ID: 912710769

View in Genome Browser
Species Human (GRCh38)
Location 1:111948349-111948371
Sequence TGTGAATCACAGGCTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710769_912710781 14 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710781 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 180
912710769_912710785 27 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710769_912710786 30 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG 0: 1
1: 0
2: 6
3: 75
4: 616
912710769_912710779 11 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710779 1:111948383-111948405 CAGCCTCCTGAGGTGGCGTAGGG No data
912710769_912710778 10 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710778 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG No data
912710769_912710776 4 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710776 1:111948376-111948398 AGAAAGCCAGCCTCCTGAGGTGG No data
912710769_912710783 17 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710783 1:111948389-111948411 CCTGAGGTGGCGTAGGGAGGCGG 0: 1
1: 0
2: 1
3: 32
4: 433
912710769_912710784 26 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710769_912710775 1 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710775 1:111948373-111948395 GGCAGAAAGCCAGCCTCCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710769 Original CRISPR TGTGAATCACAGGCTCTGTG GGG (reversed) Intronic
No off target data available for this crispr