ID: 912708717

View in Genome Browser
Species Human (GRCh38)
Location 1:111934165-111934187
Sequence CTGTAAAAGTGGGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 487}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912708705_912708717 30 Left 912708705 1:111934112-111934134 CCCGTGTGGTTCTGGGTAGGTCA No data
Right 912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG 0: 1
1: 0
2: 6
3: 45
4: 487
912708706_912708717 29 Left 912708706 1:111934113-111934135 CCGTGTGGTTCTGGGTAGGTCAC No data
Right 912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG 0: 1
1: 0
2: 6
3: 45
4: 487
912708708_912708717 5 Left 912708708 1:111934137-111934159 CCAAGTCGCCAGGTTGCTGTCTC 0: 1
1: 0
2: 2
3: 6
4: 75
Right 912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG 0: 1
1: 0
2: 6
3: 45
4: 487
912708709_912708717 -3 Left 912708709 1:111934145-111934167 CCAGGTTGCTGTCTCCTCACCTG No data
Right 912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG 0: 1
1: 0
2: 6
3: 45
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912708717 Original CRISPR CTGTAAAAGTGGGAGGTGGG AGG Intronic
900212950 1:1465997-1466019 TCATAAAAGTGTGAGGTGGGTGG + Intronic
901042508 1:6374017-6374039 CTCTAAAAGGCAGAGGTGGGAGG - Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901396907 1:8988397-8988419 CTGTTCCAGTGGGATGTGGGGGG + Intergenic
901866740 1:12111491-12111513 CTTTAAAAGAGGGAGGCAGGAGG + Intronic
902321730 1:15672440-15672462 CTTTGAAAGTCTGAGGTGGGCGG + Intergenic
903033117 1:20477408-20477430 CTGTAAGAGAGAGAGCTGGGTGG - Intergenic
903360825 1:22775979-22776001 TTGGCAGAGTGGGAGGTGGGTGG + Intronic
904396216 1:30224317-30224339 GTGGAAAAGTGAGGGGTGGGAGG - Intergenic
904465856 1:30707214-30707236 ATGTGAAGGTGGGTGGTGGGGGG - Intergenic
904558427 1:31380654-31380676 TTGTAAAGGTTGGCGGTGGGAGG + Intergenic
904760961 1:32804374-32804396 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
905037505 1:34927696-34927718 CTAAAAGAGTGGGGGGTGGGGGG - Intronic
906427291 1:45724999-45725021 CCGTCCAGGTGGGAGGTGGGGGG + Intronic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
907364316 1:53946409-53946431 CAGTGAAGGTGGGAGGAGGGAGG - Exonic
908675371 1:66597469-66597491 CCTTAAAAATGGGAGGTAGGGGG + Intronic
909261776 1:73499307-73499329 AATTAAAAGTGGGAGTTGGGGGG - Intergenic
909659077 1:78062430-78062452 ATGTAAAAGTGGGTGGAGGAAGG + Intronic
911709122 1:101048902-101048924 CTCCAAAAGGGGGAGGTTGGAGG + Intergenic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
915123800 1:153649412-153649434 CAGTAGAGGTGGGAGCTGGGAGG - Intergenic
915673668 1:157511235-157511257 CTGTAAAATAGGGATGTGGCAGG + Intergenic
915822582 1:159041091-159041113 CTGAAAAAGTGGTAGGTGAGAGG - Intronic
915937152 1:160096272-160096294 CTGTAAAATTGGGAGAGGTGGGG - Intronic
916314699 1:163436390-163436412 CTGTAAAAATGGGATGTGACGGG + Intergenic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917112889 1:171569542-171569564 TCATAAAAGTGGGGGGTGGGTGG - Intronic
917596426 1:176533580-176533602 CTGTAGAAGTGGCAGGGAGGAGG - Intronic
919800030 1:201348364-201348386 CTGTCCTGGTGGGAGGTGGGCGG + Intergenic
920160913 1:203997110-203997132 CTGGAAAAAGGGGAGGGGGGAGG - Intergenic
920947903 1:210546785-210546807 CTGTGAAAGTGGGAATGGGGAGG + Intronic
922720682 1:227898822-227898844 GGGTCATAGTGGGAGGTGGGTGG + Intergenic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923401112 1:233615664-233615686 CTGTAAAGGTTGAGGGTGGGGGG - Intronic
924754948 1:246932094-246932116 CGGTGAAAGAAGGAGGTGGGAGG + Intergenic
924898192 1:248365482-248365504 CCCTCAAAGTTGGAGGTGGGAGG - Intergenic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1063501079 10:6555122-6555144 AAGTAAAGGTGGGAGGGGGGGGG + Intronic
1063689028 10:8266097-8266119 TAGTAGAAGTGGGCGGTGGGGGG - Intergenic
1063734563 10:8738694-8738716 CTTTAAAAGGCTGAGGTGGGAGG + Intergenic
1064240598 10:13624533-13624555 CTGCTAGAGTGGGAGGAGGGCGG - Intronic
1065043068 10:21717382-21717404 TTGTAAAATTGGCGGGTGGGGGG + Intronic
1065173270 10:23052917-23052939 ATGCAAAAATGGGAGGTGGATGG - Intergenic
1065594253 10:27296322-27296344 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1066173806 10:32881733-32881755 CTGTAATTGTGGGGTGTGGGGGG - Intronic
1066214748 10:33275323-33275345 CTTTAGAAGGCGGAGGTGGGTGG + Intronic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1069715233 10:70516375-70516397 CTGTAAGAGGCTGAGGTGGGCGG - Intronic
1070404909 10:76086005-76086027 CTATAAAATTGGGCGGGGGGTGG - Intronic
1070578032 10:77694625-77694647 AAAAAAAAGTGGGAGGTGGGGGG + Intergenic
1070770387 10:79079090-79079112 CAGCAAAAGTGGGAGGCTGGAGG - Intronic
1071471533 10:85987311-85987333 AAGTGAGAGTGGGAGGTGGGAGG - Intronic
1072167797 10:92830658-92830680 TTGTCACCGTGGGAGGTGGGTGG - Intergenic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1072722550 10:97789780-97789802 CTGAAAAAATGGGGGGTTGGGGG + Intergenic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1074491417 10:113942556-113942578 CAGTGGGAGTGGGAGGTGGGAGG - Intergenic
1075823435 10:125333764-125333786 TTTTAAAAGTGTGTGGTGGGTGG - Intergenic
1076682328 10:132179583-132179605 CTGGAAGTGTGGGGGGTGGGGGG - Intronic
1077177463 11:1197228-1197250 CTGTGGAGGTGTGAGGTGGGGGG + Intronic
1077325262 11:1961022-1961044 CAGGAAAGGTGGGAGGTGGGAGG - Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077599187 11:3561663-3561685 CTGTAAAAGTGTGAGTGAGGAGG - Intergenic
1077778598 11:5299539-5299561 CTTTGAAAGTAGGACGTGGGGGG - Intronic
1077884581 11:6377320-6377342 CAGTAAGAGTGGGTGGTGTGAGG + Intergenic
1078190983 11:9092046-9092068 CTTTCCACGTGGGAGGTGGGAGG + Intronic
1078417877 11:11180513-11180535 CTGGAAAGGTGGGAGGAGGTAGG + Intergenic
1078907880 11:15704372-15704394 CTGGAAAACTGGAGGGTGGGAGG - Intergenic
1079004022 11:16779967-16779989 CTCTAAAACGGGGAGGGGGGGGG + Intronic
1079492943 11:21009939-21009961 CCGTAACAGTGGGTGGGGGGAGG - Intronic
1079989733 11:27233943-27233965 CTGTAACAGTGGAAGAGGGGTGG + Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1081806303 11:45892653-45892675 AGATAAAGGTGGGAGGTGGGGGG + Intronic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1085105214 11:73836440-73836462 CTTTAGAAGGGTGAGGTGGGAGG - Intronic
1085512479 11:77095397-77095419 AGGGCAAAGTGGGAGGTGGGGGG - Intronic
1085709467 11:78816008-78816030 CAGAAAAAGTGGGAAGTTGGGGG - Intronic
1085997177 11:81932964-81932986 CTGTAAAACTGAGAGGTTGGGGG + Intergenic
1086677177 11:89622557-89622579 CTGGAAAATTGTGGGGTGGGGGG - Intergenic
1087234962 11:95707812-95707834 CTGCAACAGCGGGAGGTGGCAGG - Intergenic
1088912744 11:114204381-114204403 CTTTAAGAGGGTGAGGTGGGTGG - Intronic
1088983027 11:114881025-114881047 TTGTAATAGTGGGAGGTGACAGG - Intergenic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1091263133 11:134249699-134249721 CTGTAAAAGGGGGATGGGGTGGG + Intronic
1202808243 11_KI270721v1_random:16201-16223 CAGGAAAGGTGGGAGGTGGGAGG - Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092843216 12:12562461-12562483 TTGTGAAAGTGGGGGTTGGGGGG + Intergenic
1092861918 12:12725698-12725720 GGGAAGAAGTGGGAGGTGGGCGG - Intergenic
1095792757 12:46185445-46185467 CTGTAAAAAAGGAAAGTGGGTGG + Intronic
1096004958 12:48162012-48162034 GTGTAAAAGTGGGAGGAGGTAGG - Intronic
1096836628 12:54355459-54355481 CTGGAATACTGGGAGATGGGGGG - Intergenic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097201661 12:57284083-57284105 CTGCTAAAGTGGTGGGTGGGAGG - Intronic
1098019133 12:66135164-66135186 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1098264709 12:68706686-68706708 CTGTCCAAGCTGGAGGTGGGCGG + Intronic
1098345715 12:69501216-69501238 CTTTTAAAGGGGGAGGGGGGAGG - Intronic
1098925215 12:76342006-76342028 CTGAGCAGGTGGGAGGTGGGTGG + Intergenic
1099718346 12:86327987-86328009 CTTTGAAAATGGGAGGTTGGAGG - Intronic
1100825138 12:98467958-98467980 CTTTAGAAGGCGGAGGTGGGAGG - Intergenic
1100995117 12:100294576-100294598 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1101183820 12:102251224-102251246 CCGTCCAAGAGGGAGGTGGGGGG - Intergenic
1101599433 12:106196143-106196165 CTGCAAGCGTGGGATGTGGGTGG + Intergenic
1101982889 12:109422828-109422850 CTTTGAAAGTCCGAGGTGGGTGG + Intronic
1102089308 12:110172972-110172994 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1102376321 12:112424291-112424313 CTGGGAAGGTGGGAGGTAGGTGG + Intronic
1102921361 12:116794020-116794042 CTTTGAGAGTGTGAGGTGGGAGG + Intronic
1103061753 12:117863896-117863918 CTGTATAAGAGGGAAGTAGGAGG - Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1105977807 13:25488873-25488895 CAGCAAAAATGGGGGGTGGGGGG - Intronic
1106155313 13:27149615-27149637 CTGCAGATGTGGGGGGTGGGAGG + Intronic
1106288586 13:28339969-28339991 CTTTAAAAGGCTGAGGTGGGTGG + Intronic
1106925477 13:34608399-34608421 CGGGAAAAGTGGGAGATCGGGGG + Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107488806 13:40859803-40859825 TTGCCAAATTGGGAGGTGGGAGG + Intergenic
1107850420 13:44566910-44566932 CTATATAAGTGGGATGTGGGGGG + Intronic
1107866641 13:44709695-44709717 CTGTAATGGTGGGAGGTGGGAGG - Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1109502529 13:63256017-63256039 CTGTAATAGGGGGAGGTGTGAGG + Intergenic
1109516813 13:63454044-63454066 CTAGAAATGTGGGAAGTGGGAGG + Intergenic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1110910509 13:80956059-80956081 ATGGGAAGGTGGGAGGTGGGAGG + Intergenic
1111939156 13:94591027-94591049 CTATTAAACAGGGAGGTGGGAGG - Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1114709246 14:24761600-24761622 CAGTAAAAGTGAGAGGAAGGTGG - Intergenic
1114890697 14:26918751-26918773 CTATAAAAGTAAGAGGGGGGAGG + Intergenic
1115078121 14:29415635-29415657 CTGCAGAAGTGGGTGGTGGATGG + Intergenic
1115475235 14:33807036-33807058 CCATAAATGTTGGAGGTGGGTGG + Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117402683 14:55372178-55372200 CAGACAGAGTGGGAGGTGGGAGG - Intronic
1117503363 14:56376053-56376075 CTGTGAAAGAAGGGGGTGGGGGG - Intergenic
1118273903 14:64368413-64368435 CTTTGAAAGTCTGAGGTGGGTGG + Intergenic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1119274141 14:73338111-73338133 CTGTAGAGGTTGGGGGTGGGGGG - Intronic
1119711006 14:76822081-76822103 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1121673557 14:95732867-95732889 CTGAAATTTTGGGAGGTGGGTGG - Intergenic
1121744333 14:96276220-96276242 CTGAAAGAGTGGGAGTTGAGGGG + Exonic
1121831664 14:97057416-97057438 CTGGAAAAGTGGGAAGTGTGTGG + Intergenic
1123480348 15:20625347-20625369 CCATAAAAGTGTGAGGTGTGTGG + Intergenic
1123637660 15:22375018-22375040 CCATAAAAGTGTGAGGTGTGTGG - Intergenic
1123893944 15:24809547-24809569 CTGTCAAAGTGGCATGAGGGAGG - Intergenic
1124615193 15:31236559-31236581 CTGGAGCAGTGGGAGATGGGTGG + Intergenic
1124990130 15:34664935-34664957 TGGTAATGGTGGGAGGTGGGTGG + Intergenic
1125862926 15:43014957-43014979 CTGTCAGGGAGGGAGGTGGGGGG + Intronic
1126007440 15:44271648-44271670 CTGTACAAGTGGAAGTTGAGAGG + Intergenic
1127072936 15:55302966-55302988 CCGTCCAAGAGGGAGGTGGGGGG + Intronic
1127719398 15:61684878-61684900 CTGGAAGAGTGGTAGGTGAGAGG - Intergenic
1128292409 15:66488065-66488087 AGGTAAGAATGGGAGGTGGGAGG - Intronic
1128342833 15:66834793-66834815 CTGTAAAAGTGGAGGGGGCGTGG - Intergenic
1128707668 15:69849617-69849639 ATACAAAAGTAGGAGGTGGGCGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128878859 15:71224806-71224828 CCTTATAAGTGGGAGGTAGGAGG - Intronic
1129937665 15:79464101-79464123 CTCTAAAAGAGGGCTGTGGGAGG + Intronic
1130097524 15:80867084-80867106 CTGTAAAATGGGGAGGGTGGGGG + Intronic
1131234476 15:90683998-90684020 CTTTATAAGTTGGATGTGGGTGG + Intergenic
1132648647 16:1010521-1010543 CCATAAAAGTGGCTGGTGGGAGG + Intergenic
1133445207 16:5853684-5853706 CTGTAGACGAGGGAGGTGTGGGG + Intergenic
1133524770 16:6593990-6594012 CTGTAACACTGGGCGGAGGGAGG - Intronic
1133599684 16:7326881-7326903 CTGAAAAAGTGTGAGGAAGGTGG - Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134349175 16:13420538-13420560 TTATAAAAGTGGGGGATGGGGGG + Intergenic
1135593416 16:23722188-23722210 CTGAAACAGTGGAGGGTGGGAGG - Intergenic
1136416833 16:30109286-30109308 CTTTGAAAGTCTGAGGTGGGAGG + Intronic
1137274415 16:46924088-46924110 CAGCAAAACAGGGAGGTGGGTGG - Intronic
1137290734 16:47050336-47050358 CTTTGGAAGTGGGATGTGGGTGG + Intergenic
1137582709 16:49643552-49643574 CTCCCAAAGTGGGGGGTGGGGGG - Intronic
1137789746 16:51165132-51165154 CTGTAAAAGTTGGGGGTGGGGGG - Intergenic
1138087404 16:54145372-54145394 CTTTAAAAGTTGGAGGTAGGAGG - Intergenic
1138642201 16:58396142-58396164 CCGTCCAAGAGGGAGGTGGGGGG - Intronic
1139132184 16:64159815-64159837 CTGTAACACTGGGAAGAGGGAGG + Intergenic
1139332234 16:66202278-66202300 CTATAAAGGTGGGAAGTGGAGGG + Intergenic
1139694536 16:68664473-68664495 CAGTAGAAGTGATAGGTGGGCGG + Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140600956 16:76474276-76474298 TTGTAAAAGTGGCAAGTGGCTGG + Intronic
1140714760 16:77712357-77712379 CTGTATAAGTGGTAATTGGGGGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143580770 17:7824386-7824408 CTGTAGAAGTGGGAGGTACAGGG - Intronic
1143887840 17:10078709-10078731 GTGTAAAATTGGTAGGTAGGGGG + Intronic
1144887086 17:18470696-18470718 TTTTAAAGGTGGGATGTGGGCGG - Intergenic
1145145130 17:20473599-20473621 TTTTAAAGGTGGGATGTGGGCGG + Intergenic
1145832738 17:27930220-27930242 CTATCAAAGTGGCAAGTGGGAGG - Intergenic
1146174889 17:30659568-30659590 CTTTAAGAGACGGAGGTGGGTGG + Intergenic
1146348345 17:32075592-32075614 CTTTAAGAGACGGAGGTGGGTGG + Intergenic
1146353805 17:32117771-32117793 TTTTAAAGGTGGGATGTGGGCGG - Intergenic
1146454548 17:32998704-32998726 CTCTAAAGGAGGAAGGTGGGTGG + Intergenic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1147505000 17:41007166-41007188 CTCAAAAAGTGGAGGGTGGGAGG + Intergenic
1148094620 17:45043815-45043837 CTATACAAGTGGAAGGAGGGAGG - Intronic
1148107142 17:45124750-45124772 CAGGAACAGTAGGAGGTGGGCGG - Intronic
1149372918 17:56013135-56013157 AAGTAAGAGAGGGAGGTGGGTGG + Intergenic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151218073 17:72591585-72591607 CTGAATAGGTGGGAGGTGGCAGG - Intergenic
1151314397 17:73312506-73312528 CTGTAAACGAGGGAGCGGGGAGG + Intergenic
1151582546 17:74988324-74988346 CTGCAAAAGTGGGGGGCGGGGGG + Intronic
1151788806 17:76290718-76290740 CAGTAGCATTGGGAGGTGGGCGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152144047 17:78557024-78557046 CAGTAATTGTTGGAGGTGGGGGG - Intronic
1152354330 17:79799334-79799356 CTGTGGAAGTGGGAGGGAGGGGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1154975154 18:21450290-21450312 CTACAAAATTGGGGGGTGGGAGG + Intronic
1155840110 18:30632966-30632988 CTGAAAAAGAGAGAGGTGGCAGG + Intergenic
1156844237 18:41645430-41645452 CTATATAATTGGGAGGTGGTTGG + Intergenic
1156880199 18:42068600-42068622 TGGGAAAAGTGGGAGGTGGGGGG - Intronic
1157486033 18:48087834-48087856 TTTTAAAAGTGGGTGGGGGGGGG + Intronic
1157593935 18:48852457-48852479 TAGAAAAAGTTGGAGGTGGGGGG - Intronic
1157648481 18:49302595-49302617 CTGTTGAAGGCGGAGGTGGGGGG + Intronic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1159055409 18:63458614-63458636 TTATAAAAATGGGGGGTGGGGGG - Intergenic
1159875327 18:73804306-73804328 GGGGAAGAGTGGGAGGTGGGGGG - Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161635613 19:5387030-5387052 CTGTAAAATGGGGATGTGTGTGG - Intergenic
1161668469 19:5590892-5590914 GTGGAGAGGTGGGAGGTGGGCGG - Intronic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1164105827 19:22107278-22107300 CTGTCCGGGTGGGAGGTGGGGGG - Intergenic
1164962643 19:32447962-32447984 CAGGAAGAGTGGGAGGTGGGTGG + Intronic
1165737243 19:38184476-38184498 CTGTAAAAGGGGGAGGACAGGGG - Intronic
1165945279 19:39437964-39437986 CTCTAAAAGGGTGAGGGGGGAGG + Intronic
1166191823 19:41180768-41180790 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1167370455 19:49078005-49078027 CTTTAAAAGAGGGACGTGGCTGG + Intergenic
1168362976 19:55758371-55758393 ATGTAAAAGTGGGAGACTGGAGG - Intergenic
1168363931 19:55768371-55768393 ATGTAAAAGTGGGAGACTGGAGG - Intergenic
925036779 2:692983-693005 GGGTAAGTGTGGGAGGTGGGAGG - Intergenic
925195435 2:1920239-1920261 CTGTATAAATGGGGGTTGGGTGG - Intronic
926252739 2:11165164-11165186 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
926578081 2:14604787-14604809 CTGTCACAATGGGTGGTGGGTGG - Intergenic
927389991 2:22583765-22583787 CTCTAAAAATGGGAGGTCAGGGG - Intergenic
927724272 2:25409088-25409110 CTGGAAAAGTGGCAGGTGGGAGG + Intronic
927850364 2:26494891-26494913 CTGTAAATATGGCAGGAGGGTGG - Intronic
929021248 2:37555441-37555463 TTCTAAATGTGGGAGTTGGGGGG + Intergenic
929046073 2:37791883-37791905 CTGAAAAAGTGTGTGGTGGTTGG + Intergenic
929118160 2:38462246-38462268 CTGGAACAGTGGGAAGTGCGGGG + Intergenic
929474491 2:42232236-42232258 CTGCACAAGTGGGAGGTGGTGGG + Intronic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930646231 2:53911587-53911609 CTCTAACAGTGGGCGGGGGGAGG - Intronic
930973665 2:57427944-57427966 GTTTAAAAGTTTGAGGTGGGAGG + Intergenic
931237489 2:60423778-60423800 CTGTAAAAAAGGGATGTGGTAGG + Intergenic
931901528 2:66794433-66794455 ATGTAAAAGTAAGGGGTGGGTGG + Intergenic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
934998509 2:98988903-98988925 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
935282402 2:101529531-101529553 CTGTAAAGGCGGGGGGTGGGAGG - Intergenic
936590079 2:113795297-113795319 ATCTAAACATGGGAGGTGGGAGG + Intergenic
937505833 2:122535418-122535440 CTGTTAAAAATGGAGGTGGGTGG + Intergenic
937950709 2:127385683-127385705 AATAAAAAGTGGGAGGTGGGGGG + Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938015404 2:127863133-127863155 TTGTACAAATTGGAGGTGGGTGG + Exonic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
940847422 2:158656847-158656869 CTGTAAAAGAGGGTGGTATGGGG - Intronic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
943764626 2:191647428-191647450 GTGTAAAAGTGGGAGGAGCAGGG + Intergenic
944148311 2:196530171-196530193 CTGTAAGAGTGGGAGGTTTTGGG - Intronic
944591299 2:201220312-201220334 CTGGCATAGAGGGAGGTGGGGGG + Exonic
946200783 2:218069660-218069682 AGGTAAATGAGGGAGGTGGGTGG - Intronic
946314224 2:218898653-218898675 CTGGAAAAATGGGAGGTTGGTGG - Intronic
946502591 2:220265516-220265538 AAATAAAAGAGGGAGGTGGGAGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947233886 2:227920031-227920053 ATGGAAAAGTGGGGTGTGGGAGG + Intronic
947392820 2:229656425-229656447 CTGGAAAAGTGCAAGGTGAGGGG + Intronic
948854719 2:240724833-240724855 CTGGATAAGTGGGCGGTGGCTGG - Intronic
948865830 2:240774324-240774346 CTGTAAATGTGGGGGGAAGGGGG - Intronic
1169159161 20:3361477-3361499 CAGGGAAAGTGGGAGGTGGGAGG + Intronic
1169228750 20:3872910-3872932 CTGTACTGGTGGGTGGTGGGAGG - Exonic
1169404298 20:5310610-5310632 CTGTACAGGTGGCAGGTGGTAGG - Intronic
1169787595 20:9376753-9376775 CTGCAGAATTGGGAGATGGGTGG + Intronic
1170623095 20:18010609-18010631 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1171122036 20:22576701-22576723 CTTTTAATGTGGGAGGGGGGCGG - Intergenic
1171519150 20:25762557-25762579 CTGAAAAGGAGGGAGGTGTGTGG - Intergenic
1171557777 20:26093932-26093954 CTGAAAAGGAGGGAGGTGTGTGG + Intergenic
1171957261 20:31471092-31471114 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1172883573 20:38217093-38217115 CTGTGCAAGTGGGTGGGGGGGGG + Intronic
1172897671 20:38311991-38312013 CCGTAGAAGGGGGAGGTGTGTGG - Intronic
1174733663 20:52942981-52943003 CTGGAAAAGTGGAATGTGTGAGG - Intergenic
1175098064 20:56557834-56557856 CTTTGGGAGTGGGAGGTGGGTGG + Intergenic
1175118697 20:56702231-56702253 CTTTAGAAGTGGGGGGTGGGGGG - Intergenic
1175334166 20:58184324-58184346 CTGGAAAACTGGGAGCTGGCTGG + Intergenic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1175858398 20:62135077-62135099 TTGTAACAGTGGGTGGAGGGAGG + Exonic
1176185110 20:63774060-63774082 CTGAAAAACTGGGGGGGGGGGGG - Intronic
1176201926 20:63864992-63865014 CTGGGAAGGTGGGAAGTGGGAGG - Intergenic
1176348188 21:5770441-5770463 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176355002 21:5891025-5891047 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176496639 21:7554014-7554036 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1176542509 21:8168511-8168533 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176561460 21:8351556-8351578 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176653287 21:9568838-9568860 CTGAAAAGGTGGGAGGTGTGTGG - Intergenic
1176672157 21:9744959-9744981 CTGTAAGCTAGGGAGGTGGGGGG - Intergenic
1178921083 21:36738680-36738702 CTACAACAGTGGGAGGTGGGAGG - Intronic
1179191388 21:39125161-39125183 CAGGACAAGTGGGAGGAGGGAGG - Intergenic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179289575 21:40006804-40006826 CCTTAAAAGTGTGTGGTGGGGGG - Intergenic
1179572354 21:42285119-42285141 CTGTTAAAATGGGGGGAGGGGGG + Intronic
1181171032 22:21010202-21010224 ATGTACATGAGGGAGGTGGGTGG - Intronic
1181185000 22:21096810-21096832 CTTAAAAAGTGCAAGGTGGGAGG + Intergenic
1181273935 22:21676987-21677009 CCGTCCAAGAGGGAGGTGGGGGG - Intronic
1181599720 22:23942322-23942344 CTGGAGAAGTGGGAGGTGCCTGG + Intergenic
1182366764 22:29784400-29784422 CTTTGAAAGACGGAGGTGGGTGG - Intergenic
1184095675 22:42315007-42315029 CTTTAAAAGTAAGAGGTGGCAGG + Intronic
1184320299 22:43736881-43736903 CTGGAAAGATGGGGGGTGGGCGG - Intronic
1184494072 22:44827107-44827129 CTTTACAAGAGGGAGGTAGGAGG + Intronic
1203247449 22_KI270733v1_random:84929-84951 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
949283213 3:2370837-2370859 CACCAAAAGAGGGAGGTGGGGGG - Intronic
949357810 3:3200391-3200413 CTGCAAAACTGGGGGCTGGGGGG + Intergenic
949542828 3:5047367-5047389 CTGGAAAAGAAGGAGATGGGAGG - Intergenic
950132740 3:10558443-10558465 CTGAGAAGGTGGGAGGAGGGGGG + Intronic
950399581 3:12759891-12759913 CTGGATAAGTGAGAGGTGAGAGG - Intronic
950949136 3:16980278-16980300 CCGTCCAAGAGGGAGGTGGGGGG - Intronic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
952057377 3:29464230-29464252 CAGTAAGACTGGGAGGTAGGAGG + Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
953343247 3:42153501-42153523 TTATAAAAGGGGGAGGTGAGCGG - Intronic
953370759 3:42386407-42386429 CCTTAAAAGAGGGAGGCGGGGGG - Intergenic
953979785 3:47407804-47407826 CTGTACAGGTGGGTGGAGGGTGG + Exonic
954481255 3:50803749-50803771 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
954752189 3:52819917-52819939 GTGACAAAGTAGGAGGTGGGGGG - Exonic
955917577 3:63922367-63922389 TAGTAAAAATGGGAAGTGGGAGG + Intronic
956488107 3:69742512-69742534 CTGTAGCAGAGGGAGGTAGGAGG - Intronic
956659133 3:71582279-71582301 CTGAAAAGGAGGGAGGCGGGAGG + Intronic
957506036 3:81122345-81122367 AAGTAAAAGTGGAAGGAGGGAGG - Intergenic
957620291 3:82585007-82585029 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
958042941 3:88247583-88247605 CAGTAAAGGGGGGCGGTGGGGGG + Intergenic
958971047 3:100610585-100610607 CTGGAAAAGGAGGACGTGGGAGG + Intronic
959620952 3:108398082-108398104 CTGGAAAAAAGGGAGGTAGGGGG + Intronic
960190283 3:114696401-114696423 CAGAAAAGGTGGGAGGTGGGTGG - Intronic
960996224 3:123342368-123342390 CCTTAAAAGTGGGAGGTGTTGGG + Intronic
961658373 3:128455603-128455625 TGGTAAAAGAGAGAGGTGGGAGG + Intergenic
962112784 3:132470798-132470820 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
962856115 3:139346359-139346381 CGGTATAAGTGGGAGGTGTGGGG - Intronic
963498558 3:146097110-146097132 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
964958165 3:162388441-162388463 TTGTGAAATTGGGAGGAGGGAGG - Intergenic
966551353 3:181207786-181207808 CTGCACAAATTGGAGGTGGGTGG - Intergenic
967605198 3:191436681-191436703 GAGTAATAGTGGGAGATGGGAGG - Intergenic
968460718 4:723514-723536 CTGTGAAAGTGAGAGCTGTGTGG + Intronic
969158043 4:5230484-5230506 TTGTAAAAGTGGAATGTGGCCGG - Intronic
969540496 4:7785691-7785713 CTTTGAAAGTCTGAGGTGGGAGG + Intronic
970211730 4:13716939-13716961 GTTTTAAAGTGGGAGGTGTGAGG - Intergenic
970897302 4:21118646-21118668 CAGTGCAAGTGGGTGGTGGGGGG + Intronic
970969526 4:21965479-21965501 CTGTAAAAGTTGTCTGTGGGTGG + Intergenic
971043435 4:22779219-22779241 CTCCAAAAGTGGGTGGGGGGGGG - Intergenic
973185162 4:47318487-47318509 CTCTAATAGTGGGAAGTGTGAGG - Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973688792 4:53403621-53403643 TTGAAAAAGTGGTAGTTGGGAGG + Intronic
975330251 4:73104738-73104760 CTATTTAAGCGGGAGGTGGGGGG + Intronic
975736714 4:77388540-77388562 CTGTAGAAGTGACATGTGGGAGG - Intronic
976166421 4:82260045-82260067 CTGTAAATGTGGGAAGAGAGGGG + Intergenic
976265274 4:83182720-83182742 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
977561647 4:98539021-98539043 CTGTAACAGTTGGGGGTGGGAGG + Intronic
977925574 4:102696729-102696751 CTGCAAAAGGGGGAGCTGTGAGG - Intronic
978933374 4:114345191-114345213 CTAGAAAAGTGGGAGTTGGGTGG - Intergenic
979533000 4:121789055-121789077 CTGCAAAAGATGGAGGTGGTAGG - Intergenic
980569189 4:134588531-134588553 ATGTAAAAGAGAGAGGGGGGGGG + Intergenic
980895241 4:138854449-138854471 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
981284384 4:142998252-142998274 CTGTAAGAGGCTGAGGTGGGAGG - Intergenic
981361239 4:143848002-143848024 GTCTAAGAATGGGAGGTGGGTGG + Intergenic
981371980 4:143969001-143969023 GTCTAAGAATGGGAGGTGGGTGG + Intergenic
981381070 4:144072202-144072224 GTCTAAGAATGGGAGGTGGGTGG + Intergenic
981458951 4:144990012-144990034 CTATAAAAGTGTGAGGTGAAGGG + Intronic
982316893 4:154041180-154041202 CTGTGAAAATGGGTGGTGTGTGG - Intergenic
983297714 4:165887259-165887281 ATGAGAAAGTGGGAGGAGGGAGG + Intronic
983404053 4:167302603-167302625 CTGTAAAAGTGGTGGGAGTGAGG - Intergenic
984769441 4:183424520-183424542 CAGTAAAGGAGGGAGGTGGCAGG + Intergenic
984977125 4:185240528-185240550 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
985402579 4:189606889-189606911 CTGTAAGCTAGGGAGGTGGGGGG + Intergenic
988240047 5:28597000-28597022 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
988552581 5:32210081-32210103 CTGTAACATTTGGAGGTAGGAGG + Intergenic
989247741 5:39273006-39273028 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
990085252 5:51968788-51968810 GTGCCAAAGTAGGAGGTGGGAGG + Intergenic
990441135 5:55846553-55846575 CTTTAAAATTCTGAGGTGGGCGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990668070 5:58095807-58095829 TTGTAAAACTAGGAGCTGGGTGG - Intergenic
992980000 5:82159383-82159405 CTGGATAAGTGGGAGCTAGGTGG + Intronic
993302192 5:86225058-86225080 GTGTTGATGTGGGAGGTGGGGGG - Intergenic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994540290 5:101086540-101086562 CTTTAAGGGTGGGTGGTGGGAGG - Intergenic
994782852 5:104115061-104115083 CAGTAAAAGTGGGAGGGATGAGG - Intergenic
995859643 5:116628004-116628026 CTGCAAAAGTGGCAGGTGAATGG - Intergenic
996760919 5:126984935-126984957 GTGGAAAGGTGGGAGCTGGGAGG + Intronic
997874813 5:137537936-137537958 CCGTCCAGGTGGGAGGTGGGGGG - Intronic
997874957 5:137538288-137538310 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
998218354 5:140254606-140254628 CTGTAAAATTGTGAGGAGAGAGG - Intronic
999101495 5:149029267-149029289 TTGTAAAAGTGGCAGGGGCGAGG + Intronic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1001040912 5:168334546-168334568 CTGTAAATGGGGGTGGAGGGGGG - Intronic
1001052128 5:168422090-168422112 CTGAAAAGGTGAGTGGTGGGCGG + Exonic
1001489633 5:172146277-172146299 GTCTAAACGAGGGAGGTGGGAGG + Intronic
1001644350 5:173269166-173269188 CTGGACATGTGGGAAGTGGGTGG - Intergenic
1002687068 5:181021072-181021094 CTGTAAAAATGTGTGGTGGCAGG - Intergenic
1003179631 6:3780643-3780665 GTCTAAAAGAGGCAGGTGGGAGG + Intergenic
1003821394 6:9901461-9901483 CTGTAAATGTGTGACTTGGGTGG + Intronic
1004697796 6:18050237-18050259 CTTTAAGAGTCTGAGGTGGGAGG + Intergenic
1004855730 6:19747732-19747754 CTTTAAGAGGGTGAGGTGGGAGG - Intergenic
1004874393 6:19939598-19939620 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1005051280 6:21686224-21686246 CACGAACAGTGGGAGGTGGGGGG - Intergenic
1008160786 6:48072816-48072838 CTGTAGAAATGGGAGGTTGCAGG - Intergenic
1008461894 6:51785139-51785161 CAATGAAAGAGGGAGGTGGGAGG + Intronic
1009840436 6:69066139-69066161 GTGTGAAGGTTGGAGGTGGGGGG - Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010339694 6:74734276-74734298 CTGTAAAAGTGGGTCTTTGGAGG + Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011087602 6:83559937-83559959 CTGCAAAAGTGAGATTTGGGGGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013582770 6:111552416-111552438 TTGTAAAAGTGGAAGGCAGGAGG - Intergenic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015574399 6:134655932-134655954 CTGTAAAATAGGGAGGTTTGTGG + Intergenic
1015973502 6:138766652-138766674 CTGTCAAAGTGGTAGGAAGGAGG - Intronic
1016806547 6:148217766-148217788 AAGCTAAAGTGGGAGGTGGGAGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017959239 6:159207326-159207348 CTGGGAAGGTGGGAGATGGGTGG + Intronic
1018696507 6:166395647-166395669 CTAAAAGAGAGGGAGGTGGGTGG + Intergenic
1020166318 7:5810156-5810178 ATGTAAACATGGGATGTGGGGGG - Intergenic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020831836 7:13103031-13103053 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021226106 7:18027961-18027983 GTCTAAAAGTGTGAAGTGGGAGG - Intergenic
1021504051 7:21361281-21361303 CTGTAAAAGAGGGAGAAGTGAGG - Intergenic
1021872493 7:25018989-25019011 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1023097280 7:36673867-36673889 CAAGAAAACTGGGAGGTGGGAGG - Intronic
1023213492 7:37833330-37833352 CTACAAAAGTGGGAGGGTGGGGG + Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023283553 7:38595308-38595330 CTGTACAGGTGGGAGGTGCTGGG + Intronic
1023862611 7:44225314-44225336 CTGTAGAAGTGGCAGGTGTCGGG + Intronic
1025279629 7:57617505-57617527 CTGAAAAGGAGGGAGGTGTGTGG - Intergenic
1025305102 7:57847995-57848017 CTGAAAAGGAGGGAGGTGTGTGG + Intergenic
1026423241 7:70262431-70262453 CTTTAAAAGGCGGAGGGGGGTGG - Intronic
1026867569 7:73832899-73832921 CTTTAAAAGGTCGAGGTGGGAGG + Intergenic
1026981063 7:74526783-74526805 CTGCTGATGTGGGAGGTGGGGGG + Intronic
1027448624 7:78303498-78303520 CTATAAAAATGTGGGGTGGGAGG - Intronic
1028020847 7:85769043-85769065 ATGTGAAAGTGTGAAGTGGGAGG - Intergenic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1029044259 7:97611442-97611464 CTCACATAGTGGGAGGTGGGAGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029940972 7:104480335-104480357 CTGGAAATCTGGGCGGTGGGGGG - Intronic
1030048185 7:105516050-105516072 CTTTACAAGTTTGAGGTGGGCGG - Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031050835 7:116943832-116943854 CAGCAAAACTGGGAGGTAGGAGG - Intergenic
1031568012 7:123323235-123323257 TTGTAAAATTAGGAGGTGTGAGG - Intergenic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032794593 7:135267637-135267659 CTAAAAAAATGGGAAGTGGGTGG - Intergenic
1033376110 7:140763292-140763314 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1034030898 7:147762714-147762736 ATGTATAAGTGGGGGGAGGGAGG + Intronic
1034459580 7:151191135-151191157 CTGTAAAAGGGGGAGGGGTGAGG - Intronic
1035543115 8:457525-457547 ATGTAAAGCTGGAAGGTGGGGGG + Intronic
1035564302 8:631038-631060 CTGTCAATGTGGGTGGTGGGTGG - Intronic
1036568186 8:9956168-9956190 CTTTATAGGTTGGAGGTGGGTGG - Intergenic
1037936977 8:22921516-22921538 CTGGAAGGGTGGGAGGTGGAAGG - Intronic
1038970305 8:32626185-32626207 CTTGGGAAGTGGGAGGTGGGAGG + Intronic
1039422082 8:37451702-37451724 GCGTAAAAGTGGAAGGTTGGAGG - Intergenic
1039613358 8:38936615-38936637 CTGTACAAATGGGACGGGGGTGG - Intronic
1039813258 8:41068893-41068915 CTGTAGGAGTCTGAGGTGGGAGG - Intergenic
1041286962 8:56272192-56272214 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1041901841 8:62991174-62991196 CTGGACAGGTGGGAGGTAGGAGG + Intronic
1042119752 8:65473907-65473929 ATGTAAAAGTGGAAGTTGAGGGG - Intergenic
1042976746 8:74478347-74478369 CAGGCAAAGTGGCAGGTGGGAGG + Intronic
1043496318 8:80804671-80804693 CTGTCAGAGTGGGAGGTGGGAGG + Intronic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044294695 8:90513871-90513893 CTGTCAGAGTGTGGGGTGGGAGG + Intergenic
1044597188 8:93970670-93970692 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1045211878 8:100107235-100107257 ATGGAGAGGTGGGAGGTGGGGGG + Intronic
1046017811 8:108627214-108627236 CTGGAAGTGTGGGAGGAGGGAGG - Intronic
1046190127 8:110784443-110784465 CAGGAAAGGTGGGAGGTTGGGGG - Intergenic
1046365728 8:113228645-113228667 CAGAATATGTGGGAGGTGGGAGG - Intronic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1046636836 8:116680059-116680081 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1047256182 8:123215125-123215147 CTGTGAAAGAGAGAGGAGGGGGG + Intergenic
1048189491 8:132275034-132275056 GTGAAAAAGTGGGAGGGGCGTGG + Intronic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048474259 8:134729265-134729287 CTGTAAAATTGGGAGATGGCTGG + Intergenic
1048627968 8:136207225-136207247 CTCTAAAAGTGAGAAGGGGGTGG - Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1049350543 8:142162143-142162165 CTGTCAAGGTGGGAGGAAGGGGG - Intergenic
1049952615 9:659936-659958 CTGCAAAAGCGGGCGGTGGCGGG - Intronic
1050194375 9:3065623-3065645 CAGAAAAAGTGGCAGGTAGGGGG - Intergenic
1050709919 9:8449919-8449941 CTGAAAACTTGGGAGGTGGGGGG - Intronic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1051357405 9:16252591-16252613 CTTAAAAAGTTGGTGGTGGGGGG + Intronic
1052064801 9:24005032-24005054 CTTTAAAAGGCTGAGGTGGGAGG + Intergenic
1052097241 9:24397835-24397857 CTGAAAAGGTTGGGGGTGGGAGG - Intergenic
1054950204 9:70841924-70841946 CTACAAAAGTGGGAGGGGTGAGG + Intronic
1055067963 9:72137773-72137795 TTGTAACAGTTGAAGGTGGGGGG - Intronic
1055437794 9:76309941-76309963 CTGTTAAAGGGAGAGTTGGGTGG + Intronic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1055503917 9:76929160-76929182 CTCTAGAAGGTGGAGGTGGGAGG + Intergenic
1055586087 9:77761099-77761121 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1056662187 9:88552192-88552214 CTGTAAAAGCGGAAGGGGAGTGG - Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057724465 9:97558386-97558408 CTGGAAAAGTTGGGGGTGGGGGG + Intronic
1057811761 9:98262796-98262818 CTTTAAGAGGCGGAGGTGGGCGG + Intergenic
1057917616 9:99069171-99069193 CTGTAAAAGTAGGAGCTGTGTGG - Intronic
1059236494 9:112764672-112764694 CTGTTGCAGTGGGAGGTTGGGGG + Intronic
1061256523 9:129456757-129456779 CTGTATGAGTGGGTGGTGAGTGG + Intergenic
1061600746 9:131668560-131668582 CTGTGAAAATGGGAGGGGAGGGG - Intronic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1062697951 9:137884963-137884985 CAGGCAAAGTGGGAGGAGGGGGG - Intronic
1203463781 Un_GL000220v1:67989-68011 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1203631007 Un_KI270750v1:72289-72311 CTGAAAAGGTGGGAGGTGTGTGG - Intergenic
1186870951 X:13771881-13771903 CTATAAAAGTAGGAGGTTAGAGG + Exonic
1186915257 X:14212292-14212314 CTATAAAAGTGGGAGGGGATGGG - Intergenic
1188006366 X:25018130-25018152 CTGCACAAGGGGGAGGAGGGGGG - Intergenic
1189195202 X:39146914-39146936 CTGGAACAGTGGGAGGTAGAAGG + Intergenic
1189479736 X:41383339-41383361 TTGTAAAAGTGGGGTGGGGGTGG + Intergenic
1189646402 X:43137513-43137535 CTGTTGAAGTTGGGGGTGGGGGG - Intergenic
1189968424 X:46395792-46395814 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1190262808 X:48808360-48808382 CTGTAAGGGTGGGAGGTGGCTGG - Intronic
1190286950 X:48967607-48967629 CTGTCTCTGTGGGAGGTGGGTGG - Intronic
1190427554 X:50346968-50346990 ATGAAATAGTGGGAGGTGGGTGG + Intronic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1192197321 X:69037133-69037155 CTGTAAAAGGCAGAGATGGGTGG - Intergenic
1192282484 X:69700791-69700813 GTTTTAAAGTGGGAGGTTGGAGG + Intronic
1192808332 X:74529099-74529121 CTATAAAATGGGGTGGTGGGAGG - Intronic
1193337855 X:80312278-80312300 CGGGAACAGTGGGAGGTGGAGGG + Intergenic
1195223597 X:102769406-102769428 CTGTAAAGGCGGGACGCGGGAGG + Intergenic
1195252253 X:103060524-103060546 CAGCAAAAGTGGGAGGAAGGAGG + Intergenic
1195300386 X:103524517-103524539 ATGTAAAGGTGGGACGTGGGAGG - Intergenic
1195316582 X:103685610-103685632 TTGAAAAAGTCGGGGGTGGGGGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195877862 X:109561254-109561276 CTGCAGAAGTGGGTGGTGGTGGG - Intergenic
1197766931 X:130065450-130065472 GTGTGAAAGTGGGAGATGAGGGG + Exonic
1198200034 X:134407153-134407175 CTGTAAAACAGGGTGGTGGTGGG + Intronic
1200216715 X:154371380-154371402 CTTTAAATGCGGGAGGAGGGCGG + Intronic
1200945556 Y:8832032-8832054 CTGTAAAGGTGGGTGGTGTCTGG - Intergenic
1201062816 Y:10063062-10063084 CTTTAAGAGGGTGAGGTGGGAGG + Intergenic
1201282277 Y:12352287-12352309 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic