ID: 912710788

View in Genome Browser
Species Human (GRCh38)
Location 1:111948410-111948432
Sequence GGCAGCCCTGGGAGGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912710780_912710788 1 Left 912710780 1:111948386-111948408 CCTCCTGAGGTGGCGTAGGGAGG No data
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data
912710774_912710788 28 Left 912710774 1:111948359-111948381 CCTGTGATTCACAGGGCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data
912710782_912710788 -2 Left 912710782 1:111948389-111948411 CCTGAGGTGGCGTAGGGAGGCGG No data
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data
912710777_912710788 5 Left 912710777 1:111948382-111948404 CCAGCCTCCTGAGGTGGCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 912710788 1:111948410-111948432 GGCAGCCCTGGGAGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912710788 Original CRISPR GGCAGCCCTGGGAGGTGCCA GGG Intronic
No off target data available for this crispr