ID: 912710770

View in Genome Browser
Species Human (GRCh38)
Location 1:111948350-111948372
Sequence CTGTGAATCACAGGCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710770_912710778 9 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710778 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG No data
912710770_912710779 10 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710779 1:111948383-111948405 CAGCCTCCTGAGGTGGCGTAGGG No data
912710770_912710785 26 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710770_912710786 29 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG 0: 1
1: 0
2: 6
3: 75
4: 616
912710770_912710781 13 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710781 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 180
912710770_912710775 0 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710775 1:111948373-111948395 GGCAGAAAGCCAGCCTCCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 332
912710770_912710784 25 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710770_912710783 16 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710783 1:111948389-111948411 CCTGAGGTGGCGTAGGGAGGCGG 0: 1
1: 0
2: 1
3: 32
4: 433
912710770_912710776 3 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710776 1:111948376-111948398 AGAAAGCCAGCCTCCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710770 Original CRISPR CTGTGAATCACAGGCTCTGT GGG (reversed) Intronic
900593884 1:3471738-3471760 CTGTGAATGCCAGGAGCTGTCGG - Intronic
900897575 1:5494354-5494376 CTCTGGATCACAGCCTCTCTTGG + Intergenic
901462875 1:9401988-9402010 CTGTGAATCAGAGGAACTGCCGG - Intergenic
902117283 1:14131993-14132015 ATCTCAATCTCAGGCTCTGTGGG - Intergenic
903007900 1:20310563-20310585 CTGTGTCTCACAGGTTCTGAAGG + Exonic
905906195 1:41619985-41620007 GGGTGACTCACAGGCTCTGCAGG + Intronic
906167721 1:43699556-43699578 CAGAGAAACACAGGCTCTTTGGG - Intronic
907197508 1:52698436-52698458 CTGGGAAGCACAGGCTCGCTTGG - Intergenic
907812888 1:57889811-57889833 TAGTGAATCACAGTCTATGTGGG + Intronic
908044419 1:60153176-60153198 ATGTGAAACACAGGCTTTATGGG - Intergenic
910988786 1:93033117-93033139 CTGTCAACCACAGGCCCTCTTGG + Intergenic
911185309 1:94897884-94897906 TTGTGAATGACAGGTTCTGTAGG + Exonic
912710770 1:111948350-111948372 CTGTGAATCACAGGCTCTGTGGG - Intronic
914453006 1:147810029-147810051 CTGTGGAGCACAGGCTCTGAAGG + Intergenic
918718945 1:187827813-187827835 CTGTGGAGCACATGTTCTGTAGG - Intergenic
921051428 1:211514622-211514644 CTGCGATTCACAGGCTCCGGTGG - Intergenic
921172480 1:212561573-212561595 CAGTGAGTCACAGGCACAGTTGG - Intergenic
921482941 1:215684407-215684429 CTGTCAATAAAAGGCTGTGTGGG + Intronic
922517407 1:226218415-226218437 CTGTCATTCACTGACTCTGTGGG - Intergenic
922545875 1:226456367-226456389 CTGGCAATTACAGGCTCTCTGGG + Intergenic
924466158 1:244300800-244300822 TTGTAAATCACAGGATCTTTAGG - Intergenic
1067686471 10:48468939-48468961 GTGGGAATGCCAGGCTCTGTTGG - Intronic
1070517198 10:77219137-77219159 CTGTGAAGCAAAAGCTCTGGAGG - Intronic
1070597505 10:77842949-77842971 CTGTGAATCACCAGTTCTCTGGG - Intronic
1070702831 10:78615958-78615980 CTATGGAGCAAAGGCTCTGTTGG + Intergenic
1075341417 10:121649389-121649411 CTGTGGATCCCCGGCACTGTAGG - Intergenic
1075479660 10:122769025-122769047 CTATGAATGACAAGCTCTGCAGG + Intergenic
1076241805 10:128914406-128914428 GTGAGTATCACAGGCTATGTGGG + Intergenic
1079638117 11:22770688-22770710 TTGAGAATCACAGGCTACGTTGG - Intronic
1080087358 11:28300401-28300423 CTTGGAATCACACGCTCAGTAGG + Intronic
1082889062 11:58119019-58119041 CCATGAATCCCAGGCTCTGCTGG - Exonic
1082909834 11:58358776-58358798 CTGAGCAGCACAGGCACTGTAGG + Exonic
1082989430 11:59194801-59194823 GTGTGATTAACAAGCTCTGTGGG + Intronic
1083149591 11:60783546-60783568 CTGGGAGTCACAGGATCTGGGGG + Intergenic
1085531738 11:77195744-77195766 TTGTGAATCACAGTTTTTGTAGG + Intronic
1086732821 11:90270912-90270934 CTGGGAAGCTCAAGCTCTGTGGG - Intergenic
1090986974 11:131776417-131776439 CTGAGAAGCACGGGCTCAGTAGG + Intronic
1096612435 12:52811661-52811683 CTTAGAATCTCAGGCTCTGAAGG - Intronic
1098308624 12:69125885-69125907 CTGTGAATCATATTCTGTGTGGG + Intergenic
1101541262 12:105667579-105667601 CTGTGGGTGAGAGGCTCTGTGGG - Intergenic
1101694232 12:107109433-107109455 TTCTGAATCACAGCCTGTGTGGG - Intergenic
1103951261 12:124552590-124552612 AGGGAAATCACAGGCTCTGTGGG + Intronic
1104071616 12:125350696-125350718 CTCTGTCTCACAGCCTCTGTGGG - Intronic
1104206450 12:126643230-126643252 CTGTGAAAAAAAGGGTCTGTGGG - Intergenic
1104236751 12:126945938-126945960 TTATGAATAACAGGCTATGTGGG + Intergenic
1104717369 12:131024994-131025016 CAGTGAATTACAGGCCCTGTGGG + Intronic
1104843230 12:131834487-131834509 GTGGGATCCACAGGCTCTGTAGG + Intronic
1105978033 13:25490522-25490544 GTGAGCATCACAGGCTGTGTGGG + Intronic
1108703380 13:52962841-52962863 CTGTGACTCTAAGGCTCTGTTGG - Intergenic
1108772955 13:53727768-53727790 CAGTGAATCAGAGACTCTGGAGG - Intergenic
1112520564 13:100091077-100091099 CTCTGCATCAGAGCCTCTGTAGG - Intronic
1114263940 14:21060131-21060153 CTCTGAATCATAGCCTGTGTAGG - Intronic
1114330597 14:21633263-21633285 CTCTGAAACACAGAATCTGTAGG - Intergenic
1115164424 14:30431563-30431585 CTGTGGATCAAAGGCACTGGTGG - Intergenic
1120489113 14:85154106-85154128 CTGTGAACGTCATGCTCTGTGGG - Intergenic
1121386135 14:93527584-93527606 CTTTGAATTACAGGCTGTTTGGG + Intronic
1121724105 14:96133599-96133621 CTGTGAAGAATAGGCTATGTGGG + Intergenic
1121876404 14:97457172-97457194 CTCTGAATCACAGCCTCCTTGGG + Intergenic
1122852284 14:104543067-104543089 CTGTGTCTCACAGTCGCTGTTGG - Intronic
1123992962 15:25696928-25696950 CAGAGCACCACAGGCTCTGTTGG - Intronic
1124019771 15:25909614-25909636 TACTGAATCCCAGGCTCTGTGGG + Intergenic
1124585728 15:31004681-31004703 CTCTGTATCACAGGCACTGTAGG + Intronic
1126330207 15:47523390-47523412 CTGTGAATCAAAGGCTGGGAAGG + Intronic
1127385087 15:58460587-58460609 CTGGGAAACCCAGGCTCTGATGG + Intronic
1131898449 15:97060801-97060823 CTCTTGATCACAGACTCTGTAGG + Intergenic
1138332176 16:56224028-56224050 CTGGGAATCTGAGGCTCAGTGGG + Intronic
1139019204 16:62726153-62726175 CTCTGATTCCCAGTCTCTGTAGG - Intergenic
1139474886 16:67198203-67198225 CTGTGGCTCTCAAGCTCTGTAGG - Exonic
1139962601 16:70726424-70726446 CTGGGAAGCACAAGCCCTGTGGG + Intronic
1140718959 16:77753132-77753154 TTGTTAAGCACAGGCTCTGCAGG - Intergenic
1140837770 16:78811290-78811312 CTGTGATTCATAGGCTCTCTGGG + Intronic
1141885706 16:86890838-86890860 CTGTGCATGGGAGGCTCTGTGGG - Intergenic
1143309400 17:5976029-5976051 CTGTGACTGAGAGGCTCTGCTGG - Intronic
1143338756 17:6193178-6193200 ATGTGAATCTCATTCTCTGTAGG - Intergenic
1144867883 17:18348478-18348500 CTGTGAAGCACAGACTTTCTGGG - Intronic
1146052348 17:29564016-29564038 CTGTGAATGACAGGCCTAGTGGG - Intronic
1146457229 17:33017440-33017462 CACTGAAGCCCAGGCTCTGTGGG - Intronic
1148161338 17:45451844-45451866 CTGTGAAGGCCAGGCTCTGAGGG - Intronic
1151003393 17:70404609-70404631 TTGTGAGTCACAGGCTCTTAAGG + Intergenic
1152469176 17:80481479-80481501 CTGTGACTCAGAGGCCCCGTGGG - Intergenic
1153807478 18:8721810-8721832 CTTCGTATCACAAGCTCTGTGGG + Intronic
1155176739 18:23307721-23307743 TTGTGAGTCACGGGCTCTGAGGG + Intronic
1155661054 18:28248762-28248784 CTGGGAAGCACAGTCTCTGAAGG + Intergenic
1156313424 18:35946240-35946262 GTGGGAAGCACAGGCTCTCTTGG - Intergenic
1156350981 18:36300581-36300603 TTGTCAATACCAGGCTCTGTGGG - Intronic
1156621031 18:38851993-38852015 CTGAGAAGCACATGCTCTGGTGG + Intergenic
1157846616 18:51009401-51009423 CTGTGAATTAAGGGCTCTGAGGG + Intronic
1158543448 18:58376837-58376859 CTGTGAATCACAGGCCCCACTGG + Intronic
1164823254 19:31266048-31266070 CTGTGAGTTACAGGTTCTGCAGG + Intergenic
1167357340 19:49012047-49012069 CTGTGGATCACAGCCTATGGGGG - Intronic
926127796 2:10282654-10282676 CTGTGCATCTCTGCCTCTGTTGG + Intergenic
927031780 2:19127795-19127817 CTGGGAAGCACAGGTCCTGTGGG - Intergenic
927960945 2:27240377-27240399 CTGTGACTCAGAGACTGTGTAGG + Intronic
929053627 2:37857826-37857848 TTGTGGATCACAGGCCCTGGGGG - Intergenic
929449735 2:42028726-42028748 CTTCCCATCACAGGCTCTGTTGG - Intergenic
930390496 2:50755507-50755529 TTGTGGATCACAGGCTCTTATGG - Intronic
930773370 2:55149784-55149806 CACTGAATCAGAAGCTCTGTGGG + Intergenic
931303572 2:61005409-61005431 CTTTGATTCACAGGCTCTGAGGG + Intronic
931652212 2:64478978-64479000 CTGTGAATCATAGGAACTCTAGG - Intergenic
934866661 2:97820122-97820144 CTGTGGACCTCAGGCTCTCTTGG + Intronic
934922577 2:98357891-98357913 CTGTTTATCACAGGCACTGCAGG - Intronic
936736001 2:115444471-115444493 CTGTCAATCACAGATTCTCTTGG + Intronic
937949561 2:127373246-127373268 CTTAAAATCACTGGCTCTGTTGG - Intronic
938970433 2:136426234-136426256 ATGTAAATCACTGTCTCTGTGGG + Intergenic
944388750 2:199194798-199194820 CTCTGCTTCACAGGCTCTGTGGG + Intergenic
944466875 2:200010792-200010814 CTGGGAATCACAGTCTCAGGTGG + Intergenic
945245211 2:207711564-207711586 CTGTGAAGCACAGCCACTGCCGG - Intronic
946530738 2:220567709-220567731 CTGTGATCCCCAGGTTCTGTAGG + Intergenic
947929193 2:233949173-233949195 CTGTGACTCTCACCCTCTGTGGG + Intronic
1169609942 20:7367349-7367371 ATGAGAGTCACATGCTCTGTTGG - Intergenic
1170180361 20:13523251-13523273 CTGTGTGTCACAGGCACTCTTGG - Intronic
1173946076 20:46952026-46952048 CTGTGAATCATAGTTTCTGGAGG + Intronic
1174896310 20:54453206-54453228 CTCTGCCTCCCAGGCTCTGTGGG + Intergenic
1176088576 20:63309063-63309085 CTGTGAGTCCCAGGCCCTGGAGG - Intronic
1176138849 20:63536439-63536461 GCGTGAGTCACAGGCTGTGTAGG - Intronic
1179573477 21:42292044-42292066 CTATGCATCACTGCCTCTGTGGG + Intronic
1182151476 22:28030049-28030071 CTGTGAAGCAGAGGCCCTGACGG + Intronic
1183071215 22:35397771-35397793 CTCTGTCTCCCAGGCTCTGTGGG - Intergenic
1183633686 22:39048184-39048206 CTCTGCATCACAGGCCCTGCAGG - Intronic
949694642 3:6680637-6680659 AAGTTAATCACAGGCTCTCTGGG - Intergenic
951583728 3:24193397-24193419 CTGTGGATCTCAAACTCTGTTGG - Intronic
953487528 3:43316380-43316402 ATGTGAATCACAATCTCTGGGGG - Intronic
956687470 3:71843539-71843561 CTGAGAAACTCAGCCTCTGTGGG + Intergenic
961626389 3:128266694-128266716 CTGTGACTCACAGTGTCTGGGGG - Intronic
962844467 3:139262593-139262615 CTGTGTATCACAGACTCTCAGGG - Intronic
963885755 3:150580325-150580347 CTGTGTATCACAGTCTCTATAGG - Intronic
964749667 3:160042699-160042721 CTGTGATCAACAGGCTTTGTGGG - Intergenic
965783267 3:172310456-172310478 CTGAGAAACACAGGCACTGCTGG - Intronic
967110666 3:186290709-186290731 CTGTGAATCCTAGCCACTGTGGG - Intronic
967400486 3:189055437-189055459 CTGTGAATCAGAGCCTGAGTGGG - Intronic
967584842 3:191200017-191200039 CTTTGAATAACAGACTCTATAGG + Intronic
968528040 4:1074459-1074481 CTGTGGATTAAAGGATCTGTGGG - Intronic
968709087 4:2099573-2099595 CTTTTAGTCACAGTCTCTGTAGG - Intronic
969321392 4:6415095-6415117 CTGTGAGGCAGCGGCTCTGTGGG - Intronic
969660183 4:8522898-8522920 CTGTGACTGACTTGCTCTGTCGG + Intergenic
974656019 4:64823711-64823733 CTGTGAATCACGCCCTTTGTAGG + Intergenic
974880209 4:67747062-67747084 CTTTAACTCACAGCCTCTGTTGG - Intronic
975971728 4:80047527-80047549 CTGTGATTCACAGCCTCACTAGG - Intronic
976131443 4:81888832-81888854 ATGGGAATCACAGGTTCTGACGG + Intronic
976911446 4:90312167-90312189 TTGTGAGTCAAAGGCTGTGTAGG + Intronic
978414293 4:108459207-108459229 CTGTGGACCAGAGCCTCTGTGGG + Intergenic
978580693 4:110228663-110228685 GTGTGAATCAGAGGCTCAGAGGG + Intergenic
980943094 4:139293747-139293769 CTGTGAAACACTGCCTCTGTTGG - Intronic
986057965 5:4157915-4157937 GTGTGCATCACTGGATCTGTAGG + Intergenic
986120258 5:4828720-4828742 TTGTGAATCACAAGATATGTTGG + Intergenic
987521174 5:18985543-18985565 CTCTGCATCCCAGTCTCTGTGGG + Intergenic
987685910 5:21200729-21200751 CTGTGAACTACAGGCTCTTTGGG + Intergenic
990268828 5:54112581-54112603 CCATGAATCACAAGCTCTATTGG + Intronic
990697369 5:58435594-58435616 TAGTGACTCACAGGCTCTGATGG - Intergenic
995245440 5:109930172-109930194 CTGTGACTCTCAGGCTCTACAGG - Intergenic
995963681 5:117877167-117877189 GTGTGATTCACAGGCTGTGTTGG + Intergenic
997416957 5:133736355-133736377 CTCTGAATCACAGGCTCTGAAGG + Intergenic
997778639 5:136634731-136634753 CTGTGAATCTGAAACTCTGTGGG + Intergenic
997831099 5:137150746-137150768 CTGTCACTGCCAGGCTCTGTAGG - Intronic
1001589526 5:172855840-172855862 CTCTGAAGCACAGGCTGAGTGGG - Intronic
1001952904 5:175828882-175828904 CCATGAATCACAGCCTCTCTAGG - Intronic
1002079336 5:176728194-176728216 CTGGAAAGCACAGGCTCTGAGGG - Intergenic
1002447552 5:179298594-179298616 CTGAGCATCCCAGGCTCTGCAGG - Intronic
1006370726 6:33642193-33642215 CAGTGGAGCCCAGGCTCTGTGGG + Intronic
1008345899 6:50426515-50426537 CTGTGAGTCAGATGCTCTCTGGG + Intergenic
1011042924 6:83050983-83051005 CTGTGATTCACATACTCTGCAGG - Intronic
1014388497 6:120831049-120831071 CAGTGAATCACAGCTTCTGACGG + Intergenic
1017776970 6:157688197-157688219 CTATGAATCAGAAACTCTGTGGG - Intergenic
1019158904 6:170056663-170056685 CTCAGAAACCCAGGCTCTGTTGG + Intergenic
1019384017 7:743462-743484 CTGTGATTCACAGGCTCGGGAGG - Intronic
1020556307 7:9674318-9674340 CCGTCTATCACAGGATCTGTGGG - Intergenic
1021048703 7:15955596-15955618 CTGTGAATCCCAAGATCAGTGGG + Intergenic
1022332896 7:29396987-29397009 CTGTGAATCCCCGGTTCTGGTGG - Intronic
1022472661 7:30691269-30691291 CAGTGAATCCCAGCCTCTGGAGG + Intronic
1024217440 7:47259268-47259290 CAGTGAATCTCAGGCTGTATGGG + Intergenic
1024465563 7:49708739-49708761 TTGTGAATCACATCCTCTGCTGG + Intergenic
1026497961 7:70919808-70919830 CTGTGAATCACCTGCTGTGATGG + Intergenic
1026518673 7:71095480-71095502 CTGTACATCAAAGGCTGTGTGGG - Intergenic
1028784929 7:94781688-94781710 CTCTGTATCTCAGTCTCTGTGGG + Intergenic
1029220452 7:98984540-98984562 CTGTGAATTACAGTCTCTTGTGG + Intronic
1030333393 7:108297117-108297139 CTGACAAACACAGGCTTTGTGGG - Intronic
1031591916 7:123603969-123603991 CACTGAACCACAGGCTCTGAAGG - Intronic
1033314168 7:140283857-140283879 CTGGGAAACACAGTCTCTATGGG - Intergenic
1036168729 8:6462648-6462670 CTGTTACTCACCTGCTCTGTGGG + Intronic
1036218147 8:6897713-6897735 CTGTGAATCATAGGACTTGTTGG + Intergenic
1037506200 8:19532073-19532095 CTGTAAATTCTAGGCTCTGTTGG + Intronic
1039561253 8:38514100-38514122 TTGTGAATGACCGGCCCTGTTGG - Intronic
1041376864 8:57214716-57214738 AGGTGAGTCACAGGCACTGTGGG + Intergenic
1043456506 8:80417441-80417463 CTGTTCATCCCAGGCTCTTTTGG + Intergenic
1045829782 8:106445064-106445086 CTGTAAATAAATGGCTCTGTTGG - Intronic
1046148254 8:110189740-110189762 CTCTCAATCACAGGCTGTGGTGG + Intergenic
1047276949 8:123413093-123413115 CTCTGACTCCCAGTCTCTGTGGG + Intronic
1047510920 8:125514716-125514738 CTCAGAATAACATGCTCTGTTGG + Intergenic
1047690523 8:127348917-127348939 CAGTGAATCAGAAACTCTGTGGG + Intergenic
1049608198 8:143539459-143539481 CAGTGAGTCCCAGGCTCTGGGGG - Intronic
1050564616 9:6869312-6869334 CTTTTAATCTCAGGTTCTGTAGG + Intronic
1050615588 9:7398615-7398637 CTGTGAATCACAGGTTACCTGGG + Intergenic
1053025385 9:34724757-34724779 ATCTGAATCAGAGGCTCTGCTGG + Exonic
1054161290 9:61673547-61673569 CTCTGTATCTCAGTCTCTGTGGG - Intergenic
1057638649 9:96796101-96796123 CTGTGCAACCCAGGCTCTGGGGG - Intergenic
1060403544 9:123361764-123361786 CTGGGAAACGGAGGCTCTGTAGG + Intronic
1060490177 9:124078297-124078319 CTGGGGCTCACAGGCTCTCTTGG - Intergenic
1060745144 9:126126265-126126287 GTGCGAGTCACAGGCTCTGAGGG + Intergenic
1061394939 9:130338592-130338614 CTGGGAATCAGAGGCACAGTGGG - Intronic
1187245400 X:17549244-17549266 CTGTGAATAACAGGCTTTTCTGG + Intronic
1189817668 X:44840224-44840246 CTGAGAATCACACACTCTGGTGG + Intergenic
1190178280 X:48169297-48169319 CTGTGAATCCCAGGTACTGCAGG + Intergenic
1190464264 X:50709883-50709905 AAATGAATCACAGACTCTGTGGG + Intronic
1191666258 X:63705861-63705883 CTGTGAATCACTGGCTTGGCGGG + Intronic
1193384764 X:80857078-80857100 CTGTGAAACCCAGGCCCTGATGG - Intergenic
1197966165 X:132064253-132064275 CTGTGAAGAACTGGATCTGTAGG - Intergenic
1200812249 Y:7498432-7498454 ATGTGAATGACAGGCACTGGGGG + Intergenic
1200938612 Y:8759996-8760018 ATGTGAATCACCTGCTCTGCTGG + Intergenic