ID: 912710784

View in Genome Browser
Species Human (GRCh38)
Location 1:111948398-111948420
Sequence GCGTAGGGAGGCGGCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710771_912710784 24 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710777_912710784 -7 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710769_912710784 26 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710770_912710784 25 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data
912710774_912710784 16 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710784 Original CRISPR GCGTAGGGAGGCGGCAGCCC TGG Intronic
No off target data available for this crispr