ID: 912709847

View in Genome Browser
Species Human (GRCh38)
Location 1:111942495-111942517
Sequence GTCCCCACTGGCTGTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912709847_912709851 20 Left 912709847 1:111942495-111942517 CCAAGGGAACAGCCAGTGGGGAC 0: 1
1: 0
2: 2
3: 21
4: 226
Right 912709851 1:111942538-111942560 ACTGTCCCCACAGTTCCTACAGG 0: 1
1: 0
2: 0
3: 10
4: 126
912709847_912709855 29 Left 912709847 1:111942495-111942517 CCAAGGGAACAGCCAGTGGGGAC 0: 1
1: 0
2: 2
3: 21
4: 226
Right 912709855 1:111942547-111942569 ACAGTTCCTACAGGTCTCTGAGG 0: 1
1: 0
2: 3
3: 16
4: 162
912709847_912709849 -4 Left 912709847 1:111942495-111942517 CCAAGGGAACAGCCAGTGGGGAC 0: 1
1: 0
2: 2
3: 21
4: 226
Right 912709849 1:111942514-111942536 GGACAAAAGTCAAATGTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912709847 Original CRISPR GTCCCCACTGGCTGTTCCCT TGG (reversed) Intronic