ID: 912704087

View in Genome Browser
Species Human (GRCh38)
Location 1:111899090-111899112
Sequence ATCTTCAGCAAGAAGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912704087_912704088 11 Left 912704087 1:111899090-111899112 CCACAGTGCTTCTTGCTGAAGAT 0: 1
1: 0
2: 1
3: 17
4: 201
Right 912704088 1:111899124-111899146 GCAGCCCCACAGTGACTACAAGG 0: 1
1: 0
2: 2
3: 13
4: 162
912704087_912704089 12 Left 912704087 1:111899090-111899112 CCACAGTGCTTCTTGCTGAAGAT 0: 1
1: 0
2: 1
3: 17
4: 201
Right 912704089 1:111899125-111899147 CAGCCCCACAGTGACTACAAGGG 0: 1
1: 0
2: 2
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912704087 Original CRISPR ATCTTCAGCAAGAAGCACTG TGG (reversed) Intronic
900915506 1:5635463-5635485 ATTATCAGAAAGAACCACTGAGG - Intergenic
903122886 1:21227814-21227836 ATCTGCAACCTGAAGCACTGGGG + Intronic
904621579 1:31778500-31778522 AACTGCAGCATGAAGGACTGTGG + Intergenic
911762527 1:101632675-101632697 ATCTTCAGGGTGAAGCACTGAGG - Intergenic
911766068 1:101676492-101676514 ATCCTCAGAAAGAAGGACTAAGG - Intergenic
912704087 1:111899090-111899112 ATCTTCAGCAAGAAGCACTGTGG - Intronic
913271228 1:117095459-117095481 ATGCTCAGCAGAAAGCACTGAGG + Intronic
913436217 1:118850369-118850391 ATCTTCATAAAGCAGCATTGTGG + Intergenic
914748886 1:150519180-150519202 GTCATCAGGAAGCAGCACTGTGG - Intergenic
917605584 1:176625281-176625303 GTCTTCAGCTAGAAGGAGTGAGG + Intronic
918430388 1:184454013-184454035 GTCTTCAGCACAAAGCACTCAGG - Intronic
919673915 1:200362608-200362630 CTCTCCAGCAAGCAGCACAGTGG - Intergenic
919979767 1:202635584-202635606 ATATTCAGGAAGAAGCTCTGAGG + Intronic
921083260 1:211761510-211761532 ATCCTCAGCCAGTAGCTCTGAGG - Intronic
922156652 1:223045495-223045517 ATTTACATCAAGATGCACTGTGG + Intergenic
923193078 1:231639468-231639490 ATCTTCTCCTAGAAGCACGGAGG + Intronic
923519185 1:234722818-234722840 GTCTTCAGCGAGAAGGACTAGGG - Intergenic
1071000691 10:80827787-80827809 ATCTTGTGCAAGCAGCTCTGAGG - Intergenic
1073177532 10:101565552-101565574 ATCTGCAGCAAGAGGGACTTAGG - Intergenic
1074916185 10:117957793-117957815 ATCTTCAGCATGTAGCACATTGG - Intergenic
1077086925 11:757611-757633 ATCTTCAGCTAGACGCTCAGAGG - Intronic
1077297015 11:1831146-1831168 AACTGAAGCAAGAGGCACTGAGG + Intronic
1079411162 11:20189304-20189326 AACTTCAGCAAGAAGTAATTGGG + Intergenic
1079971096 11:27036476-27036498 ATCCTAAGCAAGAAGAATTGAGG + Intergenic
1080759965 11:35239108-35239130 ATGTTCAGGCAGAAGCAGTGTGG - Intergenic
1081440559 11:43076440-43076462 TTCTTTAGGAAGAAGCAGTGTGG + Intergenic
1084085314 11:66852441-66852463 CTCTTCAGCATGGAGAACTGGGG - Exonic
1084318625 11:68360625-68360647 TGCCTCAGCCAGAAGCACTGAGG - Intronic
1084344407 11:68535407-68535429 ATGTTCAGCACAAAGCTCTGTGG - Intronic
1084788466 11:71457987-71458009 ATCTGTAGCAAGAAACACAGGGG + Intronic
1085616694 11:78005490-78005512 TTCTTAAGCAAGAAACTCTGGGG - Intergenic
1086176481 11:83897305-83897327 ATATTAAGAAAGAAGCAATGAGG + Intronic
1087027424 11:93663225-93663247 ATGTTCAGCAAGAACCCGTGGGG - Intronic
1088503931 11:110510900-110510922 ATCTACAGCCAGCACCACTGTGG + Intergenic
1089327766 11:117669102-117669124 ACCTGCAGCAAGAGGCCCTGGGG - Intronic
1090374769 11:126280964-126280986 ATGTTTATTAAGAAGCACTGAGG + Intergenic
1090712924 11:129404092-129404114 ATTTTCAACAAGGACCACTGTGG + Intronic
1091726358 12:2849143-2849165 TCCTTCAGCAAGAGGCCCTGGGG - Intronic
1092000736 12:5029971-5029993 ATCTTCAGCAAGAGTCCATGAGG - Intergenic
1093901952 12:24645879-24645901 GTCTTCAGCAAGAAGCTTAGAGG - Intergenic
1096601468 12:52732824-52732846 ATCCTCACCAAGAAGCGCCGGGG + Intergenic
1101249124 12:102915008-102915030 AACATCAGCAAGAAGCCATGGGG - Intronic
1103338855 12:120210586-120210608 ATCTTCCCCAAGAGGGACTGGGG - Exonic
1106185878 13:27409159-27409181 ATCTCCTGCTAGAAGCCCTGAGG - Intergenic
1106396677 13:29387335-29387357 AGCTTCAGCACCAAGCCCTGCGG + Intronic
1107360127 13:39608494-39608516 ATCTTCTGCAATACACACTGTGG - Intergenic
1108642568 13:52396155-52396177 ATTTGCAGCAAGGAACACTGGGG + Intronic
1108799578 13:54078651-54078673 ATTTTATGCAAGAAGCATTGAGG - Intergenic
1110951319 13:81495482-81495504 GTCTTCAGAAAGAACCACTTGGG + Intergenic
1113127458 13:106995695-106995717 ATATTTAGCAAGAAGAGCTGTGG + Intergenic
1113569055 13:111340112-111340134 ATTTTCATCAACAAGCACTCTGG - Intronic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114766423 14:25376238-25376260 ATCTTCAGGAGTGAGCACTGAGG - Intergenic
1115755601 14:36524211-36524233 ACCTTCAACAAGAAACACTTGGG + Intergenic
1117761404 14:59032656-59032678 AACTTCAGCAAGAGGCTATGGGG - Intergenic
1118763485 14:68894851-68894873 AACTGCAGCAAGATGAACTGAGG + Intronic
1120124539 14:80725482-80725504 ATCTGCAGGAAAAAGCACTGGGG - Intronic
1120216859 14:81689771-81689793 ATCTTGAGGGAGAAGCACTCAGG + Intergenic
1121560033 14:94867768-94867790 ATCTTCAACAACAATCTCTGAGG - Intergenic
1124495387 15:30183622-30183644 ATATTCAGGAAGAAGCTCTGAGG + Intergenic
1124748186 15:32355024-32355046 ATATTCAGGAAGAAGCTCTGAGG - Intergenic
1125874896 15:43135078-43135100 TTTTACAGCAAGAAGCAATGTGG - Intronic
1127160633 15:56181053-56181075 ATCTTCAAAAAGAATCACTCTGG - Intronic
1128694929 15:69754466-69754488 ATGTTCAGCAGGAATCAATGTGG - Intergenic
1129032139 15:72627113-72627135 ATCTTCAACACTAACCACTGGGG - Intergenic
1129217759 15:74110121-74110143 ATCTTCAACACTAACCACTGGGG + Intronic
1129406906 15:75325853-75325875 ATCTTCAACACTAACCACTGGGG - Intergenic
1129470107 15:75748717-75748739 ATCTTCAACACTAACCACTGGGG - Intergenic
1129734917 15:77954419-77954441 ATCTTCAACACTAACCACTGGGG + Intergenic
1130338380 15:82977617-82977639 ATCTCCAGCACCTAGCACTGAGG - Intronic
1130601908 15:85281285-85281307 ATCTACAGTAAGAACCACAGAGG + Intergenic
1130766999 15:86880882-86880904 ATCTACAGTAAGAACCACGGAGG - Intronic
1133226574 16:4343593-4343615 GGCTTCAGGAAGAAACACTGTGG + Intronic
1133581617 16:7149803-7149825 GTCTTCAGTAGGAAGCAATGTGG - Intronic
1137696469 16:50465268-50465290 ACCCCCAGGAAGAAGCACTGGGG - Intergenic
1140913538 16:79474679-79474701 ATATTCAACAAGAAGGAGTGTGG - Intergenic
1150331658 17:64299056-64299078 ATCTTCAACACCAAGCACAGGGG + Intergenic
1150338919 17:64350014-64350036 CTCTTCTGCCTGAAGCACTGAGG - Intronic
1150500687 17:65648151-65648173 ATCATCCTCAAAAAGCACTGTGG + Intronic
1151026566 17:70684319-70684341 GCCTTCAGCAAGCAGCACTATGG + Intergenic
1151831521 17:76554952-76554974 ATCTTGAGCAAGAAGGAATTTGG + Intergenic
1152828334 17:82481414-82481436 ATCTTGAGGAAGATGCACAGAGG - Intronic
1153469792 18:5430940-5430962 CCCTTTAGCAAGGAGCACTGGGG + Intronic
1154082629 18:11273523-11273545 ATCTTCACCAAGATGCACCTTGG + Intergenic
1155390117 18:25326646-25326668 ATCTCCAGCAAGAGGGACAGAGG - Intronic
1155994820 18:32319688-32319710 TGCTTCAGCAAGAAGATCTGAGG - Intronic
1156357778 18:36357468-36357490 AGATTCAGCAAGATGCTCTGAGG + Intronic
1157295207 18:46437425-46437447 ATCCTCTGCAAGGAGCCCTGGGG + Intronic
1157502618 18:48202118-48202140 AGCGTGAGCAGGAAGCACTGTGG - Intronic
1157827244 18:50823323-50823345 TGCTGCAGGAAGAAGCACTGGGG + Intronic
1158302502 18:56067384-56067406 ATCTTCAGAATGCAGCACTGTGG + Intergenic
1159726985 18:71973430-71973452 TGCTTCAGAATGAAGCACTGAGG + Intergenic
1165971504 19:39635141-39635163 GTTTTTAGCAGGAAGCACTGTGG + Intergenic
1166050669 19:40257009-40257031 CTCTTCAGCAGGAAGTACCGTGG + Exonic
925627300 2:5853960-5853982 AGCTTCAGCAAGAAGAGCTAGGG + Intergenic
925833250 2:7917226-7917248 TTCTTCAGGGAGAACCACTGTGG - Intergenic
926447330 2:12959169-12959191 ATGTTCAACAAGAAGCACATCGG + Intergenic
928490767 2:31780209-31780231 AGCTCCTGAAAGAAGCACTGTGG + Intergenic
929260927 2:39865887-39865909 ATCTTCAGCTAGCATCACTCAGG + Intergenic
933497993 2:83075629-83075651 ATCTGCACCAATAAGCAATGTGG - Intergenic
935671727 2:105561932-105561954 ATCTCCAGCAAGAAACTCAGGGG + Intergenic
935972369 2:108542670-108542692 AAGTTCAGAAAGAAGGACTGTGG - Intronic
938184011 2:129211886-129211908 GCCTTCAGTAAGGAGCACTGTGG + Intergenic
940003495 2:148990418-148990440 ACCTTCATCAAGAAGCCCTTTGG + Intronic
940860603 2:158766788-158766810 TTCTTCAGGAAGAGGAACTGTGG - Intergenic
940922211 2:159321042-159321064 TCTTTCAACAAGAAGCACTGTGG + Intronic
944118691 2:196216708-196216730 CCCTTCAGCAAGAAGCACCCAGG - Intronic
944869121 2:203892315-203892337 ATCTTCAGGAGGCACCACTGAGG - Intergenic
944882051 2:204023244-204023266 TTGTTCACAAAGAAGCACTGTGG + Intergenic
945145495 2:206733840-206733862 ATCTTGAGCAAGACACACTAGGG + Intergenic
945935500 2:215899288-215899310 CTCTTCATCAGGAAGCACTAGGG + Intergenic
946609348 2:221441110-221441132 ATCTTTAGGAAGAAGAAATGAGG - Intronic
946862518 2:224013858-224013880 ACCTCCTGCAACAAGCACTGCGG - Intronic
947306028 2:228748683-228748705 TTCTCCAGCAAGAAGCACTGTGG + Intergenic
947993569 2:234507470-234507492 TACTTCAACAAGAGGCACTGAGG - Intergenic
948008726 2:234633441-234633463 AAATTCAGAAAGAAGCACTCTGG + Intergenic
1169881095 20:10348006-10348028 ATATTCTGCAAGAAGCACTTTGG - Intergenic
1170547336 20:17445634-17445656 AATTTCAGCAGGAGGCACTGTGG - Intronic
1170749911 20:19136432-19136454 AACTGCAGCATGAAACACTGTGG - Intergenic
1172462670 20:35131886-35131908 ATGTTTCCCAAGAAGCACTGGGG - Intronic
1173060999 20:39661087-39661109 TCCTTCAGCAAGCAGGACTGGGG + Intergenic
1173865496 20:46309773-46309795 ATCATCAGCAAGACGGACTAGGG - Intergenic
1174143773 20:48435986-48436008 ATCTTCAGCATGCACCTCTGTGG + Intergenic
1174264580 20:49322136-49322158 CAATTCAGCTAGAAGCACTGGGG + Intergenic
1174433934 20:50491839-50491861 ATCATCAGCAAGAGGCACAAGGG - Intergenic
1175078930 20:56401654-56401676 ATGTCCAATAAGAAGCACTGAGG + Intronic
1178681461 21:34675777-34675799 ATCTGCACCAAAAAGCACAGTGG - Intronic
1178707410 21:34887177-34887199 ATCTTCAGCAAGCAGCTCCCGGG + Intronic
1180902690 22:19386156-19386178 ATCTGCAGCCATAAGCCCTGTGG + Intronic
1181616277 22:24056903-24056925 AACCTAAGTAAGAAGCACTGGGG - Intronic
953109932 3:39925193-39925215 ATCTTCAGCAAGACTCACAAGGG + Intronic
953608583 3:44428604-44428626 ACCTTCAGTAAGAAACACGGTGG - Intergenic
953706221 3:45232818-45232840 AGATCCAGCAAGAAGGACTGAGG - Intergenic
953709534 3:45258531-45258553 ATCTTGAGCAAGAAGGGCTGTGG + Intergenic
954886048 3:53874847-53874869 AACTTCAGCAAAAACCAGTGGGG + Intronic
955166768 3:56522458-56522480 AACCTCAGCATCAAGCACTGTGG - Intergenic
957678812 3:83404749-83404771 ATCTACAGAGAGAAGCACTATGG + Intergenic
958543175 3:95507322-95507344 ATCTTCAGCAAAATACACTGGGG - Intergenic
959810922 3:110618267-110618289 TTCTTCAGAAAGAAACACTCAGG - Intergenic
961795814 3:129408183-129408205 TTCTTCTGCAACAAGCAGTGGGG - Intronic
962375957 3:134858863-134858885 ATCTTCAGCAAGTGCCCCTGCGG - Intronic
963135077 3:141895543-141895565 CTATTCAGCAATAAGAACTGTGG - Intronic
964266621 3:154904335-154904357 CTCTTCAGAAACTAGCACTGAGG + Intergenic
964748195 3:160031223-160031245 ATCTTCAGCAAAAGGAACTATGG + Intronic
965925172 3:173970196-173970218 GTCTTTAGCAACAAGGACTGTGG - Intronic
965988057 3:174780678-174780700 ATTTTCAGCATGAAGCGCTGTGG + Intronic
966183654 3:177209239-177209261 ATCTCCAGCCAGAACCACTCAGG - Intergenic
969306710 4:6330025-6330047 ATCCACAGCACGAGGCACTGAGG + Intronic
969668871 4:8578625-8578647 ATCTGAGGCCAGAAGCACTGGGG + Intronic
970981955 4:22109283-22109305 ATCTTCTCAGAGAAGCACTGGGG + Intergenic
971739301 4:30500209-30500231 TTCTTCTGCAAGAACAACTGAGG - Intergenic
972843814 4:42963302-42963324 TTCTTCAGGGAGGAGCACTGTGG - Intronic
974955032 4:68628594-68628616 ATCTTCAGAAAGATGCATTTTGG - Intronic
975699714 4:77051856-77051878 ATGAACAGCATGAAGCACTGAGG + Intronic
975868819 4:78755260-78755282 AACTGCAGCAAAAAGGACTGTGG - Intergenic
978025199 4:103864897-103864919 ATCCTAAGCAAAAAGAACTGGGG - Intergenic
978536486 4:109768651-109768673 ATCCTCAGGAGGAAGCTCTGGGG - Intronic
980486694 4:133466647-133466669 ATCTTAAACAAGAAGCATTAAGG - Intergenic
980652571 4:135738078-135738100 TTCTTTAGCAAGCAGCAGTGTGG + Intergenic
981183810 4:141777977-141777999 GACATCAGCAAGCAGCACTGGGG + Intergenic
981252349 4:142618493-142618515 CTCTTCAACAAACAGCACTGGGG + Intronic
984713356 4:182904101-182904123 AGCTTTAGCAAGAGGCATTGAGG - Intronic
986320835 5:6631843-6631865 ATATTCGGCATGAAGCACTGTGG + Intronic
990296422 5:54406056-54406078 TTCTGCAGCCAGAAGCACTGAGG + Intergenic
993595127 5:89844724-89844746 ACCCTCAGCAGGAAGCAATGAGG + Intergenic
997632840 5:135382730-135382752 ATTTGCATCAAGAAGCAATGAGG + Intronic
999044156 5:148449493-148449515 ATTTTCAGAAAGGAGAACTGTGG + Intergenic
1000314914 5:160081013-160081035 ATCCGCAGCAAGATGCAATGGGG + Intronic
1003386519 6:5672762-5672784 AGCTTCATCATGAATCACTGTGG - Intronic
1003396428 6:5756927-5756949 AAATTCAGCACGAAGCAATGGGG + Intronic
1003679885 6:8242501-8242523 TTCTTAAGCAAGAAGGATTGTGG + Intergenic
1003721343 6:8706023-8706045 ATTTTCAGCAAGAAGCATGGTGG + Intergenic
1003766397 6:9241845-9241867 TCCTCCAGCAAGAAGCACTGTGG + Intergenic
1013458655 6:110355846-110355868 ATCTCCAGCCTGAATCACTGTGG + Intronic
1014677421 6:124384412-124384434 ATCTTCACCAAGAATAAGTGGGG + Intronic
1014782283 6:125578159-125578181 ATCTCAAGCAAGAAACCCTGTGG + Intergenic
1015959302 6:138630946-138630968 ATCAGCAGAAAGAAACACTGAGG + Intronic
1017511290 6:155116676-155116698 ATAGTCAGCAAGAAGCTGTGTGG + Intronic
1017989538 6:159473972-159473994 AACCTCTGCAAGAAGCACCGAGG + Intergenic
1018305456 6:162450021-162450043 TTCTTCAGCCAGAAAAACTGTGG - Intronic
1020081186 7:5286675-5286697 AATTGAAGCAAGAAGCACTGAGG + Intronic
1021564441 7:22003076-22003098 AACTTCAGAAAAATGCACTGTGG - Intergenic
1023864507 7:44232421-44232443 CTGCTCAGCAGGAAGCACTGGGG + Intronic
1024880073 7:54074773-54074795 GTCTTGAGCAAGGAACACTGAGG - Intergenic
1027694874 7:81397930-81397952 GTCTGCAGCAGGAAGCACTAGGG - Intergenic
1029800001 7:102936537-102936559 CTCTTCAGCATGAAGCACTAAGG - Intronic
1029974579 7:104820950-104820972 AGCTTAAGCAGGAAACACTGAGG - Intronic
1032544109 7:132727658-132727680 ATCTTCTCCAAGGAGCACAGTGG - Exonic
1035765275 8:2100345-2100367 ATCTTCAGCTAGTCTCACTGTGG - Intronic
1037367900 8:18142706-18142728 ATCTTGTGCAAGAAACACTTCGG + Intergenic
1038389348 8:27180510-27180532 ATCTTGGGCAAGAGGCTCTGTGG - Intergenic
1041319140 8:56595542-56595564 ATCTTCCTCGAGAAGCATTGTGG - Intergenic
1044558205 8:93587701-93587723 ATCTGGAGGCAGAAGCACTGGGG + Intergenic
1044765494 8:95568577-95568599 ATCTTAAGCAAGAAGAACAAAGG - Intergenic
1046037535 8:108862180-108862202 ATCTCTACCCAGAAGCACTGTGG + Intergenic
1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG + Intergenic
1048458744 8:134602180-134602202 ACATCCAGCAAGAAGCTCTGGGG - Exonic
1048833999 8:138500932-138500954 ATCTTCACAAAAAAGCTCTGAGG - Intergenic
1053001647 9:34580037-34580059 CCCTGCAGCAAGAAGAACTGAGG - Intronic
1053108331 9:35433597-35433619 ATCTTCAGCAAGAAAGTGTGGGG + Intergenic
1055018079 9:71640537-71640559 TTCTTCAACAAGAAGCAAGGAGG + Intergenic
1057480291 9:95440074-95440096 ATCTTCAGCCTCAAGCCCTGTGG + Intergenic
1057929503 9:99181330-99181352 ACCCTCAGCATGAGGCACTGAGG - Intergenic
1058628461 9:106960357-106960379 GTCTTGAGGAGGAAGCACTGTGG + Intronic
1060549777 9:124479429-124479451 ATCCTCAGCAAGAAGCACCTGGG - Intergenic
1061127330 9:128685074-128685096 CTCTTATGGAAGAAGCACTGAGG + Intronic
1061236899 9:129348652-129348674 ACCTTCAGCAAGAAACAGAGAGG - Intergenic
1061761617 9:132855586-132855608 ATATTCAACAACCAGCACTGGGG - Intronic
1188091246 X:25968153-25968175 AGCTTGAGCAAGAAGCTGTGGGG - Intergenic
1188427648 X:30067651-30067673 ATCTTTGGCAAGAAGCTGTGAGG - Intergenic
1194207493 X:91029488-91029510 AACTACAGTAAGAAGGACTGGGG - Intergenic
1194361178 X:92952456-92952478 TTCTTCAACAAAAAGAACTGAGG + Intergenic
1195404584 X:104498956-104498978 ATTTTCAGCAAAAATCACAGTGG - Intergenic
1195631561 X:107060781-107060803 ACCTTCTGGAAGATGCACTGAGG - Intergenic
1198267712 X:135024715-135024737 ATATAAAGCAAGAAGTACTGCGG - Intergenic
1199153417 X:144517079-144517101 ATCCTCAGCAACAAACACTGTGG - Intergenic
1199502003 X:148517310-148517332 ATCTCCAGCATGAAGCAACGAGG - Intronic
1200553290 Y:4604534-4604556 AACTGCAGTAAGAAGGACTGGGG - Intergenic
1200669373 Y:6068285-6068307 TTCTTCAACAAAAAGAACTGAGG + Intergenic
1201320417 Y:12692626-12692648 AGCTGCAGCAAGAAGGACTATGG - Intergenic