTGTTTGTGAAAGGAAGGAGG + Intronic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1036075371 8:5493575-5493597 GCGTGTTAATTGATGGAAGGGGG - Intergenic
1036285662 8:7442510-7442532 CTATGTTTGTGGAAAGAAGGAGG - Intergenic
1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG + Intergenic
1036660016 8:10701849-10701871 AAGTGTTTATGGAATGAAAGAGG - Intronic
1039106965 8:34000503-34000525 CAGTTTTTTTGGGAGGAAGGTGG + Intergenic
1042604876 8:70535352-70535374 CAGTGTTTTTGGCTGGAAGGTGG - Intergenic
1045865144 8:106856755-106856777 CCGTGTGTATTGAACCAAGGAGG + Intergenic
1047667967 8:127113162-127113184 ACTTGATTATGGAAGAAAGGAGG + Intergenic
1048859830 8:138716080-138716102 CAGTGTTGATGGAAGGGACGGGG - Intronic
1049135680 8:140896768-140896790 CCGTTTTTTTGGGGGGAAGGGGG - Intronic
1058272276 9:102987005-102987027 CCGTATTTATAGGAGTAAGGTGG - Intergenic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059795885 9:117696287-117696309 ATGTGTTTTTGGAAGGAATGGGG - Intergenic
1060298264 9:122357611-122357633 CTTTGTTGTTGGAAGGAAGGAGG + Intergenic
1060301117 9:122375181-122375203 TGGTGTTTATGGAAAGAACGTGG + Intronic
1061700509 9:132411465-132411487 CCGAGTTTAGGGAAGGCAAGAGG - Intronic
1186068828 X:5795542-5795564 ATGTGTTTGTGGAAGCAAGGAGG - Intergenic
1187482519 X:19670932-19670954 CCGTGCTGTTGGAAGGAAGTGGG - Intronic
1192303606 X:69933746-69933768 TCGTCTGAATGGAAGGAAGGGGG - Intronic
1192799056 X:74448666-74448688 CCTTGCTTTTTGAAGGAAGGGGG - Intronic
1196097621 X:111816791-111816813 CCATTGTTATGGAAGGAAGGTGG + Intronic
1196641508 X:118068298-118068320 TTGTCTTTATGGAAGGGAGGAGG - Intronic