ID: 912710785

View in Genome Browser
Species Human (GRCh38)
Location 1:111948399-111948421
Sequence CGTAGGGAGGCGGCAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710774_912710785 17 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710777_912710785 -6 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710780_912710785 -10 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710770_912710785 26 Left 912710770 1:111948350-111948372 CCCACAGAGCCTGTGATTCACAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710769_912710785 27 Left 912710769 1:111948349-111948371 CCCCACAGAGCCTGTGATTCACA No data
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data
912710771_912710785 25 Left 912710771 1:111948351-111948373 CCACAGAGCCTGTGATTCACAGG 0: 1
1: 0
2: 2
3: 32
4: 321
Right 912710785 1:111948399-111948421 CGTAGGGAGGCGGCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710785 Original CRISPR CGTAGGGAGGCGGCAGCCCT GGG Intronic
No off target data available for this crispr