ID: 912710771

View in Genome Browser
Species Human (GRCh38)
Location 1:111948351-111948373
Sequence CCTGTGAATCACAGGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 321}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710771_912710783 15 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710783 1:111948389-111948411 CCTGAGGTGGCGTAGGGAGGCGG 0: 1
1: 0
2: 1
3: 32
4: 433
912710771_912710778 8 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710778 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG No data
912710771_912710784 24 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710771_912710776 2 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710776 1:111948376-111948398 AGAAAGCCAGCCTCCTGAGGTGG No data
912710771_912710786 28 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG 0: 1
1: 0
2: 6
3: 75
4: 616
912710771_912710785 25 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710771_912710775 -1 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710775 1:111948373-111948395 GGCAGAAAGCCAGCCTCCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 332
912710771_912710779 9 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710779 1:111948383-111948405 CAGCCTCCTGAGGTGGCGTAGGG No data
912710771_912710781 12 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710781 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710771 Original CRISPR CCTGTGAATCACAGGCTCTG TGG (reversed) Intronic
900425365 1:2575929-2575951 CCTGATAGTCACAGGCTCTGAGG + Intergenic
902838840 1:19062892-19062914 TCTTTGCATCACTGGCTCTGGGG - Intergenic
903126578 1:21252367-21252389 CTTGTGACTCACACCCTCTGGGG + Intronic
903473344 1:23602750-23602772 CCTGTGAACGAGAGCCTCTGGGG - Intronic
903807274 1:26014330-26014352 CCTGTTACTCACTGGCTGTGTGG + Intergenic
905467525 1:38166638-38166660 CCTGTGACTCTCAGCCTTTGAGG - Intergenic
906032273 1:42731175-42731197 CGTCTGAGTCACAGGGTCTGGGG + Intergenic
906167722 1:43699557-43699579 CCAGAGAAACACAGGCTCTTTGG - Intronic
906544621 1:46612350-46612372 TCTGAGAATCACAGCATCTGTGG + Intronic
907812887 1:57889810-57889832 CTAGTGAATCACAGTCTATGTGG + Intronic
908865344 1:68542359-68542381 CCTGTGAATCAGAAACTCTAGGG + Intergenic
911294451 1:96097600-96097622 ACTCTGACTCACAGGCTCTAAGG + Intergenic
911958280 1:104265119-104265141 CCTTTGCATCAGATGCTCTGTGG - Intergenic
912491630 1:110065723-110065745 CCTGTTAAACACAGGCAATGGGG - Intronic
912710771 1:111948351-111948373 CCTGTGAATCACAGGCTCTGTGG - Intronic
913513214 1:119581205-119581227 CCAGTCCATCACAGGCTCTGGGG - Intergenic
916457480 1:164985922-164985944 ACTCTGAATCAAAGGCTCTGAGG - Intergenic
916789836 1:168115635-168115657 CCTGTGATTTGCAGGCTCTCAGG - Intronic
918627022 1:186667874-186667896 CCTGAGAATCACAGCTACTGAGG + Intergenic
919877018 1:201876838-201876860 CCTTTGAATATCAGACTCTGTGG - Exonic
921912150 1:220561165-220561187 CCAGTGAATTAGAGGCTTTGAGG + Intronic
922167447 1:223127959-223127981 CCGCTGAATCAGAAGCTCTGGGG + Intronic
923745945 1:236700407-236700429 CCAGTGAATTTCAGGCTCAGCGG + Intronic
924901172 1:248401844-248401866 CCTGTGAATCACTGGCAAAGTGG - Intergenic
1062993698 10:1845566-1845588 CCAAGGAGTCACAGGCTCTGAGG - Intergenic
1063017969 10:2096865-2096887 CCTGTGCAGCAGAGGCCCTGGGG - Intergenic
1063033908 10:2266535-2266557 CCTGGTGATCAGAGGCTCTGGGG - Intergenic
1064300203 10:14116570-14116592 CCTTACAATCACAGGGTCTGGGG + Intronic
1065204011 10:23341389-23341411 CCTGTTCATCACAGTCTCTCCGG + Intronic
1067155695 10:43779612-43779634 CCTGAGAATCACAGGGTCCACGG - Intergenic
1067284726 10:44899231-44899253 CCACTGAATCACAAACTCTGGGG - Intergenic
1067528068 10:47050265-47050287 CCTCTGAATCACTGGCTCTGGGG - Intergenic
1067696783 10:48541608-48541630 CCTGTGTAGAACAGGCTGTGGGG + Intronic
1067747347 10:48945866-48945888 TTTGTGGATCACTGGCTCTGGGG + Intronic
1068680265 10:59811636-59811658 CTTGGGATTCACAGGTTCTGAGG - Intronic
1069608676 10:69757697-69757719 CCTGTGGCTCAGAGGCTCAGAGG + Intergenic
1069720011 10:70543952-70543974 ACTTTGGAACACAGGCTCTGAGG - Intronic
1070597506 10:77842950-77842972 CCTGTGAATCACCAGTTCTCTGG - Intronic
1071056326 10:81513523-81513545 CCAATGAATCAGAGTCTCTGGGG - Intergenic
1072254990 10:93612949-93612971 CCTGTGAACCCCCTGCTCTGGGG - Exonic
1073466939 10:103699809-103699831 CCTGGAAAACACAGGCCCTGCGG - Intronic
1073496642 10:103897563-103897585 ACTGTGAATCACAGGCTGATTGG + Exonic
1074170044 10:110924183-110924205 CATGTGTGTCCCAGGCTCTGTGG + Intronic
1074673039 10:115817133-115817155 CCTGTGTTTCACTGGCTCTAGGG - Intronic
1074909508 10:117895031-117895053 CTTCTGAATCACATGCTCTGGGG + Intergenic
1075719706 10:124577496-124577518 CCAGGGAATCTGAGGCTCTGAGG + Intronic
1075979208 10:126722537-126722559 CCTTGGAATCACAGTCTCTGGGG - Intergenic
1076043325 10:127270029-127270051 CCTGTGTATGATTGGCTCTGAGG - Intronic
1076265974 10:129110286-129110308 CCTGTCAATCACAGTCTGTCTGG + Intergenic
1076717160 10:132372058-132372080 CCTGTGCTTTTCAGGCTCTGGGG - Intronic
1077898348 11:6470984-6471006 CCTGAAAACCACATGCTCTGAGG - Intronic
1081034168 11:38121037-38121059 CCTTTTAATCACAGGCTGTCTGG + Intergenic
1083149590 11:60783545-60783567 TCTGGGAGTCACAGGATCTGGGG + Intergenic
1083185763 11:61017072-61017094 TCACTGCATCACAGGCTCTGTGG - Intronic
1083745796 11:64735841-64735863 CCTGAGAATCCCAGGATGTGAGG - Intronic
1084199548 11:67546410-67546432 CTCCTGAATCACATGCTCTGAGG + Intergenic
1085341204 11:75732751-75732773 CCTGTCAACCAGAGGCACTGGGG - Intronic
1086732822 11:90270913-90270935 CCTGGGAAGCTCAAGCTCTGTGG - Intergenic
1089375912 11:117994509-117994531 CCTTTGTATCCCTGGCTCTGAGG - Intronic
1090539058 11:127680116-127680138 CCTCTGAATCATACGCTGTGTGG - Intergenic
1092112136 12:5971321-5971343 CCTGTGAATCTGAGGTGCTGTGG - Intronic
1092655350 12:10678101-10678123 CCTCATAATCACAGGTTCTGAGG + Intergenic
1095180377 12:39141365-39141387 CCTGCAAATCACAGACTCAGAGG + Intergenic
1095184149 12:39181367-39181389 CCTGTCAATCACTAGCTGTGTGG + Intergenic
1096217796 12:49808182-49808204 CCTGTGAATCCCAGGCCAGGAGG + Intronic
1096978609 12:55715837-55715859 CCTGTGGATCTCAGGCTTCGAGG - Intronic
1098342599 12:69468288-69468310 CTTATGAATCAGAAGCTCTGGGG - Intergenic
1099925025 12:89006856-89006878 CATGAGATTCTCAGGCTCTGAGG - Intergenic
1100187316 12:92151776-92151798 CCTGTGAATTAAAAACTCTGGGG + Intergenic
1101722003 12:107358556-107358578 CCAGTGAATCAGAAACTCTGGGG + Intronic
1102865830 12:116373292-116373314 CCGGTGTCTCAGAGGCTCTGAGG - Intergenic
1103951260 12:124552589-124552611 CAGGGAAATCACAGGCTCTGTGG + Intronic
1104071617 12:125350697-125350719 CCTCTGTCTCACAGCCTCTGTGG - Intronic
1104206451 12:126643231-126643253 CCTGTGAAAAAAAGGGTCTGTGG - Intergenic
1104717368 12:131024993-131025015 CCAGTGAATTACAGGCCCTGTGG + Intronic
1105516283 13:21093870-21093892 CCACTGAATCAGAGACTCTGGGG - Intergenic
1105574483 13:21637408-21637430 CCACTGACTCACAGCCTCTGGGG + Intergenic
1105604777 13:21917875-21917897 CCTGTGAAACAGAAGCCCTGCGG - Intergenic
1108839217 13:54592446-54592468 CCTGTGATCTACAGGCACTGGGG + Intergenic
1109503639 13:63270374-63270396 CCTTCCTATCACAGGCTCTGAGG - Intergenic
1111600535 13:90468409-90468431 CCTCTAAAACAAAGGCTCTGAGG - Intergenic
1114463248 14:22901802-22901824 CCTGAGACTCACATGGTCTGGGG + Exonic
1116864715 14:50022333-50022355 CCTGAGTATGAGAGGCTCTGTGG - Intergenic
1117108662 14:52426057-52426079 CCTTTACCTCACAGGCTCTGTGG + Intergenic
1118244636 14:64097700-64097722 CTTGTGAATCAGAATCTCTGCGG - Intronic
1119207280 14:72803915-72803937 CCTGTGTATGACAGGCTCAAGGG - Intronic
1119801205 14:77447147-77447169 CCTGTAAATCACAGCTTCTCAGG - Intronic
1120488652 14:85148226-85148248 CCTGAGAATCTCAGGCATTGAGG - Intergenic
1121876403 14:97457171-97457193 CCTCTGAATCACAGCCTCCTTGG + Intergenic
1124019770 15:25909613-25909635 CTACTGAATCCCAGGCTCTGTGG + Intergenic
1124119321 15:26875614-26875636 CGGGTGAATCCCAGGCTGTGTGG + Intronic
1124203394 15:27697624-27697646 CATGAAAAACACAGGCTCTGCGG + Intergenic
1124222234 15:27860980-27861002 TCTGTGGACCACAGGCTCTCAGG + Intronic
1124461580 15:29897118-29897140 CCTGCCCATCACAGGCTCAGAGG + Intronic
1124640901 15:31395971-31395993 CACGTGTATCACAGGCCCTGAGG - Intronic
1124686842 15:31790247-31790269 CCACTGAATCAGAGTCTCTGGGG - Intronic
1125452299 15:39821996-39822018 CTTTTGAATCACTTGCTCTGGGG + Intronic
1127170678 15:56297905-56297927 TATGTCTATCACAGGCTCTGGGG + Intronic
1128375625 15:67073043-67073065 GCTGTGAAACACAGGTTCTTTGG + Intronic
1130979935 15:88805254-88805276 CTTGTCAATCACAGGCTCCAGGG + Intronic
1131067241 15:89442320-89442342 CCTGGGTCTCACAGGGTCTGTGG + Intergenic
1131100592 15:89686357-89686379 TCCGTGAATTACAGGGTCTGAGG + Intronic
1131157836 15:90085653-90085675 CCTGTGGGCCACAGGCTGTGGGG - Intronic
1131507244 15:93029660-93029682 CCCGTTAACCACAGGCACTGTGG + Intergenic
1133775207 16:8890113-8890135 CCTGTCAATGACTGGATCTGGGG - Intergenic
1134759359 16:16700041-16700063 CCTGTGAGTCACTGCCTCAGCGG + Intergenic
1134986713 16:18659156-18659178 CCTGTGAGTCACTGCCTCAGCGG - Intergenic
1135304403 16:21356038-21356060 ACTGTGTCTCTCAGGCTCTGTGG - Intergenic
1136301145 16:29335168-29335190 ACTGTGTCTCTCAGGCTCTGTGG - Intergenic
1137377226 16:47962560-47962582 CCTCTGGATCAGAGACTCTGGGG - Intergenic
1138332175 16:56224027-56224049 CCTGGGAATCTGAGGCTCAGTGG + Intronic
1139286200 16:65816726-65816748 CCATTGAATCAGAGCCTCTGGGG - Intergenic
1139933648 16:70550832-70550854 CCTGTGCATCAGATGGTCTGAGG + Intronic
1139962600 16:70726423-70726445 CCTGGGAAGCACAAGCCCTGTGG + Intronic
1140837769 16:78811289-78811311 TCTGTGATTCATAGGCTCTCTGG + Intronic
1141633663 16:85302645-85302667 CTTTTGATTCAGAGGCTCTGGGG - Intergenic
1141700998 16:85641987-85642009 CCTGGCAGACACAGGCTCTGTGG + Intronic
1141775218 16:86118514-86118536 CCACTGAATCAGAAGCTCTGGGG - Intergenic
1141902012 16:86997117-86997139 CCTGTGGGTCACGCGCTCTGTGG + Intergenic
1141982986 16:87561262-87561284 CCTGTGAAAACCAGGCTCTGAGG - Intergenic
1142062845 16:88041904-88041926 ACTGTGTCTCTCAGGCTCTGTGG - Intronic
1143238796 17:5426242-5426264 CCTGAGAATCACAAGCGGTGTGG + Exonic
1143336516 17:6175570-6175592 CCTTTGAATCACTCCCTCTGGGG + Intergenic
1144638060 17:16923578-16923600 CCTGTGAGTCCCAGGCCCAGAGG - Intergenic
1144787375 17:17839628-17839650 CCTGGTAATCCCAGGCTGTGGGG - Intergenic
1144837094 17:18162251-18162273 CTTGTATCTCACAGGCTCTGTGG - Intronic
1146644071 17:34564774-34564796 CCCATAAATCAGAGGCTCTGGGG + Intergenic
1148161339 17:45451845-45451867 CCTGTGAAGGCCAGGCTCTGAGG - Intronic
1149315031 17:55431006-55431028 CCTGGGAGTCCCAGTCTCTGCGG + Intergenic
1149555427 17:57570245-57570267 CAAGTAAATCAGAGGCTCTGAGG + Intronic
1150392577 17:64798491-64798513 CCTGTGGAGGCCAGGCTCTGAGG - Intergenic
1152875924 17:82786167-82786189 CCTGTGAGCCACAGGTTCTACGG - Intronic
1152875927 17:82786175-82786197 CCTGTGGCTCACAGGATCTGAGG + Intronic
1153807477 18:8721809-8721831 CCTTCGTATCACAAGCTCTGTGG + Intronic
1153996916 18:10450898-10450920 CCTGAGCAACACAGCCTCTGAGG - Intergenic
1155168463 18:23249504-23249526 CCACTGAGTCACAGTCTCTGAGG - Intronic
1155176738 18:23307720-23307742 CTTGTGAGTCACGGGCTCTGAGG + Intronic
1156350982 18:36300582-36300604 CTTGTCAATACCAGGCTCTGTGG - Intronic
1157309596 18:46542344-46542366 CAATTGAATCAAAGGCTCTGGGG + Intronic
1157846615 18:51009400-51009422 GCTGTGAATTAAGGGCTCTGAGG + Intronic
1159977188 18:74728446-74728468 TGTTTGAAACACAGGCTCTGGGG + Intronic
1160035948 18:75302018-75302040 CCTGTTAATCTCAGGTTCTGTGG + Intergenic
1160371771 18:78378058-78378080 CCTGGGTCTAACAGGCTCTGGGG - Intergenic
1160969657 19:1761912-1761934 TCTGTGAATCTGTGGCTCTGAGG - Intronic
1163260512 19:16186889-16186911 CCTGTGTATCGCAGGGTGTGTGG - Intronic
1165388154 19:35523790-35523812 CTTGTGTATCCCAGGCTATGGGG - Intronic
1166446033 19:42857601-42857623 CCCGTGAGTCCCAGTCTCTGTGG + Intronic
1166449014 19:42881560-42881582 CCCGTGAGTCCCAGTCTCTGTGG + Intronic
1166455897 19:42939061-42939083 CCCGTGAGTCCCAGTCTCTGTGG + Intronic
1166492599 19:43271394-43271416 CCCGTGAGTCCCAGTCTCTGTGG + Intergenic
1167357341 19:49012048-49012070 CCTGTGGATCACAGCCTATGGGG - Intronic
1167649449 19:50721414-50721436 CCTGAGAGGCCCAGGCTCTGAGG + Intergenic
1168169539 19:54576417-54576439 CCTCAGAATCAGAGCCTCTGGGG + Intronic
1168172370 19:54597102-54597124 CCTCAGAATCAGAGCCTCTGGGG + Intronic
925503051 2:4528656-4528678 CCTGTGAATCACATGAGCTGGGG - Intergenic
925919045 2:8626653-8626675 GCTGTGAGCCACAGGCTGTGAGG - Intergenic
927031781 2:19127796-19127818 CCTGGGAAGCACAGGTCCTGTGG - Intergenic
927532935 2:23826132-23826154 CCAGTGAATCAGAATCTCTGGGG + Intronic
929053628 2:37857827-37857849 TTTGTGGATCACAGGCCCTGGGG - Intergenic
929427223 2:41855551-41855573 TATGGGAATCACAGCCTCTGGGG + Intergenic
929427990 2:41863491-41863513 CCTGGGAGTCAGAGGCTCTGAGG + Intergenic
930773369 2:55149783-55149805 CCACTGAATCAGAAGCTCTGTGG + Intergenic
931303571 2:61005408-61005430 ACTTTGATTCACAGGCTCTGAGG + Intronic
931351317 2:61491335-61491357 CCTGTTAATCATAGCCACTGAGG + Intronic
931881851 2:66577028-66577050 CCTGGGAATCCCAGGGTTTGGGG + Intergenic
932586790 2:73035461-73035483 CCAATGAATCACTGGTTCTGAGG - Intronic
933152060 2:78927509-78927531 CATGAGGTTCACAGGCTCTGAGG + Intergenic
933682134 2:85111489-85111511 CTTGTAGATCACTGGCTCTGGGG - Intergenic
933802709 2:85975905-85975927 CCACTGAATCAGAGTCTCTGGGG + Intergenic
934792421 2:97072756-97072778 CCTGTGTATTACAGGCACTTTGG - Intergenic
934814198 2:97310953-97310975 CCTGTGTATTACAGGCACTTTGG + Intergenic
934823496 2:97397530-97397552 CCTGTGTATTACAGGCACTTTGG - Intergenic
934946999 2:98549646-98549668 CCCATGGGTCACAGGCTCTGAGG - Intronic
935629045 2:105196860-105196882 CCTGTGAATCACAAACACTTTGG - Intergenic
935629129 2:105197429-105197451 CCTGTGAATCACAAACACTTTGG + Intergenic
935678598 2:105617293-105617315 TCTGTGAATCACTGCCTATGTGG + Intergenic
936278199 2:111118317-111118339 TCAGTGAATCAGACGCTCTGGGG + Intergenic
938970432 2:136426233-136426255 CATGTAAATCACTGTCTCTGTGG + Intergenic
940961549 2:159792275-159792297 CCTTTGAATCACTCACTCTGGGG - Intronic
942663908 2:178296162-178296184 CTTGTGAATCAAAACCTCTGAGG - Intronic
944388749 2:199194797-199194819 CCTCTGCTTCACAGGCTCTGTGG + Intergenic
946002013 2:216490269-216490291 CCTGTGAGTCACAGTCTTTTGGG + Intergenic
948586050 2:239020539-239020561 CCTGGGAAACTCAGGCTCCGAGG + Intergenic
948616217 2:239201014-239201036 CCGGGGAATCACAGGGCCTGGGG + Intronic
948656577 2:239480154-239480176 CCCGTGAAGCAGAGGCTCTGGGG + Intergenic
948920216 2:241062864-241062886 CCTCTGCAGCACAGGCTATGAGG + Exonic
1169025542 20:2367969-2367991 CCTCTAAATAACATGCTCTGAGG + Intergenic
1171131533 20:22658131-22658153 GATGACAATCACAGGCTCTGGGG + Intergenic
1171302383 20:24074954-24074976 CCTGTGGAGGACAGGCTCTGGGG + Intergenic
1172255281 20:33512224-33512246 CCTGTTAATCCCAGCCTCTCGGG + Intronic
1173028923 20:39336437-39336459 CCTCAGAACTACAGGCTCTGGGG - Intergenic
1174584355 20:51595939-51595961 CCTGTGAATCACAGGGTGTTCGG + Intergenic
1174896309 20:54453205-54453227 CCTCTGCCTCCCAGGCTCTGTGG + Intergenic
1175296366 20:57911594-57911616 ACGATGAATCCCAGGCTCTGTGG - Intergenic
1175979363 20:62729293-62729315 CCTGCTCAACACAGGCTCTGTGG + Intronic
1176177955 20:63737527-63737549 CCTGTGAAGCCGAGGCCCTGGGG - Exonic
1176236984 20:64057959-64057981 ACTGTTCCTCACAGGCTCTGGGG + Intronic
1177243492 21:18492177-18492199 CCTGTCAATCACAGTCACTCAGG - Intergenic
1177497670 21:21910504-21910526 TCTGGAAGTCACAGGCTCTGTGG - Intergenic
1178713086 21:34937372-34937394 CCAGTGACTCATAGGCTCTGGGG + Intronic
1179573476 21:42292043-42292065 CCTATGCATCACTGCCTCTGTGG + Intronic
1179618163 21:42595155-42595177 CCTGTGAGTCACTGGCACTTGGG - Intergenic
1179618169 21:42595163-42595185 CCAGTGACTCACAGGAGCTGGGG + Intergenic
1182414253 22:30210704-30210726 GCTGTGAGTCACAGCCGCTGAGG - Intergenic
1182642899 22:31782529-31782551 CTTGTGGAGCAAAGGCTCTGTGG + Intronic
1183071216 22:35397772-35397794 CCTCTGTCTCCCAGGCTCTGTGG - Intergenic
1183335105 22:37241874-37241896 CCTGTGGATCAGAATCTCTGGGG - Intronic
1183630259 22:39028313-39028335 CCTCTGCATCGCAGGCCCTGCGG - Intronic
1184274401 22:43401904-43401926 CCTGTGGGGCACAGGTTCTGGGG + Intergenic
1184647738 22:45905424-45905446 CCGAAGACTCACAGGCTCTGGGG + Intergenic
1185231921 22:49688427-49688449 ACTGTGGATGACAGGCTCCGAGG + Intergenic
949682261 3:6527793-6527815 CCTTTGATTCACAGGCTCAGGGG - Intergenic
949946472 3:9193646-9193668 CATGAGAAACAAAGGCTCTGGGG + Intronic
952310132 3:32181064-32181086 CCTGAGAATCAAAGGCCCCGGGG + Intergenic
952316454 3:32237121-32237143 CCTCTGAATCAGAAACTCTGAGG - Intergenic
952925489 3:38316623-38316645 CCTTCGAGTCACAGGCTCTCCGG - Intronic
953013929 3:39054331-39054353 CCTATGCATCACAGGTTCTTTGG + Intronic
953434893 3:42870634-42870656 CCTCTGACCCTCAGGCTCTGAGG + Intronic
953487529 3:43316381-43316403 AATGTGAATCACAATCTCTGGGG - Intronic
955487086 3:59446004-59446026 CCAGTGATTCACAGGCATTGAGG - Intergenic
956811528 3:72868137-72868159 CCTAGTATTCACAGGCTCTGGGG - Intergenic
959476421 3:106817838-106817860 CCTCTGAATGTCAGGGTCTGGGG + Intergenic
959669834 3:108963978-108964000 CCTGTGAATTACTGGTGCTGTGG - Intronic
960323819 3:116270208-116270230 CCTGTGACTAAAAGGGTCTGCGG - Intronic
961506195 3:127372013-127372035 CCTGGGCACCACAGCCTCTGAGG + Intergenic
961626390 3:128266695-128266717 ACTGTGACTCACAGTGTCTGGGG - Intronic
962844468 3:139262594-139262616 ACTGTGTATCACAGACTCTCAGG - Intronic
962902669 3:139774806-139774828 CTTGGGAATCACATGCTCAGTGG + Intergenic
963313386 3:143732724-143732746 CCTGGGAATCCAAGGCACTGTGG + Intronic
963897470 3:150702646-150702668 CCTGTGAATTACAGGATATTTGG - Intronic
965596408 3:170415539-170415561 TCTGTGGCTCACAGACTCTGAGG - Intergenic
967400487 3:189055438-189055460 CCTGTGAATCAGAGCCTGAGTGG - Intronic
967856730 3:194123401-194123423 CTTATGAATCACAGGTTCTAAGG - Intergenic
967905695 3:194497877-194497899 CCAGTGAATGACAGGCTTTGAGG - Exonic
967931981 3:194696531-194696553 CCTGGGAATCACAGCCACCGGGG - Intergenic
968461986 4:730771-730793 CCTCTGAAACGCAGGCTCTGAGG + Intronic
968528041 4:1074460-1074482 CCTGTGGATTAAAGGATCTGTGG - Intronic
968641048 4:1715137-1715159 CCTGTGACTCACAGGTACTTGGG - Intergenic
969575835 4:8035190-8035212 CCTGTGGATCACAGAATTTGAGG - Intronic
969689383 4:8695914-8695936 CCTGTGCATCTCAGGCTCTGTGG + Intergenic
969847757 4:9932960-9932982 CGTGGGAACCACAGCCTCTGAGG - Intronic
971432554 4:26583868-26583890 CTTGTGCATCAGAGGCGCTGTGG + Intronic
973684559 4:53356220-53356242 CTTTTGGATCACTGGCTCTGAGG - Intronic
975365665 4:73524668-73524690 CCTAGGAATCACAGTCTTTGTGG + Intergenic
975468364 4:74735247-74735269 TCTGTCTATCACAGCCTCTGTGG - Intergenic
977176120 4:93821918-93821940 CCCTTGAATCACTTGCTCTGGGG + Intergenic
977270918 4:94916847-94916869 CCTGGCCATCACAGGCTCAGAGG + Intronic
978580692 4:110228662-110228684 TGTGTGAATCAGAGGCTCAGAGG + Intergenic
978932510 4:114332307-114332329 CTTTTGAATCTCAGGCTCAGAGG + Intergenic
979184145 4:117767117-117767139 CCTGTCAATCACTGTCTCTGTGG + Intergenic
979734425 4:124064909-124064931 CCTCTGTCTCACAGTCTCTGGGG + Intergenic
980592716 4:134912241-134912263 CCTCTGTCTCACAGTCTCTGTGG + Intergenic
981110582 4:140929257-140929279 TCTGTGGATCAGAGACTCTGGGG - Intronic
982227978 4:153183103-153183125 TCAGTGGATCACAGGCTTTGAGG - Intronic
983592207 4:169426554-169426576 CCTGTGAATCAGAAACTTTGGGG + Intronic
983808962 4:172033509-172033531 CCTGGGAAGCAATGGCTCTGTGG - Intronic
985322775 4:188733442-188733464 CCTGGAAATCTCAGGCTCGGCGG + Intergenic
985548635 5:522296-522318 CCTGTGAATAACAAACTCTGAGG + Intronic
985664568 5:1175367-1175389 TCTATGAATCCCAGCCTCTGAGG - Intergenic
986029676 5:3882635-3882657 CCTGGAGATCACAGGGTCTGAGG - Intergenic
986239093 5:5940974-5940996 CTTTTGAATCCCAGGCTCAGAGG - Intergenic
987521173 5:18985542-18985564 CCTCTGCATCCCAGTCTCTGTGG + Intergenic
987685909 5:21200728-21200750 CCTGTGAACTACAGGCTCTTTGG + Intergenic
991035070 5:62120908-62120930 CCTCTGTATCACAGGCATTGAGG - Intergenic
991411744 5:66352636-66352658 CCTGTTTATGTCAGGCTCTGTGG - Intergenic
994017089 5:94979671-94979693 TCTGTCAACCACAGGCTTTGAGG + Intronic
994612281 5:102058673-102058695 CCTGTGAACCACATGTTCTGTGG + Intergenic
995888469 5:116922538-116922560 CCAGCCTATCACAGGCTCTGGGG - Intergenic
997455275 5:134012309-134012331 ACTGTGAACCACAGACTCAGTGG - Intergenic
997778638 5:136634730-136634752 CCTGTGAATCTGAAACTCTGTGG + Intergenic
998099682 5:139422077-139422099 CCATTGAATTAGAGGCTCTGGGG - Intronic
999439413 5:151590002-151590024 TCTGTGACTCACAGGCTGTGTGG - Intergenic
999961706 5:156763015-156763037 CCAGAGAAACACAGGCTCAGAGG + Intronic
1000957580 5:167560957-167560979 CCTGTGCATCACGGGCTGTTAGG - Intronic
1001589527 5:172855841-172855863 CCTCTGAAGCACAGGCTGAGTGG - Intronic
1001665481 5:173430226-173430248 CTTGAGAATTCCAGGCTCTGAGG + Intergenic
1002079337 5:176728195-176728217 CCTGGAAAGCACAGGCTCTGAGG - Intergenic
1005758653 6:28948082-28948104 CCAGTGACTCACAGGCTCAGAGG - Intergenic
1005954849 6:30656637-30656659 CCTCTGGATCTCAGGCACTGTGG + Exonic
1006370725 6:33642192-33642214 CCAGTGGAGCCCAGGCTCTGTGG + Intronic
1006394276 6:33776942-33776964 CCAGGGACTCACCGGCTCTGTGG + Exonic
1007610312 6:43144755-43144777 GCAGTGAATAACAGGCTCTGGGG - Intronic
1007718127 6:43869271-43869293 GGTGTGGCTCACAGGCTCTGTGG - Intergenic
1008500053 6:52171517-52171539 CATGTAAACCACAGCCTCTGGGG + Intergenic
1013268125 6:108520345-108520367 CCTGTGGGTGCCAGGCTCTGAGG + Intronic
1013352178 6:109315879-109315901 CCTGGGACTCACGCGCTCTGTGG + Intergenic
1014767342 6:125422041-125422063 CCGCTGAGTCACAGGCTCTATGG - Intergenic
1014989654 6:128057768-128057790 CTTGTGAATCACCGAATCTGAGG + Intronic
1017776971 6:157688198-157688220 CCTATGAATCAGAAACTCTGTGG - Intergenic
1018093994 6:160368653-160368675 CCTGGGAAGCACAGATTCTGTGG - Intronic
1019307557 7:343130-343152 CCTCTGGAGCTCAGGCTCTGGGG + Intergenic
1019692843 7:2426295-2426317 CGAGTGAATCTCAGGCTCAGAGG - Intronic
1019708872 7:2509425-2509447 CCTGGGAAGCACAGCCTCCGGGG - Intergenic
1019842001 7:3456366-3456388 CTTTTGTATTACAGGCTCTGAGG + Intronic
1019917221 7:4141331-4141353 CTTGTGGATCACAGGATTTGGGG - Intronic
1021599040 7:22345455-22345477 CCTGTGATTCACAGACGGTGAGG + Intronic
1023324945 7:39043987-39044009 CATGAGAATCACTGCCTCTGAGG - Intronic
1023987621 7:45106017-45106039 CCTGTGAGTCACTGTTTCTGTGG + Intronic
1024371193 7:48586142-48586164 GCTGTGAACCGCAGGCTCTTGGG + Intronic
1024608025 7:51038855-51038877 CCTCTGAATGACAGGCCTTGGGG - Intronic
1028784928 7:94781687-94781709 CCTCTGTATCTCAGTCTCTGTGG + Intergenic
1029436303 7:100565841-100565863 CCTGGAAAACCCAGGCTCTGGGG - Exonic
1029998159 7:105029995-105030017 CCACTGAATTACAGGCTTTGAGG + Intronic
1032904036 7:136343697-136343719 CTAGTAAATCAGAGGCTCTGGGG + Intergenic
1033314169 7:140283858-140283880 CCTGGGAAACACAGTCTCTATGG - Intergenic
1033447590 7:141436403-141436425 CCTGGGAAGCACAGACCCTGGGG + Intronic
1033648761 7:143323996-143324018 ACTGTGGATCACAGCCCCTGCGG + Intronic
1033729958 7:144168275-144168297 TCTGGGAATCACAGGCTGTATGG - Intergenic
1035824286 8:2628165-2628187 CCTGTCAACCAAATGCTCTGGGG + Intergenic
1037761763 8:21746217-21746239 TCTGTGCATCTCAGTCTCTGTGG + Intronic
1038650942 8:29402598-29402620 GCAGTGAATCACAGACTCTGGGG + Intergenic
1040468496 8:47716949-47716971 GCTTTGCATCACAGTCTCTGGGG - Intronic
1041650742 8:60299720-60299742 CCAGGGAATCAGAAGCTCTGGGG + Intergenic
1042563160 8:70088639-70088661 CCTGTGAGCCAAAGGCGCTGGGG + Intergenic
1043474211 8:80590521-80590543 CCTGGGAATCAGAAACTCTGGGG + Intergenic
1044836655 8:96302141-96302163 CCTGGGGATTACAGGCACTGGGG - Intronic
1045293196 8:100851359-100851381 CCTTGGAATCAGAAGCTCTGAGG + Intergenic
1045721859 8:105121762-105121784 CATGTGAATCAGATGATCTGTGG + Intronic
1047276948 8:123413092-123413114 CCTCTGACTCCCAGTCTCTGTGG + Intronic
1047690522 8:127348916-127348938 CCAGTGAATCAGAAACTCTGTGG + Intergenic
1048164710 8:132052186-132052208 CCTGAGAACTACAGGCTTTGAGG + Intronic
1049608199 8:143539460-143539482 TCAGTGAGTCCCAGGCTCTGGGG - Intronic
1051390698 9:16560121-16560143 CCAGTGAATCAGAAACTCTGGGG - Intronic
1051877606 9:21808084-21808106 CCAGTGAATCAGAAACTCTGGGG + Intronic
1052152950 9:25142166-25142188 ACTGTGAATGACAGGTTCAGGGG + Intergenic
1052989491 9:34510853-34510875 CTTATGCCTCACAGGCTCTGTGG + Intronic
1052996666 9:34554866-34554888 TCTGTGACTCACTGGCACTGGGG - Intronic
1054873819 9:70074648-70074670 TCAGTGAAACACAGCCTCTGGGG - Intronic
1056591507 9:87969073-87969095 CATGCCAATCACAGGTTCTGAGG + Intronic
1057299079 9:93865999-93866021 CCTGTGAGCAGCAGGCTCTGGGG + Intergenic
1057638650 9:96796102-96796124 ACTGTGCAACCCAGGCTCTGGGG - Intergenic
1058032082 9:100211048-100211070 CCAGTGAATGACAAACTCTGCGG + Intronic
1058906668 9:109487503-109487525 CAAGAGAATCACACGCTCTGGGG + Intronic
1059939706 9:119346745-119346767 CCATAGAATCACAAGCTCTGTGG - Intronic
1060745143 9:126126264-126126286 GGTGCGAGTCACAGGCTCTGAGG + Intergenic
1060898058 9:127231852-127231874 CTTGTGAATCAGAATCTCTGGGG - Intronic
1062024759 9:134335233-134335255 CCTCTGAGTCACAGGCTGTATGG + Intronic
1062182844 9:135200042-135200064 CCTCTCAAGCTCAGGCTCTGGGG + Intergenic
1062478620 9:136741522-136741544 CGTGTCAATCTGAGGCTCTGTGG + Intronic
1186427857 X:9478325-9478347 CCTGTGAACCTCAGGCTTGGAGG + Intronic
1188971443 X:36621236-36621258 CCTATGAATCAGTGACTCTGGGG - Intergenic
1189444406 X:41067260-41067282 CCTGTGGATCCCAGGCCCGGTGG - Intergenic
1189699020 X:43696938-43696960 CCTTTAAATCACAGCCGCTGTGG + Intronic
1190464263 X:50709882-50709904 CAAATGAATCACAGACTCTGTGG + Intronic
1191666257 X:63705860-63705882 TCTGTGAATCACTGGCTTGGCGG + Intronic
1193122330 X:77836642-77836664 CCTGTAAATCACAGCATTTGGGG + Intronic
1194168862 X:90557106-90557128 CCTTCCAAACACAGGCTCTGAGG + Intergenic
1196057981 X:111376668-111376690 CTTCTGAATCACAAACTCTGGGG - Intronic
1196939709 X:120763076-120763098 CTTGTGAATCAGAAACTCTGAGG - Intergenic
1197181289 X:123539468-123539490 CCTGTGCTACACAGGCTATGGGG + Intergenic
1198056079 X:132996191-132996213 CCTGTGAATAAAAGTCTTTGAGG - Intergenic
1198125403 X:133638673-133638695 CCTGTGAACCACATGCCTTGAGG - Intronic
1198789371 X:140326934-140326956 CCCGTGGATCACACACTCTGGGG + Intergenic
1200515106 Y:4134891-4134913 CCTTCCAAACACAGGCTCTGAGG + Intergenic
1200812248 Y:7498431-7498453 GATGTGAATGACAGGCACTGGGG + Intergenic
1201501227 Y:14645066-14645088 CCAGTGAATCACAAAATCTGAGG + Intronic