ID: 912706446

View in Genome Browser
Species Human (GRCh38)
Location 1:111918575-111918597
Sequence TCTGTGCCCCCAAAGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912706446_912706454 -2 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706454 1:111918596-111918618 GAGGATTTGGGGAAGGGGAGAGG 0: 1
1: 2
2: 22
3: 156
4: 1465
912706446_912706455 -1 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706455 1:111918597-111918619 AGGATTTGGGGAAGGGGAGAGGG 0: 1
1: 1
2: 18
3: 166
4: 1467
912706446_912706457 28 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706457 1:111918626-111918648 CTAGTAAGACCAGAAAAGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 194
912706446_912706452 -8 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706452 1:111918590-111918612 GGCACAGAGGATTTGGGGAAGGG 0: 1
1: 0
2: 3
3: 51
4: 574
912706446_912706456 0 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706456 1:111918598-111918620 GGATTTGGGGAAGGGGAGAGGGG 0: 1
1: 1
2: 18
3: 179
4: 1367
912706446_912706451 -9 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706451 1:111918589-111918611 GGGCACAGAGGATTTGGGGAAGG 0: 1
1: 0
2: 11
3: 59
4: 493
912706446_912706453 -7 Left 912706446 1:111918575-111918597 CCATGGTGCTTTGGGGGCACAGA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 912706453 1:111918591-111918613 GCACAGAGGATTTGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912706446 Original CRISPR TCTGTGCCCCCAAAGCACCA TGG (reversed) Intronic
901735849 1:11311682-11311704 TCTGTGTCTCCAAAGTGCCAAGG + Intergenic
901757390 1:11449588-11449610 TACCTGCCCCCAAAGCACCACGG + Intergenic
902685423 1:18073737-18073759 ACTGTTCACCCCAAGCACCATGG + Intergenic
903003764 1:20284764-20284786 TCAGTACCCCCAAAGAATCATGG - Intergenic
903997736 1:27318315-27318337 TCTTTGCTCCCAGAGCACGAAGG - Intergenic
904462358 1:30687646-30687668 CCTCTGCTCCCAAACCACCAAGG + Intergenic
905388792 1:37623096-37623118 TCTGAGCCCCCAAACCCTCATGG - Intronic
905973919 1:42162103-42162125 ACAGTGCCCAGAAAGCACCAAGG + Intergenic
906137731 1:43511473-43511495 TCAGTGCCCCCTAAGCCACATGG - Intergenic
906319936 1:44809529-44809551 ACTGTGACCCCAAAGAAGCAGGG - Intronic
907276450 1:53319522-53319544 TCTATGCCCCCAAAGCAGCTAGG + Intronic
907310085 1:53534152-53534174 TCTGTGCCCCCACAACCCAATGG - Intronic
910287456 1:85571463-85571485 TCTGTACTCCCAAAGCTGCACGG + Intronic
910655541 1:89614714-89614736 GCTGTTCCTCCAAAACACCAGGG + Intergenic
912033148 1:105274797-105274819 ACTGTGCCCCCACAACAGCAAGG + Intergenic
912706446 1:111918575-111918597 TCTGTGCCCCCAAAGCACCATGG - Intronic
912865311 1:113251095-113251117 TCTATTCCCCCAAAGCATCTAGG - Intergenic
913325678 1:117626370-117626392 TCTTTGCCACCATTGCACCATGG + Exonic
915105871 1:153534925-153534947 TCTGTGCTCCCTCATCACCAAGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916028628 1:160857189-160857211 CCAGTGGCCCCAAAGCAGCATGG + Intronic
917214565 1:172664669-172664691 TCTGTGCCCCCAATCCCCCAAGG - Intronic
918081520 1:181211279-181211301 TCTGGACCCCCACAGCACCTTGG + Intergenic
918658800 1:187063491-187063513 TGTGTGTAACCAAAGCACCAGGG - Intergenic
919819707 1:201465453-201465475 TCTTTGCCCACAAAGACCCAGGG - Intergenic
921292996 1:213676216-213676238 TCTGTGTCCCCAAAACACCAAGG + Intergenic
923522582 1:234747073-234747095 TCTGGGCCTCCAAGGCACCACGG - Intergenic
924288579 1:242513481-242513503 TCTGTGGTCCCATAACACCATGG - Intronic
924587258 1:245370987-245371009 TGCATGCCCCCAAAGCACCGCGG - Intronic
924641581 1:245838252-245838274 TCTGTGCCCCCTAAGCCCACAGG - Intronic
924645849 1:245876832-245876854 TCTATGCTCCCATAGCCCCAGGG - Intronic
924691446 1:246355586-246355608 ACCGTGCCCCCACAGCAGCACGG - Intronic
924782849 1:247168839-247168861 CCCTTGCCCCCAAATCACCAAGG - Intronic
1063980580 10:11448584-11448606 ACTGTGCACACAAAGCACCTGGG - Intergenic
1064259877 10:13776849-13776871 TCAAGGTCCCCAAAGCACCAGGG + Intronic
1066048089 10:31611881-31611903 TCTCTGCCCCCAAATTAGCAGGG + Intergenic
1067817560 10:49493850-49493872 TCTACACCACCAAAGCACCATGG + Intronic
1067859645 10:49832259-49832281 GCTGTGCTCCCACAGCCCCATGG + Intronic
1067966505 10:50919171-50919193 TCTGAGCCCAGAAAGTACCAAGG - Intergenic
1070809931 10:79292657-79292679 TCTGGGCCCCCAACTCACCAAGG + Intronic
1073448972 10:103598301-103598323 TCACTGCCCCCAAAGTCCCATGG + Exonic
1076350249 10:129810667-129810689 TCTGGGCCCACAGAGCAGCAGGG + Intergenic
1076793480 10:132788184-132788206 TCTGCGCCCCCAACTCACCCTGG - Intergenic
1077022814 11:426755-426777 TCAGTGCCCCCAAGCCACCAGGG - Intronic
1077024755 11:434097-434119 TCTCTGCCCCCAAACCCCCAGGG - Exonic
1077045726 11:544451-544473 CCTGAGCCCCCAAAGCCTCACGG - Intronic
1077062335 11:623364-623386 TCTGTGCCCTCCATGCACCACGG - Intronic
1077197433 11:1288450-1288472 TCTCTGCCACCAAACCACCCAGG + Intronic
1077350785 11:2092290-2092312 TCTGTGCCTGCCAAGCACCCAGG + Intergenic
1077475724 11:2789581-2789603 TCTGTGCAGCCACAGCACCCAGG + Intronic
1079616521 11:22500692-22500714 TTTGTGTCTCCACAGCACCAAGG + Intergenic
1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG + Intronic
1081391474 11:42534506-42534528 TCTCTGCTCCAAAAGCAACAGGG + Intergenic
1082162558 11:48900781-48900803 TGTGTGCCCCCAGAGCTCCCTGG - Intergenic
1083588621 11:63878733-63878755 TCTTTGCTCTCCAAGCACCATGG - Intronic
1083626352 11:64073960-64073982 CCTGGGCCTCCAAAGCACCCTGG - Intronic
1083689169 11:64396363-64396385 CCTGTGCCCCCAGAGGGCCAGGG + Intergenic
1083770345 11:64863672-64863694 TCTGTGAGCCCAAAGCCACAGGG + Intronic
1084261495 11:67981691-67981713 GCTGTCCCCCCAAAGAAGCAAGG - Intergenic
1084811148 11:71612417-71612439 GCTGTCCCCCCAAAGAAGCAAGG + Intergenic
1085293209 11:75414977-75414999 TCTGTGACCTCACACCACCAAGG + Intronic
1085453022 11:76648281-76648303 TCTGTTTCCCCCAAGCTCCAGGG + Intergenic
1089576822 11:119450455-119450477 TCTCTGCCCTCAAAGAAGCAAGG + Intergenic
1094469567 12:30791260-30791282 TCTGTGTCCCCAGAGCCCCCAGG + Intergenic
1096262686 12:50103020-50103042 TCTGAGACCACAAAGCCCCACGG + Intergenic
1096765724 12:53887361-53887383 TCTATGCTCACATAGCACCAGGG + Intergenic
1098614711 12:72508333-72508355 ACTGAGCCCCCAAAGCTACAGGG + Intronic
1101317584 12:103643528-103643550 TCTGGGCTCCCAGAGCACCCTGG + Intronic
1101422232 12:104559127-104559149 TCTGTGCTTCCAGAACACCATGG + Intronic
1104632110 12:130412408-130412430 TCTGTGTCCCTAAAGCACACAGG + Intronic
1105847078 13:24302612-24302634 CCTGTGGCCCCACCGCACCAGGG + Exonic
1108259093 13:48639124-48639146 TATGTGCTCCCAAAGCACAATGG - Intergenic
1108505312 13:51107595-51107617 TCTGTGACACCAGGGCACCATGG - Intergenic
1110012676 13:70357426-70357448 CCTCAGCCCCCAAAGCAGCAGGG - Intergenic
1112802349 13:103126362-103126384 TATGTGCCCTGAAAGAACCAGGG + Intergenic
1112907625 13:104444076-104444098 TTTGTGCCACCAAAGCACACGGG + Intergenic
1115758616 14:36555395-36555417 TCTCTGCCAACAAAGCACCTGGG - Intergenic
1120203930 14:81567600-81567622 CCTGTGCCCCCAAAGCATCCAGG - Intergenic
1122692563 14:103538208-103538230 TCAGTGCCCCCACAGCCCCGGGG + Intergenic
1123673076 15:22680080-22680102 TCTGTTCATCCACAGCACCATGG - Intergenic
1124325131 15:28753373-28753395 TCTGTTCATCCACAGCACCATGG - Intergenic
1127772239 15:62241539-62241561 ACTGTGCCCCATAGGCACCACGG + Intergenic
1128338385 15:66803034-66803056 CCTGAGCCCCCAACCCACCATGG - Intergenic
1129331203 15:74828294-74828316 TCTGTGCCCACCAAGGGCCAGGG + Intronic
1129399657 15:75274593-75274615 ACTGTGCCCCATAGGCACCATGG - Intronic
1130319130 15:82825309-82825331 TCTGTTCATCCACAGCACCATGG - Intronic
1130785858 15:87095383-87095405 TTTGTGCCACCAAAGAACAAGGG - Intergenic
1131743601 15:95421102-95421124 GCTGTGCCCTCAAAGCCACAGGG - Intergenic
1132220204 15:100099683-100099705 TATGTGACACCAAAGGACCAAGG + Intronic
1135551307 16:23400360-23400382 TCTTTGCCGACAAACCACCAAGG - Intronic
1135939696 16:26810327-26810349 TCTGTGCTCCCAAAGCCCCTTGG + Intergenic
1136106874 16:28036371-28036393 TATGTGCCCACCCAGCACCAAGG + Intronic
1136698999 16:32115720-32115742 TTTTTGCCCCCCAAGCGCCAAGG + Intergenic
1136799570 16:33059178-33059200 TTTTTGCCCCCCAAGCGCCAAGG + Intergenic
1136799590 16:33059274-33059296 TTTGTGCCCCCCCAGCGCCAGGG + Intergenic
1137942217 16:52699364-52699386 ACTTTGCCCCCATTGCACCAAGG - Intergenic
1138442343 16:57042583-57042605 TTTGTGAGCCAAAAGCACCAAGG - Intronic
1139574053 16:67830285-67830307 TCTGTGCCCCTAGAGCACCCTGG - Intronic
1139654160 16:68377274-68377296 TCTGGGCTCCCAAAGTCCCAGGG - Intronic
1141996871 16:87641416-87641438 TCTGTACCCCCAAAGCTGCTTGG - Intronic
1142033983 16:87852447-87852469 CGTATGCCCCCAAAGCAGCAGGG - Intronic
1142234408 16:88915101-88915123 TCCATGCCCCCAAGCCACCAAGG + Intronic
1143720747 17:8807436-8807458 TCTGTGCTCCCATAGGACCCTGG - Intronic
1144514535 17:15908111-15908133 TCTGTCCACCCAGAGCACCCAGG + Intergenic
1144747574 17:17626113-17626135 TCTGCGCCAGAAAAGCACCATGG - Intergenic
1145065749 17:19760141-19760163 TCTGTTTGCCCAAAGGACCAGGG + Intergenic
1145262748 17:21364603-21364625 GCTGAGTCCCCAAAGCACCCAGG - Intergenic
1145262948 17:21365529-21365551 GCTGAGTCCCCAAAGCACCCAGG - Intergenic
1145267963 17:21389606-21389628 GCTGTGCCCTCAGAGCCCCATGG + Intronic
1145772879 17:27506147-27506169 CCTCTGCCCCAAAAACACCACGG + Intronic
1146587373 17:34093854-34093876 CCTGTGCCCCCAAATGACTAGGG - Intronic
1146691255 17:34877741-34877763 TCTGTTCCCTGAAGGCACCAGGG - Intergenic
1147925691 17:43944197-43944219 TCTGAGCTCCCACAGGACCATGG + Intergenic
1150135821 17:62694416-62694438 GCTGGTCCCCTAAAGCACCAGGG - Intergenic
1150230159 17:63545360-63545382 TCTGTGGCCCCAGAGCAGCCAGG + Intronic
1150938497 17:69663284-69663306 TCTGGACCCCCAAAGGTCCAAGG + Intergenic
1151326990 17:73385721-73385743 TCTCTGCCCCCAGAGCGCCTGGG - Intronic
1151414565 17:73952879-73952901 TCTGGTCCCCCAAAGCTCCCCGG + Intergenic
1152294014 17:79456307-79456329 TCTGTCCCCTCCAGGCACCATGG + Intronic
1152843457 17:82585151-82585173 TCTAAGCCCCCAAACCACAAAGG + Intronic
1153672748 18:7428102-7428124 TCTGTGTGCCCAAGGCACCTCGG - Intergenic
1155158646 18:23178278-23178300 TGTGTGCCCCTACAGCAGCAGGG + Intronic
1158481364 18:57824431-57824453 TGTGTGCCCCCACAGTACCCTGG + Intergenic
1160799397 19:960816-960838 TCTGTGCCCCCAAAGTCTCCTGG + Intronic
1161625765 19:5325656-5325678 TCTGTGCTCCCCAAGCACTGGGG + Intronic
1162871652 19:13591058-13591080 ACTGTTCCTCCAATGCACCAGGG - Intronic
1164809901 19:31147546-31147568 TCAATGCCCTGAAAGCACCATGG - Intergenic
1166049942 19:40252681-40252703 TCTGTGTCACCAGAGAACCAAGG - Intronic
1166678542 19:44754066-44754088 TCTGTGTTCCCAAAGGGCCAGGG + Intronic
1167597503 19:50435348-50435370 TCTGTCCCCGCACAGCCCCAGGG + Intronic
1168326191 19:55539654-55539676 TCTGCTCCCACAGAGCACCACGG - Intergenic
1202680789 1_KI270712v1_random:4862-4884 TTTGTGCCCCCCCAGCGCCAGGG - Intergenic
927152892 2:20205825-20205847 TCTTTGGCCCCAAAGCTCCCTGG - Intronic
927883452 2:26704702-26704724 TGCCTGCCCCCAAAGCCCCAGGG - Intronic
928126735 2:28621489-28621511 TCAGGGCCCCCAAAACAGCATGG + Intronic
928943711 2:36753286-36753308 TCTGTGCAGCAAAAACACCATGG + Intronic
930548426 2:52799845-52799867 TCTGTGCAAGCAAACCACCATGG + Intergenic
931247230 2:60501361-60501383 TCATTTCCCCCAAAGGACCATGG - Intronic
931656732 2:64516195-64516217 TTTATGCCCCCACAGCACCTGGG - Intergenic
932460335 2:71878161-71878183 TCTGTGCTCCCACAGCCCCCTGG - Intergenic
934043090 2:88146355-88146377 AGTGTGTCCCCAAAACACCAGGG - Intergenic
936160071 2:110078148-110078170 TAAGTGCCCCCAGAGCCCCAAGG - Intergenic
936184593 2:110293205-110293227 TAAGTGCCCCCAGAGCCCCAAGG + Intergenic
938277570 2:130039903-130039925 TATCTGCCCCCAAAGCTTCACGG + Intergenic
938437816 2:131297478-131297500 TATCTGCCCCCAAAGCTTCACGG - Intronic
940219654 2:151338435-151338457 TCTGTGTTCCCATAGCACAAAGG - Intergenic
940234080 2:151490906-151490928 TCTGTGTTCCCAAAATACCATGG + Intronic
943384525 2:187184907-187184929 TCTGTCCCCCCAAAAAACCCAGG - Intergenic
944614629 2:201447882-201447904 TCTGTGCTCCCAAAGTACCTCGG + Intronic
946339336 2:219058058-219058080 TCTGTGCCTCCAAGGCAGGAGGG + Intronic
946937430 2:224736534-224736556 TCTGTGCACCCACAGGCCCAAGG - Intergenic
948737324 2:240017463-240017485 TATGTGCCCCCAAAGCACCCAGG + Intronic
948766438 2:240223965-240223987 TGTGTGGTCCCAAAGCACCCTGG + Intergenic
1169137800 20:3208267-3208289 CCTCTGCCCCCAAATCCCCATGG + Intergenic
1169881532 20:10352069-10352091 TCTTAGCCCCCAAAGTAGCAGGG - Intergenic
1171176260 20:23052399-23052421 TCTGTGCCCCCTGCACACCAGGG + Intergenic
1171436997 20:25131563-25131585 CCTGAGCCCCCACAGCACCTGGG + Intergenic
1174056234 20:47800319-47800341 TCTGTTCCCACAAAGCACCGGGG - Intergenic
1175101076 20:56579237-56579259 GCTGGGCTTCCAAAGCACCATGG - Intergenic
1175578929 20:60084058-60084080 TCTGTTCACCAAAAACACCATGG - Intergenic
1175911985 20:62409355-62409377 CCTCTGCAGCCAAAGCACCAAGG - Intergenic
1175915449 20:62423811-62423833 TCTTCTCCCCAAAAGCACCAAGG - Intronic
1178589625 21:33898450-33898472 TCTGTGCCCCAGAAGCAGCCTGG - Exonic
1179050559 21:37885371-37885393 TGTGTGTCCCCCAAGCAGCAAGG - Intronic
1179615916 21:42583512-42583534 GCTGTGCCCACAAGGCACCCAGG + Intergenic
1180595980 22:16973689-16973711 TCTGTGCCCCCATAGCACCTGGG + Intronic
1180786834 22:18552356-18552378 TGTGTGCACACAAAGGACCACGG + Intergenic
1180790109 22:18571199-18571221 CCTGTGTCCCCACACCACCAAGG + Intergenic
1180905519 22:19408207-19408229 TCGCTGGCCCCAAAGCCCCATGG + Intronic
1181231630 22:21424116-21424138 CCTGTGTCCCCACACCACCAAGG - Intronic
1181234904 22:21442952-21442974 TGTGTGCACACAAAGGACCACGG - Intronic
1181243745 22:21491877-21491899 TGTGTGCACACAAAGGACCACGG + Intergenic
1181247021 22:21510752-21510774 CCTGTGTCCCCACACCACCAAGG + Intergenic
1182782839 22:32881563-32881585 TCTCCGCCCCCAGAGCACCCAGG + Intronic
1183073573 22:35412611-35412633 TCTGTGCCCCCAAAGATGGAGGG - Exonic
1184401757 22:44278632-44278654 TCTGTACCCCCAAAGGTTCAGGG - Intronic
949111550 3:267282-267304 TCTGTGCCCACAGGTCACCAGGG - Intronic
953034810 3:39202412-39202434 TCAGTGCCCCCAGGTCACCAGGG + Intergenic
953179210 3:40580926-40580948 TCTGTGCCCTGAAACCATCAGGG + Intergenic
953861964 3:46552145-46552167 TCTGGGCTCCCAAAGCCCCCTGG + Intronic
953955889 3:47231740-47231762 GCTGTGCACACAAATCACCAGGG - Intronic
954627922 3:52032852-52032874 TCTGAGCCCACAGAACACCAGGG + Intergenic
954780053 3:53052066-53052088 TCTGTGCTCCCGAGGCAGCAGGG - Intronic
958085372 3:88798779-88798801 TGTATGCCCCCCAAGTACCATGG + Intergenic
959439974 3:106362509-106362531 TTTGTGCCAACAAAGCAACATGG + Intergenic
960008940 3:112812161-112812183 TCTGTGGCCTCACAGCACCCAGG + Intronic
965410986 3:168330907-168330929 TCTGTAGCCCCAAAGCACTGTGG - Intergenic
969020025 4:4133558-4133580 GCTGTCCCCCCAAAGAAGCAAGG - Intergenic
969793418 4:9507912-9507934 GCTGTCCCCCCAAAGAAGCAAGG + Intergenic
970406120 4:15766070-15766092 GCAGTGCCCTCTAAGCACCAGGG + Intergenic
970964743 4:21915072-21915094 TCTGTGCCGCTACAGCACCCTGG - Intronic
972074461 4:35067792-35067814 TGTTTGCCCCCAAACAACCAAGG + Intergenic
972306267 4:37833007-37833029 GCTGTGGCCCCAATGCTCCATGG - Intronic
972330670 4:38061992-38062014 TCTGTGCACCAAAAGCACCTGGG + Intronic
973928242 4:55761824-55761846 TCTGTGACCTCAGAACACCAAGG + Intergenic
976803527 4:89020030-89020052 TCTTTGGCCCAAAAGCATCAGGG + Intronic
981416508 4:144500085-144500107 TCTGGGCCACCAAAGCAACAAGG - Intergenic
982550421 4:156791163-156791185 TCTCTGCCACCAGAACACCAAGG + Intronic
984710411 4:182879802-182879824 TGTGTCCCCCCAAAACAGCAGGG - Intergenic
985281977 4:188296242-188296264 TTTGTGCCCTCTGAGCACCATGG - Intergenic
986161304 5:5231881-5231903 GCTTTCCCCCCAAAGCACCTGGG - Intronic
986972071 5:13348638-13348660 TATTTGCCCCTAAAGCACAAGGG + Intergenic
988563295 5:32299995-32300017 TCTGTGCCCCCAGAGCACTTGGG + Intronic
991535918 5:67669289-67669311 TCTGTGCACCCACAGGCCCAAGG - Intergenic
994965064 5:106658995-106659017 TCTGTACTCCCATAGCACCCTGG - Intergenic
998156546 5:139790019-139790041 CCTGTTCCTCCAAAGCACCAGGG - Intergenic
998882558 5:146658203-146658225 CCTGTGGTCCCAGAGCACCAGGG - Intronic
999256776 5:150213886-150213908 GCTGTGGCCCCAAAGCACTCTGG - Intronic
999434517 5:151553007-151553029 CCTGTGCTCCCAGAGAACCAGGG + Intronic
1000364212 5:160476228-160476250 CCTGTGCCGCCAAAGCAGCCAGG - Intergenic
1002063886 5:176642818-176642840 TCTCTACCCCCAGTGCACCATGG + Intronic
1007000387 6:38306600-38306622 TCTGTTCTTACAAAGCACCAGGG + Intronic
1007645495 6:43377248-43377270 TCTGGTCCCCCAGATCACCATGG + Intergenic
1010311670 6:74393508-74393530 TCTGTGCCTCCCAAGCAGCTGGG - Intergenic
1011522875 6:88228893-88228915 ACTGAGCCTCCAAACCACCATGG + Intergenic
1012166706 6:95963043-95963065 TCTGAACCCCCAAATCACTAAGG - Intergenic
1015937127 6:138415343-138415365 TCTGTGCCACCTATCCACCAGGG - Exonic
1015957474 6:138613688-138613710 GGTGTTCCCCCAAAGCACCCTGG + Intronic
1016237548 6:141886837-141886859 TGTGTGCCATCAAAGCAGCATGG - Intergenic
1018893061 6:167996214-167996236 TCTCTGCTCCTAAAGCACCTGGG - Intergenic
1018941595 6:168311961-168311983 TTTGTGCTCCCCAGGCACCAAGG - Intronic
1019034931 6:169046768-169046790 TCTTTGCCCTCAATGCACAAGGG + Intergenic
1020307430 7:6845593-6845615 GCTGTCCCCCCAAAGAAGCAAGG - Intergenic
1021602592 7:22379030-22379052 TCTGTGCACCCAAAGGTCAAAGG - Intergenic
1023911832 7:44561878-44561900 ACTGTGCCCACAGAGCACCTGGG + Intergenic
1024416080 7:49108330-49108352 TCTGTACCCCCATTGCACCTAGG + Intergenic
1027552933 7:79621776-79621798 GCTGTGCACCAAAATCACCAAGG - Intergenic
1028614791 7:92754351-92754373 TTTATGCCCCCAAAGCAAAATGG + Intronic
1029302870 7:99598570-99598592 TCTGTGGCCCCAAAGCCATAGGG - Intronic
1031852762 7:126885474-126885496 TCTGTGCCCCTAAAGCAGTCAGG + Intronic
1032651697 7:133885618-133885640 TCTGTGCCACCAGAGGACCCTGG - Intronic
1033277702 7:139985197-139985219 TCTGGGACCCCAAAGCACAGTGG + Intronic
1034205186 7:149308593-149308615 TCTGTAAGCCAAAAGCACCAAGG - Intergenic
1035917627 8:3642331-3642353 TCTTTCTCCCCACAGCACCAAGG - Intronic
1036117420 8:5972997-5973019 TCTTTTCCCCTAAAACACCAAGG + Intergenic
1037325738 8:17688274-17688296 CCTGTCCCCGCAAAGCACCAGGG - Intronic
1037779938 8:21861017-21861039 TCTGAGCCTCCAAAGCTGCAAGG - Intergenic
1038325636 8:26570773-26570795 TGTGTGACCCCAAAGCCCAAGGG - Intronic
1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG + Intergenic
1039354717 8:36802368-36802390 TCTGTGCTCCCAAAGTTCCAAGG - Intronic
1041439204 8:57875584-57875606 TCTGGGTTCCCAAACCACCACGG + Intergenic
1042144798 8:65716534-65716556 TCTGTGCACCCAAAGGGACATGG + Intronic
1043074206 8:75675364-75675386 TGGGTGACCCCAAAGCACCAGGG - Intergenic
1043141939 8:76601734-76601756 TATTTTCCCCCAGAGCACCACGG + Intergenic
1043618832 8:82162377-82162399 AATGTGCTCCCAAAGCAACACGG - Intergenic
1044630961 8:94278318-94278340 CCTGTGACCCTGAAGCACCAGGG + Intergenic
1047917964 8:129603349-129603371 TCTGTGCCCCCATTGTACCTAGG - Intergenic
1048183075 8:132214122-132214144 GCTGTGCCCCCAAATCACCTCGG + Intronic
1049196965 8:141320989-141321011 TCTGAGGCCCCAAAGCAGGAAGG + Intergenic
1049369098 8:142254979-142255001 TCTATCCCCCCAAACCACCCAGG - Intronic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1049909086 9:248190-248212 GCTTTGCCCCTCAAGCACCAGGG + Intronic
1051264668 9:15299036-15299058 TCTGTGCTCACAAAGTACCCTGG + Intronic
1051609277 9:18945587-18945609 TCTGTGTCCCATAAGGACCAGGG - Intronic
1052823528 9:33158736-33158758 TCAGTACCCTCAAAGCACCCAGG + Intronic
1053800442 9:41760652-41760674 TCTGTGACCCCAAAAGGCCAGGG - Intergenic
1055606904 9:77979595-77979617 TCTGAGGTCCCAAAGCCCCAGGG + Intronic
1058469232 9:105260099-105260121 TATGTGCTTCCAAAGCACCAGGG + Intronic
1060158834 9:121340896-121340918 TCTGAACCCCCTAAGCACCCAGG - Exonic
1185677625 X:1861461-1861483 TCTCTTCCCCCAAATCAGCAAGG - Intergenic
1188440016 X:30207478-30207500 TCTCAGCCCCCAAACCTCCAAGG - Intergenic
1190952131 X:55156470-55156492 TATGTGCTCCCAAAGTTCCAAGG + Intronic
1191185619 X:57607903-57607925 CCTGTGAGCCCACAGCACCAAGG - Intergenic
1191732131 X:64348200-64348222 TTGGTTCTCCCAAAGCACCAGGG - Intronic
1192249910 X:69403397-69403419 TCTGTGGCCCAAAATAACCAAGG - Intergenic
1193459919 X:81777891-81777913 GCTGTGCCTCCCCAGCACCATGG + Intergenic
1194110153 X:89824083-89824105 TGTGTGCCCCCAAAGTACAGTGG - Intergenic
1194539429 X:95152939-95152961 TTTGGTTCCCCAAAGCACCAGGG + Intergenic
1195134414 X:101889805-101889827 TCTGTGCAGCAAAACCACCATGG + Intronic
1195248417 X:103018374-103018396 TCTGTGCAGCAAAACCACCATGG - Intergenic
1196123940 X:112080295-112080317 TTTGTGCTTCCAAAGCACCCAGG - Intronic
1196388450 X:115185399-115185421 TCTTTGCCCTCAAAGTACTATGG + Intronic
1200212114 X:154351330-154351352 CCTGTGCCCCTTGAGCACCAGGG - Intronic
1200295376 X:154914098-154914120 TCTGTGCACCCACAGAACAAAGG + Intronic
1200462810 Y:3478824-3478846 TGTGTGCCCCCAAAGTACAGTGG - Intergenic
1201550865 Y:15215195-15215217 TCTGTACCCCAAAACCACCTGGG + Intergenic