ID: 912709847

View in Genome Browser
Species Human (GRCh38)
Location 1:111942495-111942517
Sequence GTCCCCACTGGCTGTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912709847_912709855 29 Left 912709847 1:111942495-111942517 CCAAGGGAACAGCCAGTGGGGAC 0: 1
1: 0
2: 2
3: 21
4: 226
Right 912709855 1:111942547-111942569 ACAGTTCCTACAGGTCTCTGAGG 0: 1
1: 0
2: 3
3: 16
4: 162
912709847_912709851 20 Left 912709847 1:111942495-111942517 CCAAGGGAACAGCCAGTGGGGAC 0: 1
1: 0
2: 2
3: 21
4: 226
Right 912709851 1:111942538-111942560 ACTGTCCCCACAGTTCCTACAGG 0: 1
1: 0
2: 0
3: 10
4: 126
912709847_912709849 -4 Left 912709847 1:111942495-111942517 CCAAGGGAACAGCCAGTGGGGAC 0: 1
1: 0
2: 2
3: 21
4: 226
Right 912709849 1:111942514-111942536 GGACAAAAGTCAAATGTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912709847 Original CRISPR GTCCCCACTGGCTGTTCCCT TGG (reversed) Intronic
901238519 1:7680109-7680131 CTCCCGACTAGCTGTTCCCGCGG - Intronic
902078268 1:13804222-13804244 GTCCCCACCGGCTGTACTCAAGG + Intronic
902251149 1:15154761-15154783 CACCCCACGGGCTGCTCCCTGGG - Intronic
904277672 1:29394877-29394899 GGCCCCACTGCCTTTTCGCTGGG - Intergenic
904697715 1:32339518-32339540 GTGCCAAGTAGCTGTTCCCTAGG - Intergenic
904884546 1:33726372-33726394 GACCTCACTGGCTCTGCCCTTGG - Intronic
906709764 1:47920498-47920520 AGCCCCACTGGCTCTGCCCTGGG + Intronic
908549700 1:65196324-65196346 ATCCCCACTTGGGGTTCCCTTGG - Intronic
909130336 1:71727872-71727894 CACCCCACTGGCTGTTCTCAAGG - Intronic
910119915 1:83776158-83776180 GTCCACACTGGCCGGTCCCATGG + Intergenic
910213218 1:84815217-84815239 TTCTCCACAGGCTGTGCCCTGGG + Intronic
910426062 1:87120890-87120912 GACACCACTGTCTGTTTCCTGGG - Intronic
912452298 1:109774486-109774508 GTCCCCACTGGAAGTCCCTTTGG - Intronic
912495410 1:110088536-110088558 GTCCCCACTGGCTTCTCCACTGG + Intergenic
912709847 1:111942495-111942517 GTCCCCACTGGCTGTTCCCTTGG - Intronic
913174745 1:116263374-116263396 CTCCCCACAGGCTGTTCCTGGGG + Intergenic
915357734 1:155266033-155266055 CTCCTCACTGGCTTTGCCCTAGG - Intronic
916957741 1:169857085-169857107 GTTCCCAGTGGATGTTACCTGGG - Intronic
918239629 1:182610211-182610233 ATCAGCACTGGCTGTTGCCTTGG - Intergenic
918697996 1:187568239-187568261 GTCACCACTGGCTGTCAGCTGGG - Intergenic
920260864 1:204686716-204686738 GTCACCACTGGCTGTACCCTTGG - Intergenic
921265444 1:213417531-213417553 GCCCCCACTGGCTTTCCCCCAGG - Intergenic
921419428 1:214929282-214929304 GTCCCTACTGGCAGTTGACTAGG - Intergenic
923304394 1:232674759-232674781 ATCCTTACTGGCTGTTCCCCTGG - Intergenic
1063104282 10:2979356-2979378 GTCCCCAATTCCTGTTCCCCTGG - Intergenic
1063461931 10:6220552-6220574 GTCCCGCCTTGCTGTTCTCTGGG + Intronic
1072699981 10:97633515-97633537 CTGCCCATTGGCTGTTACCTAGG + Intronic
1075007260 10:118839942-118839964 TACCCCACTGGGTTTTCCCTGGG - Intergenic
1075086081 10:119415336-119415358 CCCCACACTGGCTGTTTCCTGGG - Intronic
1075210385 10:120485920-120485942 GTCCCCACCGGCTGCTTACTAGG - Intronic
1075922929 10:126227958-126227980 GTCCCCACTGTCTCCTCCCTAGG - Intronic
1075974451 10:126683570-126683592 GTCCCCACTTACTGTCCCCATGG - Intergenic
1076331810 10:129675785-129675807 GTCACCACGGCCTGCTCCCTTGG - Intronic
1078662445 11:13298295-13298317 CTCCCTACTGCCTGCTCCCTTGG + Intronic
1080823342 11:35827242-35827264 GTACCCACTGGCTTCTCCCAGGG + Intergenic
1083307409 11:61768583-61768605 GGCCTCTCTGGCAGTTCCCTGGG + Intronic
1083320436 11:61842664-61842686 GCCCCCACTGGCTGTGTCCTTGG + Intronic
1084209807 11:67615685-67615707 ATACCCACTGTCTGTTCCCAGGG - Intergenic
1084989910 11:72913114-72913136 GTTCCCCCTTGCTGTTCTCTTGG - Intronic
1086110586 11:83194198-83194220 GTCTTCTCTGGCTGTTCCCCTGG - Intronic
1090234165 11:125134197-125134219 GTGACCACTGGCCTTTCCCTAGG + Intergenic
1090348720 11:126092415-126092437 GTCTGCACTGGTTGTTCCCAGGG + Intergenic
1091485331 12:881173-881195 GTTTCCACTGGCTGTTCTGTTGG + Intronic
1091626735 12:2126882-2126904 CTCCCCTCTGCCTGGTCCCTGGG + Intronic
1094399109 12:30041978-30042000 GTCCCCACAGGCTGTCATCTTGG - Intergenic
1094742429 12:33305034-33305056 GTTCCTACTGACTGTTGCCTTGG - Intergenic
1103926604 12:124426865-124426887 GTCCCCTCTGTGTCTTCCCTGGG - Intronic
1104758907 12:131285559-131285581 GGCCCCACATGCTGTCCCCTGGG + Intergenic
1104821703 12:131680937-131680959 GGCCCCACATGCTGTCCCCTGGG - Intergenic
1104960984 12:132488715-132488737 GGCACCACTGGCTGTTTGCTGGG - Intergenic
1105033305 12:132900247-132900269 GACCCCACAGGCTCTTCCCAGGG - Intronic
1105602183 13:21897321-21897343 GGCCTCTCTGGCTCTTCCCTTGG - Intergenic
1106420928 13:29585578-29585600 GTACTCACTGGGTGTTCCCGAGG - Intronic
1113038228 13:106074632-106074654 CTACCCACTGGCTGTACCCAGGG + Intergenic
1113766813 13:112887269-112887291 GCCCTCCCTGGCTGTTCCCTCGG + Intergenic
1117145616 14:52834117-52834139 GTACCCACTGACTGTGCCCAAGG - Intergenic
1118717349 14:68569798-68569820 CTTCCCACTGGCTGTTCAGTAGG + Intronic
1119258091 14:73217183-73217205 GTCTCCACTGGCTGTTGCTGAGG - Exonic
1122834690 14:104425030-104425052 TTCCCCACTGGCTCTGCCCTTGG + Intergenic
1125409992 15:39396096-39396118 TTCTCCACTTGCTGTTCCCACGG + Intergenic
1125506877 15:40272293-40272315 GTCCCCACCGGCTGGTCCGAGGG - Exonic
1127653638 15:61034566-61034588 CTCCCTACTGGCAGTTCCCCAGG - Intronic
1128695963 15:69763056-69763078 GTCCACACTGGCTGGTCCCTGGG - Intergenic
1128701166 15:69805409-69805431 GTCACCACTGACTGTTGCCCTGG + Intergenic
1128708527 15:69855085-69855107 GCCCCCACTGGCTCTGCCCTGGG + Intergenic
1128760707 15:70214430-70214452 GTCCCTACTGGCTGTCCCTTGGG - Intergenic
1129718210 15:77863971-77863993 CTCCCCACTGGCTGCGCCCCAGG - Intergenic
1130460720 15:84156894-84156916 CTCCCCACTGGCTGCTCCCCAGG + Intergenic
1131428738 15:92368879-92368901 CTTCACACTGGCTGTTACCTCGG + Intergenic
1132842725 16:1986141-1986163 GTCCCCACAGGCAGTGTCCTGGG - Exonic
1132904962 16:2277837-2277859 GCCCCCACTGGGTGGGCCCTGGG - Intronic
1132925024 16:2424787-2424809 GCCCCCACTGGGTGGGCCCTGGG + Intergenic
1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG + Intergenic
1134320407 16:13157730-13157752 GTCCTCCCTGCCTGTTCCCAAGG + Intronic
1136270329 16:29144769-29144791 GCCCCCACTGTCTGTGGCCTTGG + Intergenic
1136670156 16:31849437-31849459 ACACCCACTGGCTGCTCCCTAGG + Intergenic
1137556025 16:49470829-49470851 GCCCCCTCTGGCTGTCCACTGGG + Intergenic
1137846963 16:51699402-51699424 TTCCCAACTGGTTGTTTCCTTGG + Intergenic
1139592617 16:67941952-67941974 GGCCCCACCTGCTCTTCCCTAGG - Intronic
1142181395 16:88672620-88672642 CTCCCCGCTGCCTGTTCCCAGGG + Intergenic
1143345849 17:6248497-6248519 CTCCCCACTGGATGGTCCCCTGG - Intergenic
1143502906 17:7349248-7349270 TTCCCCACCACCTGTTCCCTAGG + Intronic
1143781332 17:9231127-9231149 GTACCCGCTGGCTCTCCCCTGGG + Intronic
1144879776 17:18425340-18425362 GTCACCTGTGGCTGGTCCCTGGG + Intergenic
1145152458 17:20519044-20519066 GTCACCTGTGGCTGGTCCCTGGG - Intergenic
1146480313 17:33199959-33199981 GTGCCCCCTTGCTGTTCCATGGG + Intronic
1147580797 17:41626061-41626083 GTCACCTGTGGCTGGTCCCTGGG - Intergenic
1147685795 17:42286333-42286355 GTGCCCAGTGGCTGTGCCCTTGG - Intergenic
1147796068 17:43043967-43043989 TTTCCCACTGGCTGTTGGCTGGG - Intergenic
1147862297 17:43530665-43530687 GTGCCCACTGCCTCTTCCCCAGG - Intronic
1147882478 17:43662984-43663006 TTCCCCACTGGTTATTCCCATGG + Intergenic
1148349239 17:46927993-46928015 GTCCCCTGTACCTGTTCCCTTGG + Intronic
1151142169 17:72004086-72004108 GTCCACTCTGCCTGTGCCCTTGG + Intergenic
1152557165 17:81059136-81059158 GCCCCCACAGGCTGCTGCCTTGG + Intronic
1152600568 17:81260177-81260199 GTGCCCACTGGGTGTCTCCTGGG - Intronic
1152901335 17:82942762-82942784 CTCCCCTCTGGCTGACCCCTGGG - Exonic
1154334066 18:13452142-13452164 GTCCCCAGTAGCTGTGCCTTTGG + Intronic
1155491376 18:26405040-26405062 CCCCTCACTGGCTGTTCCCTCGG - Intergenic
1157554099 18:48601557-48601579 CTCCCCACAGGCTGGTCCCCAGG - Intronic
1159823414 18:73175360-73175382 GTCATCACTGACAGTTCCCTTGG + Intronic
1160555987 18:79725673-79725695 GTCCTCACGGGAGGTTCCCTCGG + Intronic
1161003029 19:1920719-1920741 GCTCCCACTGGCCCTTCCCTGGG + Intronic
1161280175 19:3441663-3441685 GGCCCCTCTGGCCCTTCCCTTGG - Intronic
1161961243 19:7524516-7524538 GCTCCCACTGGCTTTTCACTGGG - Intronic
1161962291 19:7529474-7529496 GACCACACCGGCTGTGCCCTCGG + Intronic
1162349254 19:10138806-10138828 TTCCCCAGTGGCTGTCCCCTGGG - Intronic
1163126567 19:15247366-15247388 GTCCTCTCTGGCTGTTCCTGGGG + Intronic
1163359470 19:16836830-16836852 GAGCCCCCTGGCTGTTCTCTGGG + Intronic
1163472222 19:17504346-17504368 CTTCCCACAGGCTGTCCCCTGGG - Intronic
1164874558 19:31674516-31674538 GGCCCCAGTGGCTCTCCCCTTGG - Intergenic
1166229012 19:41414755-41414777 GACCCCACTCACTGCTCCCTGGG - Intronic
1166327583 19:42060704-42060726 CTTCACGCTGGCTGTTCCCTTGG + Intronic
1166386196 19:42382906-42382928 CTTTGCACTGGCTGTTCCCTTGG - Intergenic
1167344200 19:48935158-48935180 GTGCCCCCTGGCTGCCCCCTGGG + Intronic
1167493291 19:49803879-49803901 GTCCCCCCTGCCCGTTCTCTGGG + Intronic
1168097075 19:54122004-54122026 TTCCCCACTGGCCTTTCCCAGGG + Intronic
927092306 2:19721342-19721364 CTACACACTGGCTTTTCCCTGGG + Intergenic
928433194 2:31236891-31236913 GTCATCACTGGCTGTTAACTGGG + Intronic
932461543 2:71885107-71885129 GTCACCACTGAATGTTACCTAGG - Intergenic
932732742 2:74232430-74232452 CTCCCCATTGGGTGATCCCTAGG + Intronic
935200601 2:100853421-100853443 GTCCTAAGTGGCTGTTTCCTGGG + Intronic
935697942 2:105786341-105786363 CTGCCCACTGGCCGTTCCCAGGG - Intronic
936012281 2:108932636-108932658 GTCCCCACTGACAGGGCCCTTGG - Intronic
936075744 2:109400862-109400884 AGCCCCAATGGCTGTTCTCTGGG - Intronic
937328264 2:121005216-121005238 CTCTGCACTGGCTGTTCCCCAGG + Intergenic
938289876 2:130143495-130143517 GTGGCCCCTGCCTGTTCCCTAGG + Intronic
942917806 2:181333292-181333314 GTCTCGACTGGCTGCTCTCTAGG + Intergenic
944598089 2:201280742-201280764 ATACCAACTGGCTGTTCCATAGG - Intronic
944663682 2:201941477-201941499 GGCCACACTGTCTGCTCCCTGGG - Intergenic
944913251 2:204330862-204330884 TTCCCCACTTGCTATTGCCTGGG + Intergenic
947175288 2:227360441-227360463 GTCCCCACTGGCGGTACTGTTGG + Intergenic
948244130 2:236463974-236463996 CTTCTCACTGGCTGTTGCCTGGG + Intronic
1169314885 20:4582229-4582251 GTCTCCACCTCCTGTTCCCTGGG + Intergenic
1169400257 20:5273727-5273749 GTCTCCACTGGCAGCTTCCTGGG + Intergenic
1172971439 20:38875747-38875769 GTCCCCACTGTCTCTACCCCCGG - Intronic
1173564184 20:44027544-44027566 GTTCCCACTGGCTGCCCCCATGG - Intronic
1174147237 20:48460288-48460310 GTCCCCCATAGCTGTTCCCCAGG - Intergenic
1174488182 20:50874294-50874316 CTCAGCACAGGCTGTTCCCTCGG + Intronic
1174565716 20:51463188-51463210 CTCCACTCTGGCTGTTCCCTGGG + Intronic
1175551977 20:59823101-59823123 CTCCCCACTGCCTGCTCCCAGGG - Intronic
1177911125 21:27033681-27033703 GTCCTCACTGGCTGTTGGCTGGG - Intergenic
1178664376 21:34533869-34533891 CTCCACACCTGCTGTTCCCTGGG - Intronic
1180086141 21:45508812-45508834 GTCCCCACTGTCTGCTCCACAGG - Intronic
1180090243 21:45530606-45530628 GTCCCCACTTGCCTCTCCCTGGG - Intronic
1181195763 22:21184180-21184202 GTCCTCACTGGCGATTCCGTGGG - Intergenic
1181265571 22:21628944-21628966 CTCCGCACTGGCTGTTCACCTGG - Intronic
1182068982 22:27450174-27450196 GACCCCACTGGGATTTCCCTAGG + Intergenic
1183022719 22:35040123-35040145 GTTCCCATTGGCTGCTGCCTGGG - Intergenic
1183491784 22:38120699-38120721 GCCCACTGTGGCTGTTCCCTGGG - Intronic
1183772119 22:39935845-39935867 TTCCTCACTGCCTGTGCCCTGGG - Intronic
949503324 3:4703140-4703162 GGACTCACTGGCTCTTCCCTTGG - Intronic
950138809 3:10601326-10601348 GCAGCCACTGGCTGGTCCCTGGG + Intronic
950150719 3:10685141-10685163 GTCCCCACTGTTTAATCCCTGGG + Intronic
951531807 3:23705056-23705078 TTGCCCAGTGGCTGTTGCCTGGG + Intergenic
953770347 3:45774849-45774871 GCCCTCACTAGCTGTGCCCTTGG + Intronic
955741254 3:62093732-62093754 ATCCCCTCGGGCTGTTGCCTGGG + Intronic
956793011 3:72694456-72694478 GTCCCCACTTGCTCTCCCCTGGG - Intergenic
958905094 3:99933311-99933333 GTTGTCACTGGCTCTTCCCTAGG + Intronic
965626918 3:170690858-170690880 GACCCCAGATGCTGTTCCCTGGG + Intronic
966388718 3:179429115-179429137 GTCCCTAGTGGCTGTTACTTGGG + Intronic
967215712 3:187208431-187208453 TTCACCTCTGGCTGATCCCTAGG - Intergenic
968538267 4:1148796-1148818 GTCTCCACAGCCTGCTCCCTCGG + Intergenic
968804936 4:2766257-2766279 CTCTCCATGGGCTGTTCCCTCGG - Intergenic
969061609 4:4439782-4439804 TTCCCCACGGGCTCTTCCCAGGG + Intronic
972286937 4:37658050-37658072 TTCCTCCCTGGCTGTTCCTTAGG - Intronic
972561267 4:40231100-40231122 GTGCCCACTGGCTTGTCTCTGGG - Intronic
972639795 4:40915099-40915121 GTCCCCACTGGTTATTCCTTTGG + Intronic
976604270 4:86968077-86968099 CTCCCCACCTGCTCTTCCCTTGG - Intronic
978180508 4:105789513-105789535 ATCCTCACTGGCTGTTCACTGGG + Intronic
978423243 4:108556407-108556429 TGCCCCAATGGCTGTTCCATAGG + Intergenic
980963716 4:139500892-139500914 CTCCCCACTGGCCGGTCCCCTGG + Intronic
981978340 4:150759432-150759454 TTGTACACTGGCTGTTCCCTAGG + Intronic
982026697 4:151258814-151258836 TTCCCCACTGGCCTCTCCCTGGG + Intronic
982157512 4:152536252-152536274 ATCCCCACTTCCTCTTCCCTTGG - Intergenic
986667376 5:10115222-10115244 GTCCCTGCTGGCTGTTGGCTGGG - Intergenic
992486352 5:77200871-77200893 GCCCCCAGTGACTGTTGCCTTGG + Intergenic
994165711 5:96606203-96606225 GTCCACATTGGCTGATGCCTGGG - Intronic
996045947 5:118873641-118873663 ATCCCCACTGACGGCTCCCTTGG + Intronic
997355654 5:133261178-133261200 GGCCCCACTGCATGTTTCCTGGG + Intronic
997472530 5:134124800-134124822 GTCCACACCCACTGTTCCCTGGG - Intronic
997527439 5:134562393-134562415 TTCCCCACGGGCTATTCCTTGGG - Intronic
998411843 5:141917152-141917174 GTCCCAGCTGTCTCTTCCCTTGG + Intergenic
999269815 5:150290145-150290167 GCACCCACTGGCTGTTACCATGG - Intronic
1000832726 5:166123902-166123924 GTCCTCACTGGCTCTTGGCTGGG + Intergenic
1001279940 5:170379497-170379519 GTGCCCACTGACTCTTGCCTTGG + Intronic
1001743309 5:174071079-174071101 CTCCCCACTGGATGTGCTCTAGG - Intronic
1002008685 5:176258445-176258467 ATCCCCACCTGATGTTCCCTTGG - Intronic
1002087966 5:176787619-176787641 GTCCCACCTGACTGTACCCTGGG + Intergenic
1002218037 5:177653806-177653828 ATCCCCACCTGATGTTCCCTTGG + Intergenic
1002467543 5:179415163-179415185 CCCCACACTGGGTGTTCCCTTGG - Intergenic
1002670141 5:180860473-180860495 GTTCCCGCAGGCTGTCCCCTGGG + Intronic
1002699256 5:181111006-181111028 TTCCCCACAGGCTGTGACCTTGG + Intergenic
1003107282 6:3226614-3226636 GACCCCACTGGCAGTTACCATGG - Exonic
1003568279 6:7239047-7239069 GGCCCCTCTGGCTGGTCCCCAGG + Intronic
1004696631 6:18040177-18040199 GTCTCCACTTGCTTTTCCCTCGG - Intergenic
1006419178 6:33922903-33922925 TTCCCCAGTGGCTGTCCCCATGG - Intergenic
1006987677 6:38187391-38187413 GTCCCCACTGCCTGTGGCCAAGG - Intronic
1008408163 6:51142262-51142284 GTCCACACAGGCTTTACCCTGGG - Intergenic
1009272520 6:61631835-61631857 GTCTCCAGTGGCTTTTCCTTAGG + Intergenic
1010144071 6:72645654-72645676 GTCCTCACTGGCTTTGCGCTGGG + Intronic
1010250142 6:73698655-73698677 TTCCCCACTGGAAGTTCACTGGG + Intronic
1013308585 6:108872571-108872593 GGCTCCACTGGCTGTTCCTCTGG - Intronic
1013491169 6:110647117-110647139 GTTCCCTCTGGCTTTTCCTTTGG - Intronic
1014096741 6:117469551-117469573 GTCCCCACTTCCTCTTCCCCAGG + Intronic
1015634705 6:135263925-135263947 TTCAACACTTGCTGTTCCCTGGG + Intergenic
1016825132 6:148381563-148381585 GGCCCCCATGGCTGTTGCCTAGG + Intronic
1018141583 6:160842912-160842934 GTCACCATTGTCTTTTCCCTGGG + Intergenic
1018292131 6:162302535-162302557 TTCCTCACTGGCTCTTCCCCGGG - Intronic
1019433035 7:1008099-1008121 GTCTCCACTGGCAGGTGCCTCGG - Intronic
1019961575 7:4464891-4464913 GGCCAGACTGGCTTTTCCCTTGG - Intergenic
1021034670 7:15783952-15783974 GGCTCCACTGGTTGTTCCCCTGG + Intergenic
1023132387 7:37015638-37015660 GTCCCCTCTGCCTTCTCCCTTGG + Intronic
1023135018 7:37042727-37042749 CTTTACACTGGCTGTTCCCTTGG + Intronic
1023940447 7:44765785-44765807 GGCCCCACTGTCTGTTTCCTGGG - Intronic
1024198947 7:47087602-47087624 GCCTCATCTGGCTGTTCCCTGGG - Intergenic
1024875164 7:54013811-54013833 GTAACCACTGCCTGCTCCCTTGG - Intergenic
1026081768 7:67227857-67227879 GTCCCACGTGCCTGTTCCCTCGG + Intronic
1026695306 7:72586132-72586154 GTCCCACATGCCTGTTCCCTCGG - Intronic
1027231370 7:76274609-76274631 GTCCCTGCTGGCTGTTCTTTTGG - Intronic
1029113128 7:98223526-98223548 CTCCCCACTGCTTCTTCCCTTGG + Intronic
1029272144 7:99383728-99383750 TTCCGTGCTGGCTGTTCCCTAGG - Intronic
1030989606 7:116284191-116284213 GTCTTCACTTGCTGTTTCCTTGG - Intergenic
1034138754 7:148797005-148797027 GTGCCCTCAGGCTGGTCCCTTGG + Intronic
1034156834 7:148962720-148962742 GTTCACACTGGTTGTTTCCTGGG - Intergenic
1038789725 8:30657916-30657938 GCCCCGGCTTGCTGTTCCCTGGG - Intronic
1040017190 8:42709219-42709241 ATCCTCCCTGGCTGTGCCCTGGG + Intronic
1044747922 8:95389148-95389170 CTTCCCACAGGTTGTTCCCTGGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049497507 8:142943279-142943301 GTCCCCAGGGGCTGGGCCCTGGG - Intergenic
1049547476 8:143240091-143240113 GTGCCCACTGGCTGCACCCATGG - Intergenic
1050227672 9:3478977-3478999 GTCCCAACTTGCAGCTCCCTGGG - Intronic
1051544305 9:18256805-18256827 GTCAGCACTGCCTGTTCCTTGGG + Intergenic
1051566253 9:18502066-18502088 TTTCCCTCTGGCTGTTCTCTGGG - Intronic
1053108480 9:35435531-35435553 GTCCCCACTGCTTGTTACGTAGG - Intergenic
1057815690 9:98292427-98292449 ATCCCAACTGGGTGTGCCCTTGG + Intronic
1057949270 9:99356828-99356850 CTGGCCACTGGCTCTTCCCTTGG + Intergenic
1058908434 9:109499373-109499395 CTTGGCACTGGCTGTTCCCTCGG - Intergenic
1059299477 9:113300622-113300644 GGCCACACATGCTGTTCCCTGGG - Intronic
1062256437 9:135624670-135624692 TTCCCCACTGTGTGTTTCCTAGG - Exonic
1062543701 9:137052657-137052679 GTCCCCAGGGACTTTTCCCTGGG + Intronic
1186229309 X:7436459-7436481 CTCCCCAGTGGCTGTGCCTTAGG + Intergenic
1187106905 X:16252709-16252731 CTTTGCACTGGCTGTTCCCTCGG - Intergenic
1187344064 X:18447029-18447051 GTTCCCAGTGGCTGTCCACTTGG + Intronic
1187377154 X:18765319-18765341 GTCATCAATGGCTCTTCCCTCGG - Intronic
1191031877 X:55982420-55982442 GTCTCCACTGCCTCTTTCCTAGG + Intergenic
1191765930 X:64698420-64698442 GTCCTCACCAGCGGTTCCCTGGG + Intergenic
1191890212 X:65931961-65931983 GTCCTCTCTGGCTGCTCCCTCGG + Intergenic
1201447517 Y:14074477-14074499 GTCCCCACTGGATGTCCCTTAGG + Intergenic
1202378530 Y:24258286-24258308 CTCCCCACTGGCTGCTCCCCAGG - Intergenic
1202492252 Y:25411835-25411857 CTCCCCACTGGCTGCTCCCCAGG + Intergenic