ID: 912710777

View in Genome Browser
Species Human (GRCh38)
Location 1:111948382-111948404
Sequence CCTACGCCACCTCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710777_912710789 8 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710789 1:111948413-111948435 AGCCCTGGGAGGTGCCAGGGAGG 0: 1
1: 0
2: 4
3: 75
4: 661
912710777_912710792 16 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710792 1:111948421-111948443 GAGGTGCCAGGGAGGTGCTCAGG 0: 1
1: 0
2: 4
3: 37
4: 380
912710777_912710786 -3 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG 0: 1
1: 0
2: 6
3: 75
4: 616
912710777_912710784 -7 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710777_912710788 5 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data
912710777_912710785 -6 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710777_912710794 23 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710794 1:111948428-111948450 CAGGGAGGTGCTCAGGACTCTGG 0: 1
1: 0
2: 0
3: 43
4: 482
912710777_912710787 4 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710787 1:111948409-111948431 CGGCAGCCCTGGGAGGTGCCAGG 0: 1
1: 0
2: 5
3: 49
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710777 Original CRISPR CCTACGCCACCTCAGGAGGC TGG (reversed) Intronic
900500745 1:3003347-3003369 GCTACTGCACCTCAGCAGGCAGG - Intergenic
900795925 1:4708389-4708411 CCCACACCTCCTCTGGAGGCAGG - Intronic
902504660 1:16931326-16931348 CCTGCTCCTCCTCTGGAGGCAGG + Exonic
902515181 1:16986215-16986237 CCTGCACTACCTCAGGGGGCCGG + Exonic
903969954 1:27112237-27112259 CCCACGCCTCCTCATGGGGCTGG - Intronic
904534433 1:31189880-31189902 CCTTGGCCACCTCAGGTGGATGG + Intronic
906240636 1:44240090-44240112 CCTCAGCCACCACAGCAGGCTGG + Intronic
907232754 1:53015351-53015373 CCTAAACCACCTCAGAAGCCTGG - Intronic
911095030 1:94048017-94048039 TCTAAGCCAAATCAGGAGGCTGG - Intronic
912710777 1:111948382-111948404 CCTACGCCACCTCAGGAGGCTGG - Intronic
912816969 1:112837253-112837275 CCTCAGCCCCCTCAGTAGGCTGG + Intergenic
922717713 1:227885933-227885955 CCGAGGCCAGCTGAGGAGGCAGG + Intergenic
1070342216 10:75508182-75508204 CCTACCCCACTTCAGGGAGCTGG + Intronic
1070715864 10:78720391-78720413 CCTACGGCGCTTCAGGTGGCTGG + Intergenic
1073069883 10:100786742-100786764 CCTAGGCCACCCCTGGAGGCAGG - Intronic
1073075297 10:100821680-100821702 CCTACCTCACTTCAGGAGGAAGG - Intronic
1077514893 11:2995502-2995524 CCAAAGCCCCCTCAGTAGGCTGG + Intergenic
1077864325 11:6210552-6210574 CCTACGCCACCTCCCCAGGAAGG + Exonic
1079248392 11:18769918-18769940 CCCCCGCCACCCCAGGAGGCAGG - Intronic
1081705424 11:45180186-45180208 CCTGCGCCCTCACAGGAGGCAGG + Intronic
1083839694 11:65297188-65297210 CCGACTCTACCTTAGGAGGCCGG + Exonic
1084776751 11:71382009-71382031 CCTACCCAACCACAAGAGGCAGG - Intergenic
1084914633 11:72419357-72419379 CCTACACTGCCTCAAGAGGCAGG + Intronic
1085896385 11:80644541-80644563 CCTGCGCCACCTCAGGATGCTGG + Intergenic
1088322723 11:108570097-108570119 CCTGGGCCATTTCAGGAGGCAGG - Intronic
1088940754 11:114453458-114453480 CCAACCACTCCTCAGGAGGCTGG + Intergenic
1088972965 11:114789710-114789732 CCAAGGCCGCCTCAAGAGGCCGG - Intergenic
1089068853 11:115683076-115683098 CCTAGGTCCCCTCAGGAGCCAGG + Intergenic
1089294288 11:117458677-117458699 CCAGCCCCACCCCAGGAGGCAGG - Intronic
1089616229 11:119696425-119696447 CCAACCCCACCCCAGGGGGCGGG - Intronic
1091079706 11:132654870-132654892 CCCAGGCCACCTCAGAGGGCTGG + Intronic
1091162573 11:133438678-133438700 CCTAGGTCACTTCAGGAGGGGGG + Intronic
1092769319 12:11882530-11882552 CTTACGCCGCCTTATGAGGCAGG - Intronic
1093062113 12:14618015-14618037 CTTACGAAACCACAGGAGGCAGG - Intronic
1101984640 12:109436167-109436189 CATACGCCACCCCACAAGGCAGG - Intronic
1102349975 12:112184855-112184877 CCTCCGCCACCTCACCAGGAAGG - Exonic
1103594503 12:122015921-122015943 CCTCAGCCTCCTGAGGAGGCCGG - Intergenic
1104850098 12:131868640-131868662 CCGCCCCCACCTCAGAAGGCTGG + Intergenic
1106114133 13:26802286-26802308 CCAACGCCTCCTGGGGAGGCAGG + Intergenic
1111626561 13:90795291-90795313 CCTCAGCCTCCTAAGGAGGCTGG + Intergenic
1117434791 14:55705643-55705665 CTGACCCCACCTCAGGAGCCAGG - Intergenic
1120952665 14:90056954-90056976 CCAGCTCCACCTCAGTAGGCAGG - Intergenic
1121656633 14:95601757-95601779 CTTACCCCAACCCAGGAGGCCGG - Intergenic
1121767677 14:96502052-96502074 CCGCCGCGACCTCAGGCGGCGGG + Intronic
1125519527 15:40340210-40340232 CCTGAGCCCCCTGAGGAGGCAGG - Intronic
1126062662 15:44798916-44798938 CTTACCCCCCCTCAGGAGACAGG + Intergenic
1126084677 15:45000639-45000661 CCTATGCCACCGCAGGATGTGGG + Intergenic
1127655417 15:61051084-61051106 GCTATGGCACCTCAGGTGGCAGG + Intronic
1130141257 15:81228186-81228208 CCTATTCCACAGCAGGAGGCTGG + Intronic
1130348090 15:83067202-83067224 CCCAGGCCGCCTCCGGAGGCCGG + Exonic
1131403877 15:92147588-92147610 CCTGCTCCACTGCAGGAGGCAGG - Intronic
1132285283 15:100658060-100658082 GCTACGCCAGCTCAGGAGCCTGG - Intergenic
1132382219 15:101374196-101374218 CCTTCGCCTCCTCAGGAGAAGGG - Intronic
1133925692 16:10190282-10190304 CCTGCGCCTTCTCTGGAGGCTGG - Intergenic
1141541581 16:84726860-84726882 CCTATGCAACCACAGGACGCGGG + Intronic
1141894053 16:86947203-86947225 CCTTGGCCACCTCAGGATGAGGG + Intergenic
1143205330 17:5136770-5136792 CCTACAGCCCCACAGGAGGCAGG - Intronic
1143530007 17:7497245-7497267 CTCACACCACCCCAGGAGGCAGG - Intronic
1149597169 17:57871147-57871169 CCTGGGCCTCCTCAGCAGGCTGG - Intronic
1149884507 17:60327498-60327520 CCCACCCCACCTCAGGAGCCAGG + Intronic
1150388938 17:64780076-64780098 CCTGGGTCACCTTAGGAGGCAGG - Intergenic
1151708678 17:75786929-75786951 CCTAAGACACCTCAAGAGCCAGG - Intronic
1151807901 17:76418017-76418039 TCTTCACCACCTCAGGAGGAAGG + Intronic
1151928013 17:77213030-77213052 CCCACCCCACCTACGGAGGCAGG - Intronic
1153245330 18:3067501-3067523 ACCACGACACCTCCGGAGGCGGG + Exonic
1160287571 18:77559009-77559031 TCTGCGCCATCTCAGGAGACAGG + Intergenic
1161390080 19:4016161-4016183 CCTGCGCCACCTGGGGAGTCCGG + Intronic
1162115057 19:8424150-8424172 CCCAGGGCAGCTCAGGAGGCAGG - Intronic
1163764459 19:19154979-19155001 CCTACACCAACTCTGGAGGCAGG + Intronic
1165035760 19:33032402-33032424 CCTACACCACCTCTGGAGAAGGG - Intronic
1165811830 19:38616522-38616544 CCCACGCCAACCTAGGAGGCAGG + Intronic
925386077 2:3462780-3462802 CCCAAGCCACCTAAGGTGGCAGG - Intronic
926907275 2:17817127-17817149 TCTACTCCTGCTCAGGAGGCTGG - Intergenic
929460757 2:42101034-42101056 CGTGCGCCACCCCAGAAGGCAGG + Intergenic
929592456 2:43156053-43156075 CCTCTGCCAACTCAGCAGGCCGG + Intergenic
929731242 2:44495254-44495276 CCTACGCCTCCTGAGTAGCCTGG + Intronic
929813663 2:45213428-45213450 CCTCAGCCAGCCCAGGAGGCTGG + Intergenic
933606935 2:84393079-84393101 CCTTCTCCTCCTCAGGAGTCAGG - Intergenic
935051703 2:99530160-99530182 CCTTCGCCTCCCCAGGGGGCTGG + Intergenic
937952503 2:127399237-127399259 TCTACGCCACCTCAGTCTGCAGG - Intergenic
938949061 2:136240719-136240741 CCAAAGCCACCTCATGAGGTTGG + Intergenic
939642507 2:144657358-144657380 CCTCCCCCACCACAGAAGGCAGG + Intergenic
940321468 2:152381911-152381933 CCTCAGCCTCCTGAGGAGGCTGG + Intronic
940876239 2:158900477-158900499 CCTGGGCGACCTCAGGAGGTGGG - Intergenic
943655348 2:190502976-190502998 CTTACCCCACCCCAGGAGGCAGG + Intronic
948687372 2:239677608-239677630 CCTGCCCCACCTCAGGGAGCTGG + Intergenic
1175704872 20:61169177-61169199 CCTACCCCACCTCAGTATGGGGG - Intergenic
1175838810 20:62013963-62013985 CCTACCACAGCTCAGGAGTCGGG + Intronic
1176139521 20:63538862-63538884 TCTAAGCCACACCAGGAGGCAGG + Intergenic
1180011077 21:45051871-45051893 CCTCAGCAACCCCAGGAGGCTGG - Intergenic
1181146632 22:20853102-20853124 GCTACGACACCTCAGGATTCTGG + Intronic
1182972202 22:34589359-34589381 GCCTCGCCACCTCAGGGGGCCGG - Intergenic
1184071682 22:42150999-42151021 CCTCCTCCAACACAGGAGGCAGG - Intergenic
1184570314 22:45319444-45319466 CCTGCCCCACAGCAGGAGGCCGG + Intronic
1184769119 22:46587695-46587717 CCAACCCCAGCTCAGGAGGGAGG + Intronic
949459869 3:4279721-4279743 CATATGCCACCTCAGCAGGCTGG + Intronic
949897340 3:8778062-8778084 CCAACGCCACCCCAGGGTGCTGG + Intronic
950353568 3:12382130-12382152 CCAACACCACCTAAGGAGTCAGG - Intronic
953070390 3:39514384-39514406 CCTACCCCACCTCGGGACACAGG + Exonic
954744705 3:52780580-52780602 CCTTCCCCACCTCAGCATGCAGG - Intronic
963967406 3:151388013-151388035 CCTCTTCCTCCTCAGGAGGCAGG - Exonic
966590041 3:181672849-181672871 CCTCAGCCTCCTCAGGAGCCAGG + Intergenic
968119259 3:196113036-196113058 CCTAAGCCTCCTCAGGAGCTGGG + Intergenic
969865602 4:10075256-10075278 CCCACCCCACCACAAGAGGCAGG - Exonic
972740485 4:41882150-41882172 CCTCCCCCACCCCCGGAGGCGGG + Intergenic
982083517 4:151812818-151812840 CCCAGGCCACCTCATAAGGCTGG - Intergenic
983323691 4:166227090-166227112 GCCCCGCCAACTCAGGAGGCAGG - Intergenic
984808875 4:183776344-183776366 CCTGCGCCCCATCAGGAGGCAGG - Intergenic
985165583 4:187090928-187090950 CCCTCACCACCTCAGGATGCTGG - Intergenic
988705420 5:33721697-33721719 CCAACTCCAACTCAGGATGCAGG - Intronic
996101001 5:119445685-119445707 CCTGCGCCCCCGCAGGAGCCTGG + Intergenic
997215149 5:132103838-132103860 CCTACCCCACCCCTAGAGGCAGG - Intergenic
1000617000 5:163437970-163437992 CGAAAGGCACCTCAGGAGGCCGG - Intronic
1002322108 5:178382423-178382445 CCTCCTCCTCCTCTGGAGGCTGG + Intronic
1002434312 5:179221642-179221664 CCTGCGCCTCCTGAGGGGGCAGG + Intronic
1003225881 6:4205112-4205134 ATTACCCCACCTGAGGAGGCGGG - Intergenic
1004016752 6:11738403-11738425 CAGAGGCCACCTCAGCAGGCAGG + Intronic
1006077793 6:31545539-31545561 CCTGCTCCACCTCAGCAGACAGG + Exonic
1007501931 6:42305086-42305108 CCTACAGCACCTCAGCAGGATGG - Intronic
1008978590 6:57457373-57457395 CAGACTCCACCTCTGGAGGCAGG - Intronic
1012220045 6:96638296-96638318 TAGACGCCACCTCTGGAGGCAGG + Intergenic
1019278179 7:186982-187004 TCTGCCCCACCTCAGGAGGCTGG + Intergenic
1020448440 7:8295032-8295054 CCTCCGCCTCCTCAGTAGGTGGG + Intergenic
1022902522 7:34825039-34825061 AATCAGCCACCTCAGGAGGCAGG - Intronic
1031074360 7:117198725-117198747 CCTGTTCCACCTGAGGAGGCAGG - Intronic
1032189965 7:129759275-129759297 CTCACTCCACCTCAGCAGGCTGG + Intergenic
1032845537 7:135748715-135748737 CCTACTCTGCCTCAGAAGGCTGG + Exonic
1033107064 7:138536800-138536822 CAGACGCCACCTCTGGGGGCAGG - Intronic
1033267721 7:139900405-139900427 CCCATGCCACCTCAGGGAGCAGG + Intronic
1035477859 7:159156326-159156348 CCTACTCCTCCACAGCAGGCGGG - Intergenic
1036181415 8:6588542-6588564 CTTACGCCACTCCAGGAGCCCGG - Intronic
1037835224 8:22211590-22211612 AGTACACCTCCTCAGGAGGCTGG - Exonic
1037982144 8:23261815-23261837 TCTACGCCACCTCAGGCAGCAGG - Exonic
1038413695 8:27377622-27377644 CCAGGGCCACCTCCGGAGGCAGG + Intronic
1039496819 8:37986624-37986646 CCTCAGCCACCTCAGTAGCCGGG + Intergenic
1042580005 8:70266276-70266298 CCTTAGCCACCTGAGTAGGCGGG + Intronic
1042748387 8:72132630-72132652 CCTAGGCCAGCACAGGAGGGTGG + Intergenic
1045327649 8:101128452-101128474 CCTACGCCAACTCAGAATACTGG - Intergenic
1049400213 8:142423170-142423192 CGTACGCCTCCTGTGGAGGCTGG - Intergenic
1053070138 9:35096331-35096353 CCTTCGCCACGCAAGGAGGCTGG + Exonic
1056927063 9:90844116-90844138 CCTACGCCATCGCCGGTGGCAGG + Exonic
1061837649 9:133340203-133340225 CCTAGGCCACCCCAGAAGCCAGG + Exonic
1186122895 X:6382582-6382604 CCTAGGCCACCTCAGCAAGGCGG - Intergenic
1190778715 X:53576870-53576892 GCTAGCCTACCTCAGGAGGCTGG - Intronic
1190979543 X:55443751-55443773 CTGACTCCACCTCTGGAGGCAGG + Intergenic
1197728852 X:129793891-129793913 CCTGGGCCACCACGGGAGGCTGG - Exonic
1200080731 X:153575191-153575213 CCGAAGCCAGCACAGGAGGCTGG + Intronic
1200097388 X:153670549-153670571 CCTGCGCCACATCCGGAAGCTGG - Exonic