ID: 912705526

View in Genome Browser
Species Human (GRCh38)
Location 1:111909169-111909191
Sequence ATGCAATCACACCTATTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 75}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912705526_912705537 22 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705537 1:111909214-111909236 ATCCATTGCCATCTGGGGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 115
912705526_912705532 15 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705532 1:111909207-111909229 TGGCAATATCCATTGCCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 95
912705526_912705538 23 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705538 1:111909215-111909237 TCCATTGCCATCTGGGGGGTGGG No data
912705526_912705534 17 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705534 1:111909209-111909231 GCAATATCCATTGCCATCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
912705526_912705535 18 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705535 1:111909210-111909232 CAATATCCATTGCCATCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 81
912705526_912705540 24 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705540 1:111909216-111909238 CCATTGCCATCTGGGGGGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 262
912705526_912705543 30 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705543 1:111909222-111909244 CCATCTGGGGGGTGGGGAGGTGG No data
912705526_912705529 -5 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705529 1:111909187-111909209 TGCATCCCATTATGTTGTCATGG No data
912705526_912705536 19 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705536 1:111909211-111909233 AATATCCATTGCCATCTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
912705526_912705533 16 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705533 1:111909208-111909230 GGCAATATCCATTGCCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 107
912705526_912705541 27 Left 912705526 1:111909169-111909191 CCCCACAATAGGTGTGATTGCAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 912705541 1:111909219-111909241 TTGCCATCTGGGGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912705526 Original CRISPR ATGCAATCACACCTATTGTG GGG (reversed) Intronic