ID: 912710780

View in Genome Browser
Species Human (GRCh38)
Location 1:111948386-111948408
Sequence CCTCCCTACGCCACCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710780_912710785 -10 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710780_912710786 -7 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710786 1:111948402-111948424 AGGGAGGCGGCAGCCCTGGGAGG 0: 1
1: 0
2: 6
3: 75
4: 616
912710780_912710794 19 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710794 1:111948428-111948450 CAGGGAGGTGCTCAGGACTCTGG 0: 1
1: 0
2: 0
3: 43
4: 482
912710780_912710789 4 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710789 1:111948413-111948435 AGCCCTGGGAGGTGCCAGGGAGG 0: 1
1: 0
2: 4
3: 75
4: 661
912710780_912710792 12 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710792 1:111948421-111948443 GAGGTGCCAGGGAGGTGCTCAGG 0: 1
1: 0
2: 4
3: 37
4: 380
912710780_912710787 0 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710787 1:111948409-111948431 CGGCAGCCCTGGGAGGTGCCAGG 0: 1
1: 0
2: 5
3: 49
4: 446
912710780_912710788 1 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710780 Original CRISPR CCTCCCTACGCCACCTCAGG AGG (reversed) Intronic
No off target data available for this crispr