ID: 912710774

View in Genome Browser
Species Human (GRCh38)
Location 1:111948359-111948381
Sequence CTTTCTGCCCTGTGAATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710774_912710785 17 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710774_912710784 16 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710774_912710787 27 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710787 1:111948409-111948431 CGGCAGCCCTGGGAGGTGCCAGG 0: 1
1: 0
2: 5
3: 49
4: 446
912710774_912710783 7 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710783 1:111948389-111948411 CCTGAGGTGGCGTAGGGAGGCGG 0: 1
1: 0
2: 1
3: 32
4: 433
912710774_912710778 0 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710778 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG No data
912710774_912710781 4 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710781 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 180
912710774_912710775 -9 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710775 1:111948373-111948395 GGCAGAAAGCCAGCCTCCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 332
912710774_912710786 20 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG 0: 1
1: 0
2: 6
3: 75
4: 616
912710774_912710776 -6 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710776 1:111948376-111948398 AGAAAGCCAGCCTCCTGAGGTGG No data
912710774_912710788 28 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data
912710774_912710779 1 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710779 1:111948383-111948405 CAGCCTCCTGAGGTGGCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710774 Original CRISPR CTTTCTGCCCTGTGAATCAC AGG (reversed) Intronic
900095526 1:938566-938588 CTTGCTGCTCTGTGAGTCACTGG - Intronic
900807643 1:4778228-4778250 CTTTTTGCCCAGGGAATCTCAGG + Intronic
901037383 1:6344402-6344424 CCTTCTGCCCTATGAAGGACAGG - Intronic
905849964 1:41266488-41266510 CCTTCTCCTCTGAGAATCACAGG - Intergenic
909504120 1:76368586-76368608 CTTTCTGCCTGCTGAATCCCTGG + Intronic
910288575 1:85579617-85579639 CATTGTGCCCTATGAATCTCTGG - Intergenic
912710774 1:111948359-111948381 CTTTCTGCCCTGTGAATCACAGG - Intronic
915130735 1:153693746-153693768 CTTGCTACCCTGTGACTTACTGG + Exonic
915544252 1:156586972-156586994 CTTACTTCTCTGTGAAACACAGG + Intergenic
915615102 1:157031597-157031619 CTTTTTGCCCTGTGCATTAGTGG - Intronic
915900713 1:159844795-159844817 CTCTCTCCCCTGAGCATCACTGG - Intronic
917631918 1:176898727-176898749 CTTACTTCCTTGTGAATCAATGG + Intronic
917809255 1:178641815-178641837 CGTTCTGGCCCGTGAAACACAGG + Intergenic
918768146 1:188515673-188515695 CATTCTGACCTGGGAAACACTGG + Intergenic
919943859 1:202306229-202306251 CTTTGTGACCTTTGAATCCCAGG - Intronic
924387530 1:243513067-243513089 ATTCCTGCCCTGTCAATCTCAGG - Intronic
1066260062 10:33720881-33720903 CTCTCTGTTCTGTGAATAACAGG + Intergenic
1066615736 10:37292700-37292722 CGTTTTGTCCAGTGAATCACTGG - Intronic
1068441651 10:57063291-57063313 TTTTCTTCCCTGTGTATCTCTGG + Intergenic
1068567110 10:58588543-58588565 CTTTCTTCCCTCTCCATCACTGG - Intronic
1069669782 10:70192426-70192448 CTTTCTGCCTTGAGACTCCCAGG + Intergenic
1069817396 10:71207093-71207115 CTTTCTGCCACCTGAATCCCTGG + Intergenic
1071737454 10:88317958-88317980 CCCTCTGCCCTCTGGATCACGGG + Intronic
1071983144 10:91023852-91023874 ATTTCTGTCCTGTGACTCACAGG + Intergenic
1072498615 10:95989215-95989237 CTTACTACCCTGTGTGTCACTGG + Intronic
1074238753 10:111614158-111614180 CTTCTTGCCCTTTGAATCAGTGG - Intergenic
1074698799 10:116075096-116075118 CTTACTGCCCTCTGGACCACAGG + Intronic
1077100770 11:821379-821401 CTGCCTGCCCTATGAGTCACTGG - Intronic
1077430403 11:2513376-2513398 CTGTTTGCCCTGTGGATCAAAGG + Intronic
1082291812 11:50384546-50384568 CTTTTTGCCCTTTGAAGCATGGG + Intergenic
1086267247 11:85015573-85015595 CTTTTTGCCCTGTGAATTTAAGG - Intronic
1086743674 11:90399741-90399763 CTTGCTGCCCTTAGAATGACTGG - Intergenic
1087510883 11:99091451-99091473 CTTTCTACTCTGTGAATTTCTGG - Intronic
1089302981 11:117509717-117509739 CCTTCTGACCTGTGAGTCAGCGG + Intronic
1089618071 11:119706369-119706391 CTTTCTCCACTGGGAGTCACAGG - Intronic
1090190067 11:124761557-124761579 CTTCCTGCCCTGGGAATCAAGGG - Intronic
1091862178 12:3795694-3795716 CTTTCTGGCCTCTGAACCACTGG - Intronic
1091981671 12:4869193-4869215 CTTTCAGACCTCAGAATCACAGG + Intergenic
1096616523 12:52836172-52836194 CTGGCTGCCCTGTGACTCAGAGG - Intergenic
1097793485 12:63839650-63839672 CTTTCTGCATTTTAAATCACAGG + Intergenic
1098522934 12:71454037-71454059 TCTTCTCCCCTGTGGATCACTGG - Intronic
1103834538 12:123808352-123808374 CTGGCTGCCATGTGAATTACTGG + Intronic
1106251695 13:27986892-27986914 CTTTCTGACCCTTGACTCACAGG - Intronic
1106780613 13:33055790-33055812 CATTCTGACCAGTGAATCATTGG - Intronic
1113812018 13:113148719-113148741 CTTGCTGCCCAGGGAACCACTGG - Intronic
1114661176 14:24345957-24345979 ATTTCTGCTCTGTCAATTACTGG + Intergenic
1114927528 14:27422394-27422416 GTTTGTGCCCTGTGAAGCAGCGG + Intergenic
1115013346 14:28577782-28577804 ATTCTTCCCCTGTGAATCACAGG - Intergenic
1116804442 14:49478777-49478799 GTTTCTGCCCTGGTCATCACAGG + Intergenic
1119675751 14:76552221-76552243 CTTCCTGCCCTGGAAATTACCGG - Intergenic
1120249404 14:82044117-82044139 CTTTCTGACCTGTGAAACATGGG + Intergenic
1121474064 14:94178099-94178121 CTTTCTTCCCTGGGATTCAGGGG + Intronic
1124219913 15:27842417-27842439 CATTCTGCAATGTGTATCACAGG + Intronic
1124486241 15:30119708-30119730 CTTTCTGCGCTGTGAGCAACAGG - Intergenic
1124541315 15:30588693-30588715 CTTTCTGCGCTGTGAGCAACAGG - Intergenic
1124757343 15:32418894-32418916 CTTTCTGCGCTGTGAGCAACAGG + Intergenic
1125771644 15:42171485-42171507 CTTGCTGACCTCTGGATCACAGG + Intronic
1127111406 15:55675745-55675767 TTTCCTGCACTGTGAAACACTGG + Intronic
1127484180 15:59404218-59404240 TTTTTTGCCCTGAGAATCAATGG - Intronic
1128058379 15:64717845-64717867 CTTCCTGCCCTGTGAGCCAAGGG - Intergenic
1129263941 15:74383889-74383911 CTGTCAGCCCCGTGAGTCACCGG - Intergenic
1131316855 15:91346834-91346856 CTGTCTGCCCTGGGAATCACAGG - Intergenic
1131543072 15:93290717-93290739 TTTTCTCCCCTGCGAATGACTGG + Intergenic
1132302538 15:100784928-100784950 CTTTCTGCCCCTGGGATCACTGG - Intergenic
1132387115 15:101408474-101408496 CCTTCTGCCCTGTGTCTCCCTGG - Intronic
1133301149 16:4783686-4783708 CTGTCGGCCCTGGCAATCACGGG + Exonic
1133349547 16:5092417-5092439 GCTGCTGCCCTGTGAATCATAGG - Intronic
1133697682 16:8280445-8280467 CATTCTCCCCTGTGACTCAGGGG - Intergenic
1135386703 16:22047982-22048004 CTTTCTTCCCTGGCAGTCACAGG - Intronic
1135881696 16:26263753-26263775 CTCTCTGCCCTGGAAATCACTGG + Intergenic
1138312822 16:56042657-56042679 CTTTCTGCCCTCTGTTTCTCAGG - Intergenic
1140901856 16:79375232-79375254 GATCCTTCCCTGTGAATCACAGG - Intergenic
1142231516 16:88902286-88902308 TTGGCTGTCCTGTGAATCACCGG - Intronic
1142366057 16:89650358-89650380 CCTTCTGCCCTGTCCATCATGGG + Intronic
1143874571 17:9981936-9981958 CCTTCTGCTCTGTGAAACTCAGG - Intronic
1144337034 17:14280827-14280849 CATGCTCCCCTGAGAATCACTGG - Intergenic
1144682532 17:17205342-17205364 CCTGCTGCCCAGTGAATCTCAGG - Intronic
1145980320 17:29007249-29007271 CTTGCTGTCCTGTGACTCACTGG - Intronic
1147599301 17:41735852-41735874 CTTTCTGCCCTCTGAATCCTAGG - Intergenic
1152088408 17:78233881-78233903 CGTTCTGCCCTGGGAAACATAGG - Exonic
1153113303 18:1620383-1620405 CATTCTGTCTAGTGAATCACAGG + Intergenic
1158342688 18:56483913-56483935 TTTTCTGCCATATGAATCTCAGG + Intergenic
1159604932 18:70465511-70465533 GTTTGTGTCCTTTGAATCACTGG - Intergenic
1161275107 19:3411687-3411709 CTTTTTGACCTGTGAACCCCAGG + Intronic
1163229909 19:15994467-15994489 CTCTCTGCCATGTGAACCATGGG + Intergenic
1164013772 19:21234057-21234079 CTTTCTACCCTGTGAATTTGGGG + Intronic
1165077006 19:33285287-33285309 TTTTCTGCCCTCCGAGTCACGGG + Intergenic
1167292262 19:48630750-48630772 CTTCCTGCCCTGTGGCCCACGGG - Exonic
927280267 2:21298774-21298796 CTTATTGCCCTGTGCATCACTGG + Intergenic
928170884 2:29002432-29002454 CCTTCTGCCCTGGGAAGGACTGG - Intronic
929045640 2:37786275-37786297 CTTGATGCCCTGTGACTCCCAGG - Intergenic
929674161 2:43908255-43908277 CTTACTGCTCTTTGAATCAGTGG + Intronic
931800068 2:65749522-65749544 CTCTCTGCCCACTGAATCAATGG - Intergenic
931977319 2:67656903-67656925 CTTTCTTATCTGTAAATCACTGG - Intergenic
932071926 2:68629097-68629119 CTTTTTGCCCTTTGAAGCATGGG - Intronic
933987703 2:87606068-87606090 CTTTCAGCCCAGTGACTCACGGG - Intergenic
935483051 2:103617057-103617079 ATTTCAGCCCTGTGATTCCCTGG + Intergenic
935483054 2:103617065-103617087 TTCTCTGCCCAGGGAATCACAGG - Intergenic
935602436 2:104936757-104936779 CCTTCTGCCCTGTGAAAAAAAGG + Intergenic
935985887 2:108672740-108672762 GATTCTGCCCCGTGAAGCACAGG + Intronic
936138318 2:109916367-109916389 GATTCTGCCCCGTGAAGCACAGG + Intergenic
936206378 2:110455118-110455140 GATTCTGCCCCGTGAAGCACAGG - Intronic
936306137 2:111344740-111344762 CTTTCAGCCCAGTGACTCACGGG + Intergenic
937326371 2:120991784-120991806 CCTTCTGCCCGCTGAGTCACTGG + Exonic
937979806 2:127608346-127608368 CTTTTTGCCCTTTGAATAAAGGG + Intronic
938399427 2:130976562-130976584 GTCTCCTCCCTGTGAATCACTGG - Intronic
939624449 2:144459920-144459942 CTTTTGGCCCTGTGCATCATAGG + Intronic
939691388 2:145266254-145266276 GATTCTGCCCTGTGATCCACAGG + Intergenic
940026926 2:149218298-149218320 CATTCTGTCATGTCAATCACTGG + Intergenic
940664470 2:156590866-156590888 CTTGCTACCTTGTGAATCAAAGG - Intronic
941291775 2:163684658-163684680 CTTTCTCCTCTATGAACCACAGG + Intronic
944552762 2:200860376-200860398 CTATGTGCCCTGTGAATTTCTGG - Intronic
946221908 2:218234973-218234995 CTTTTTACCCTGTGATTCAGTGG + Intronic
948326833 2:237128489-237128511 CCTGCTGCCCTGTGACTCAGAGG - Intergenic
948694117 2:239724631-239724653 CTTGTTGCCCTGAGAATCCCGGG + Intergenic
949056980 2:241933004-241933026 CAGGCTGCCCTGTGACTCACAGG + Intergenic
1169964905 20:11205960-11205982 CTTCCTACCCTGTCAAGCACAGG - Intergenic
1170724300 20:18912626-18912648 TTTTCCACCATGTGAATCACTGG + Intergenic
1173105048 20:40125700-40125722 CCATCATCCCTGTGAATCACGGG + Intergenic
1175422771 20:58845744-58845766 TTCTCTGCCCTGTGAATTAATGG - Intronic
1175583746 20:60121095-60121117 CTTTCTGCTCTGTGATCCAACGG - Intergenic
1178376088 21:32068533-32068555 CTTGCTGCCCTGTAAATGATAGG + Intergenic
1178662991 21:34522509-34522531 CTTTTTGCCCTGGGAGGCACAGG - Intronic
1178721008 21:35008889-35008911 CTTTCTTCCCTTTGGATCAATGG - Intronic
1179147398 21:38780461-38780483 CTTTCTGCCCAGTAACTAACGGG - Intergenic
1179431359 21:41323344-41323366 CTTCCTCCCCTGGGAAGCACAGG + Intronic
1180049474 21:45324744-45324766 CCTTCTGCCCTGGGAATTTCTGG - Intergenic
1180743574 22:18071307-18071329 AGTTGTGCCCTGTGAATCCCAGG + Intergenic
1182599022 22:31445209-31445231 CTCCCTGCCCAGTGAAGCACAGG - Intronic
1183886960 22:40891918-40891940 GTTTCTGCTGTGGGAATCACTGG + Intronic
1184426278 22:44410968-44410990 CATTCTCCCCTGAGAAGCACAGG + Intergenic
1184953457 22:47862663-47862685 CTTTCTGCCCTGATACCCACAGG - Intergenic
949573996 3:5320988-5321010 CTTTCTGCCCAGTGAAATATGGG - Intergenic
950099384 3:10347715-10347737 ATTTCTGCCCTGTGGCTCCCAGG + Intronic
950454109 3:13082569-13082591 CTCTCTGCCTTGTCAGTCACTGG + Intergenic
954285512 3:49616349-49616371 CTTCCTGCCCTGGGACTCAAAGG + Intronic
954288600 3:49636969-49636991 CTTTCTGGGCTATGAGTCACTGG - Intronic
960385402 3:117016575-117016597 CTTTCTGCTCTGTGATTCTGCGG - Intronic
963122725 3:141789732-141789754 CTTTCTGACCCCTTAATCACGGG + Intronic
968728127 4:2257627-2257649 CTCTCTGCCCTGTGCATCCTGGG - Intronic
968948675 4:3679065-3679087 CTTTGTGGCCTCTGAATCCCAGG + Intergenic
968996651 4:3950070-3950092 GTTGCTGCCCTGTGAATCTTAGG - Intergenic
969800916 4:9564549-9564571 CTTTCTGCCCTGTGATGTAGAGG + Intergenic
976478606 4:85513033-85513055 TTTTCTGCCTTGTGAATCGTAGG + Intronic
978543766 4:109848278-109848300 ATTTCTGCCGTGATAATCACAGG - Exonic
979673266 4:123383703-123383725 TCTTCTGCCTTGTGCATCACAGG - Intergenic
982457350 4:155625805-155625827 CTATCTGGCCTGTGCATCCCAGG - Intergenic
986011182 5:3716876-3716898 ATTTCAGGGCTGTGAATCACAGG - Intergenic
986988667 5:13526885-13526907 CTGTCTGCCCTCTGACACACAGG - Intergenic
992779810 5:80117669-80117691 CTTTCTGTGTTGTAAATCACTGG - Intronic
993822665 5:92638905-92638927 CTTTTTGCCTTTTGTATCACAGG + Intergenic
994564567 5:101425687-101425709 CTTTCTGCCTTGTGGACCCCTGG + Intergenic
997614364 5:135236451-135236473 ATTTGTGCCCTGTGAATCTGGGG + Intronic
998227739 5:140339929-140339951 CTTTCTGCCCTGAGTAGCAAGGG + Intronic
999750992 5:154628048-154628070 CTTTCTGCACTGGGAAGCAGCGG + Intergenic
1001651964 5:173322255-173322277 CTTTCTGCCCTGTGTCTCTTAGG + Intronic
1005717946 6:28569435-28569457 CTTTCTGCCAAAGGAATCACTGG - Intergenic
1006162380 6:32046174-32046196 GTCTCTGCCCTGGGAATGACAGG - Intronic
1009942457 6:70304913-70304935 CCTTTTCCCCTGTGAATCTCTGG - Intergenic
1011717513 6:90122794-90122816 GTGTCTGCCCTGTGAAGCTCAGG - Intronic
1011931641 6:92722318-92722340 CTTGCTGTCAAGTGAATCACTGG + Intergenic
1015775648 6:136811570-136811592 CTTCCTGCCTTCTGATTCACTGG + Intergenic
1017242220 6:152183205-152183227 CTTGCTGCTCTGTGAATGAAAGG - Intronic
1018170257 6:161138805-161138827 CTTCCTGCCCTGTGAACAGCAGG - Intronic
1018404153 6:163459410-163459432 CTGACTGCCCTGTGCATTACAGG - Intronic
1018537634 6:164838359-164838381 CTGGCTGCCCTGTGAAATACAGG + Intergenic
1020960580 7:14797816-14797838 CTTCCTGCTCTGTGAAAAACAGG - Intronic
1021645173 7:22782566-22782588 CTATTTGCCCTATGAAGCACAGG + Intergenic
1022468802 7:30669147-30669169 TTTTCTGCCCTTTGAAGCACAGG - Intronic
1024062720 7:45710748-45710770 CTTTCTGCCCTGCCACTTACGGG - Intronic
1026140081 7:67698328-67698350 CTTTCTGCCCTGTCCTTCAAAGG + Intergenic
1026408999 7:70099475-70099497 CTTTAAGCCCTGTGACTCAGGGG + Intronic
1029100779 7:98128357-98128379 CTTTCTTCCGTGTGCATCCCTGG - Intronic
1030392798 7:108947922-108947944 CTTTCCCCTCTGTGAAGCACTGG + Intergenic
1030889887 7:114986466-114986488 CCTCCTTCCTTGTGAATCACTGG + Intronic
1032691636 7:134293657-134293679 CCTTCTGCCCTGTGAGTGCCCGG + Exonic
1034896973 7:154882344-154882366 CATTCTGCCCAGTGGATCCCGGG + Intronic
1037253966 8:16930409-16930431 GTTTTTCCCCTGTGAATAACTGG - Intergenic
1038079174 8:24113488-24113510 GTTTCTGCCCTGTGAACCTCTGG - Intergenic
1038782511 8:30580198-30580220 CTTTCTGCCCTCTGAAGAGCTGG - Intronic
1042236459 8:66617683-66617705 CTTTCTGCTTTGTGAATGGCTGG + Intergenic
1042501134 8:69510558-69510580 TTTTCTGCTTTGTGAATTACTGG - Intronic
1043142452 8:76606951-76606973 CTTTGTCTCCTGTGAATTACAGG - Intergenic
1048551014 8:135433647-135433669 CTGTCTGCCCTGAGAAGGACAGG + Intergenic
1048610941 8:136022471-136022493 CTTTCCGCGTTGAGAATCACTGG - Intergenic
1052954542 9:34243375-34243397 CTTTCTGACCTGTTCATCTCAGG + Intronic
1055742816 9:79408320-79408342 CTGTCAGCCATATGAATCACAGG - Intergenic
1057007024 9:91569247-91569269 CTCTCTGGCCTGAGAATCAAGGG - Intronic
1057160603 9:92885819-92885841 CTCTCTGCACAGTGAATCTCTGG + Intergenic
1058522013 9:105820927-105820949 CCTTCTGCCCTCTGGATCATGGG + Intergenic
1059644357 9:116249854-116249876 GTTGCTGGCCTGTGAATCAGAGG + Intronic
1061007377 9:127935780-127935802 CTTTCTGGTCTGTGTATCCCAGG - Exonic
1187803688 X:23094657-23094679 CTTGCTCCTCTGTGAATCAAGGG - Intergenic
1187866879 X:23731041-23731063 CTTACTGGCCTGTGTACCACTGG - Intronic
1188373915 X:29404223-29404245 CTTTCTGCCTTCCGAATCCCTGG + Intronic
1189076693 X:37923014-37923036 CTTTCTGCATTGTAAATCCCTGG - Intronic
1190099920 X:47514738-47514760 ATTTCTGGGCTGTGAATCACTGG + Intergenic
1193521346 X:82533175-82533197 CTTTCTAGCCTGTGACTCACAGG - Intergenic
1194589462 X:95780709-95780731 CTTTTCTCCCTGTGATTCACTGG - Intergenic
1195913673 X:109915034-109915056 CATTCTGCCCATTAAATCACAGG - Intergenic
1196686223 X:118512801-118512823 TTTTCTGCCTTGAGAAACACGGG - Intronic
1198062113 X:133056493-133056515 CTAGCAGCCCTGTGACTCACAGG + Intronic
1200282757 X:154792086-154792108 CTCTCTGCCCCATGAGTCACTGG - Intronic
1201554970 Y:15258031-15258053 CTTTCTGAACAGTGAATCTCAGG - Intergenic
1201680639 Y:16641058-16641080 CTTTCTGAACAGTGAATCCCAGG + Intergenic