ID: 912711477

View in Genome Browser
Species Human (GRCh38)
Location 1:111953085-111953107
Sequence CTTTGTGACATTTAGTAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912711477_912711480 -3 Left 912711477 1:111953085-111953107 CCGACCTACTAAATGTCACAAAG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 912711480 1:111953105-111953127 AAGCTGGCATAACTAGATGCTGG No data
912711477_912711481 25 Left 912711477 1:111953085-111953107 CCGACCTACTAAATGTCACAAAG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 912711481 1:111953133-111953155 ATTAATCTCAGTTTCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912711477 Original CRISPR CTTTGTGACATTTAGTAGGT CGG (reversed) Intronic
900729031 1:4239801-4239823 CTTTGTGAAAATTAATAAGTGGG - Intergenic
902421053 1:16280530-16280552 CACTGTGACAATTATTAGGTTGG - Intronic
907677589 1:56532917-56532939 CTCTGTGACCTTTGGAAGGTGGG + Intronic
909761041 1:79287629-79287651 CTTTAGGACATGTAGCAGGTAGG + Intergenic
910451677 1:87353009-87353031 CTTTGTGCCTTTTAGGAGGAAGG + Intergenic
911782805 1:101904366-101904388 ATTTGTAACATTTAGTAGGGTGG + Intronic
912521182 1:110245825-110245847 CTTTCTGACATTGAGAGGGTGGG + Intronic
912711477 1:111953085-111953107 CTTTGTGACATTTAGTAGGTCGG - Intronic
914890233 1:151615117-151615139 CTTTGTCACTTTTAGTGGGCAGG + Intronic
915280246 1:154817563-154817585 GTTTGTCACATTTAGTGTGTAGG - Intronic
916326855 1:163571277-163571299 CTTTAAAACATTTAGTAGCTTGG + Intergenic
917758261 1:178125657-178125679 CTTTCTCACACTTAGTAGCTGGG + Intronic
918917701 1:190666357-190666379 CTTTTTGACTTATAGTAAGTAGG + Intergenic
918974926 1:191471729-191471751 GTTTGTGACATTGGGTAAGTGGG - Intergenic
921713342 1:218394669-218394691 CTGTGTTACATGTAATAGGTGGG + Intronic
923693038 1:236215182-236215204 CTTTGTGACATTTTGTAAGTTGG - Intronic
1064536987 10:16367195-16367217 ATTGGTGACATTTCATAGGTAGG - Intergenic
1065432248 10:25671535-25671557 TTTTGTGAAATTAGGTAGGTAGG - Intergenic
1068236969 10:54249628-54249650 GTTTTTGACATTTAGGAGGTTGG + Intronic
1068255746 10:54508480-54508502 TGCTATGACATTTAGTAGGTTGG - Intronic
1068587376 10:58814378-58814400 CTGTCTGACACCTAGTAGGTAGG + Intronic
1069050224 10:63784816-63784838 CATTATAACATTTAGGAGGTGGG - Intergenic
1071899378 10:90102474-90102496 CTTTGTTAAATTTATTTGGTGGG - Intergenic
1074126984 10:110536349-110536371 CTTTGTGGCATTTACTAAATAGG - Intergenic
1076915077 10:133419389-133419411 CTTTGTGGCATTCAGGAGGAAGG + Intronic
1081147797 11:39584806-39584828 CTTTGTGTAATTGAGTATGTAGG - Intergenic
1082266085 11:50120135-50120157 CTTTCTGTCATGTAGTAAGTGGG - Intergenic
1082290004 11:50358437-50358459 CTTTCTGTCATGTAGTAAGTGGG + Intergenic
1085123415 11:73981812-73981834 ATTTGTGATATTAAGCAGGTGGG - Intronic
1091526860 12:1311127-1311149 TTTTGTAACTTTTAGTAGTTAGG + Intronic
1094093854 12:26681285-26681307 CTTTGTGTCACTTACTAGGTTGG - Intronic
1094593368 12:31841875-31841897 GTTTGTAAGATTTAGTAGGCCGG - Intergenic
1097145009 12:56934016-56934038 CTTGGTGACATCCAGTAGGGTGG + Exonic
1097479997 12:60111816-60111838 CTTTCTGACTTTTAGCAGATAGG + Intergenic
1098105578 12:67067386-67067408 CATTGTGACATTTAGTTGATAGG + Intergenic
1098415167 12:70225922-70225944 CTATGTGACACTTATTAGTTTGG - Intergenic
1099013410 12:77318780-77318802 CTAGGTGACATTTTGTAGCTTGG + Intergenic
1099916613 12:88902888-88902910 CTGTTTGACATTTATTGGGTTGG + Intergenic
1100025079 12:90118296-90118318 CTATGTTACCTTTAGTATGTTGG + Intergenic
1100069281 12:90691610-90691632 CTCTGTGACAGTTATTAGATTGG + Intergenic
1101428507 12:104607230-104607252 CTTGGTGACATTTGGAAGCTGGG + Intronic
1102732022 12:115119932-115119954 CTTACTGGCATTTAGTAAGTAGG + Intergenic
1103331145 12:120154913-120154935 CTTTGTGAGATGTGGCAGGTTGG - Intronic
1105473446 13:20711935-20711957 CTTGGGCACATTTAGTAAGTAGG - Intronic
1109045943 13:57410535-57410557 CTTTGTTACATTTATCTGGTAGG - Intergenic
1109064609 13:57671135-57671157 CTTTATAAAATATAGTAGGTAGG + Intronic
1109784736 13:67158782-67158804 CTTTATGAGATATAGTCGGTGGG + Intronic
1111254512 13:85648577-85648599 CTTTGTAAAATTGAATAGGTAGG - Intergenic
1111673441 13:91357629-91357651 CTTTCTGAGATTTAGAAGCTGGG - Intergenic
1115419818 14:33181577-33181599 CTTTGAAAAATTTAGTAGTTGGG + Intronic
1116309446 14:43304683-43304705 TTTTGTTACATTTATTATGTAGG + Intergenic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1131542063 15:93282950-93282972 CTGGGGGACATTGAGTAGGTGGG - Intergenic
1133319093 16:4902098-4902120 CTTGGTGACATTTTGTGGGCAGG - Intronic
1134383367 16:13748574-13748596 ACTTGTGAAATTTTGTAGGTTGG - Intergenic
1140590806 16:76350045-76350067 ATTGGTGATATTTAGTAGATGGG + Intronic
1141229742 16:82154235-82154257 CTCTGTGATATTTAGTAGAAAGG + Intronic
1143253680 17:5540484-5540506 CTTTGTGACATTTACAAGCTTGG - Intronic
1153490767 18:5645740-5645762 CTTTGTGAGATGTAGGCGGTGGG - Intergenic
1155254060 18:23979305-23979327 CTTTTTCCCATTTATTAGGTGGG - Intergenic
1155352082 18:24917114-24917136 CTTTGTGAGATTTCGTGGGGTGG + Intergenic
1159245609 18:65800607-65800629 TTTTGTGAAATTTAGTATGTAGG - Intronic
1167592514 19:50411891-50411913 CTTTGTGACACTGAGGAGGGAGG + Intronic
928669006 2:33580914-33580936 CTTTATTACATTTAGTGGGCAGG + Intergenic
930705183 2:54498092-54498114 CTTTGTTATATTTCTTAGGTTGG + Intronic
934612145 2:95748040-95748062 CTTTGTGACACTTAGGGGGGTGG - Intergenic
934792415 2:97072719-97072741 CTTATTGGCATTTAGTGGGTAGG + Intergenic
934814204 2:97310990-97311012 CTTATTGGCATTTAGTGGGTAGG - Intergenic
934823490 2:97397493-97397515 CTTATTGGCATTTAGTGGGTAGG + Intergenic
934842005 2:97631415-97631437 CTTTGTGACACTTAGAGGGGTGG + Intergenic
937871373 2:126788587-126788609 CAGTGCGACATTTAGTTGGTTGG - Intergenic
941496339 2:166209192-166209214 CTTTGTGACATTGTGTCGGATGG + Intronic
945491615 2:210462421-210462443 CTTTGTAAAATTTAGTACATGGG - Intronic
947366175 2:229396942-229396964 AATTGTGCCATTTTGTAGGTAGG + Intronic
1174169855 20:48609479-48609501 CTTTGTGACATTGAGTGGGAAGG + Intergenic
1178609868 21:34071655-34071677 ATTTGTGACATATGGGAGGTAGG - Intergenic
1179181229 21:39046892-39046914 CTCTGGGACATTCAGAAGGTGGG - Intergenic
1181889785 22:26052395-26052417 GTTTGTGTCATTTTATAGGTTGG + Intergenic
1183796153 22:40120001-40120023 CAATATGACATTTAGTAAGTGGG + Intronic
1183993115 22:41612110-41612132 CTTCATGACACTTACTAGGTGGG + Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
949561722 3:5208990-5209012 CTTGGTGAAATTCAGTAGGCCGG + Intronic
949729766 3:7095114-7095136 CTTTCTTACATTTACTAGGTTGG - Intronic
951414175 3:22402858-22402880 CCTTGTGAAATTTATTATGTTGG - Intergenic
953811080 3:46113403-46113425 CTTGGTTACATTTATTGGGTAGG + Intergenic
954614348 3:51961932-51961954 CCTAGTGACTTTTGGTAGGTGGG - Exonic
954840477 3:53507363-53507385 CTTTGGGACACTTAGCAGGGAGG + Intronic
956908092 3:73787988-73788010 GTTTCTGTCATGTAGTAGGTAGG - Intergenic
958056923 3:88425278-88425300 CTCTGTGACATTTAGTATTCTGG + Intergenic
958120626 3:89283329-89283351 CTTTCTGACATTTATCTGGTGGG + Intronic
959127053 3:102302492-102302514 CTTTGTGGCATTTGATAGGAAGG + Intronic
961852023 3:129830030-129830052 TTTTGTGGCATTTAGAAAGTAGG - Intronic
964152126 3:153538948-153538970 TTATGTGACATTTAGTAGCATGG + Intergenic
965456302 3:168904994-168905016 TTTTCTGGCATTTAGTATGTGGG + Intergenic
966252220 3:177878765-177878787 CATTCTGCCATTTATTAGGTGGG + Intergenic
969063517 4:4458965-4458987 CTGTGTGGCATTTAGTGGGATGG - Intronic
970863513 4:20732313-20732335 CTCTGTCACATCTAGAAGGTGGG - Intronic
971386433 4:26144598-26144620 CTTTCTGGAATTTAGAAGGTTGG - Intergenic
972336573 4:38112221-38112243 CTTTGTGAAAATTAGTTGCTTGG + Intronic
972731001 4:41795146-41795168 CTTTGTGACATCTGATGGGTGGG - Intergenic
974413902 4:61579356-61579378 TTTTTTGACATTTAGAAGATTGG + Intronic
977354648 4:95930221-95930243 CCTTGTGACATTGAGTTGGAGGG + Intergenic
981751589 4:148097530-148097552 CTATGTGACTTTTAGCAAGTAGG - Intronic
982286538 4:153741924-153741946 TTTTGTGAGATATAGTAGGTTGG - Intronic
983504268 4:168535642-168535664 GATTGTGGCATTTAGTAGGATGG + Intronic
986834075 5:11615128-11615150 TTTTGACACATTTATTAGGTTGG + Intronic
987211179 5:15685041-15685063 GCTTGTGACATTTAGTAAGTCGG + Intronic
989215983 5:38905086-38905108 CTTTATGACATTGAGTTGGAGGG - Intronic
989993159 5:50793167-50793189 CTCTGTGACATATTGTAAGTGGG + Intronic
993510907 5:88770613-88770635 CATTGTGACATTTGCTAGGAAGG - Intronic
994104423 5:95930455-95930477 CTTGGTGACATTGATTAGGTTGG - Intronic
996344040 5:122470733-122470755 CTTTGTTTTATTTATTAGGTTGG + Intergenic
998952001 5:147401857-147401879 CTTGGTCACATTTAGCAGATAGG - Intronic
1000795941 5:165664566-165664588 CTTTCTCACCTCTAGTAGGTTGG + Intergenic
1001171618 5:169424803-169424825 CTTATTGACATTTACTAGCTTGG - Intergenic
1003259124 6:4500690-4500712 CTGTGTGACTTTTATTATGTGGG - Intergenic
1005849366 6:29808984-29809006 TTTTGTGACATTGAGTAGTTAGG + Intergenic
1011108457 6:83809808-83809830 GTTTGTCACACTTAGTAGGTAGG + Intergenic
1011454645 6:87535026-87535048 CTTTGCATGATTTAGTAGGTGGG + Intronic
1012318585 6:97813808-97813830 CTGTGTGCCTTTTAGGAGGTTGG + Intergenic
1015992587 6:138962198-138962220 CTTTGTGTCCTTTAGCAAGTAGG + Intronic
1017285015 6:152664270-152664292 TTTTGTGATATTTAGAGGGTGGG - Intergenic
1023554589 7:41408042-41408064 CTATGAAACATTTAGTAGGAAGG - Intergenic
1024136989 7:46419328-46419350 CTTTGCTAGATTTAGGAGGTGGG + Intergenic
1025876812 7:65488673-65488695 CTTTTTTTTATTTAGTAGGTGGG - Intergenic
1027755566 7:82207105-82207127 CCTGGTGGCATTTAGTGGGTGGG - Intronic
1029219864 7:98979911-98979933 CTTGGTTTCATTTAGTAAGTGGG + Intronic
1030119499 7:106094224-106094246 CTTTTAGTCATTTATTAGGTTGG + Intronic
1030327614 7:108237372-108237394 TTTTGTGTCTTTTAGAAGGTGGG - Intronic
1037310573 8:17551353-17551375 CTTTGGGACATTGAGGAGGGTGG + Intronic
1040344305 8:46472900-46472922 CTTTCTGACATTCATCAGGTTGG - Intergenic
1040344872 8:46482246-46482268 TTTCTTTACATTTAGTAGGTTGG - Intergenic
1040345819 8:46492155-46492177 CTTTTTTATATTTAGCAGGTTGG - Intergenic
1040346745 8:46509211-46509233 CTTTCTCACATTCAGCAGGTTGG - Intergenic
1040347255 8:46517070-46517092 CTTGTTGACATTCAGCAGGTTGG + Intergenic
1040347348 8:46518764-46518786 TTTTTTTACATTCAGTAGGTTGG + Intergenic
1041174574 8:55181221-55181243 CTTTGTGAGAATTAATTGGTTGG + Intronic
1052700068 9:31926989-31927011 CTGTCTGAGATTTAGAAGGTGGG + Intergenic
1056277543 9:85007739-85007761 CTCTGTGACATGTAGCAGATGGG + Intronic
1191260724 X:58317334-58317356 CTTTGTTAGATTCAGCAGGTTGG + Intergenic
1194075653 X:89388922-89388944 CTTTATGACAATAAGTGGGTGGG - Intergenic
1194714883 X:97276752-97276774 CAGTGTGACATTAAGTAGTTTGG + Intronic
1196017352 X:110954110-110954132 CTTTTTGGCATTTAGAAGATAGG - Intronic
1198247080 X:134840413-134840435 CATTGTGACATTTTGTATGGGGG - Intronic
1200731254 Y:6743078-6743100 CTTTATGACAATAAGTGGGTGGG - Intergenic
1200848256 Y:7854645-7854667 CTTTGCCATATTTATTAGGTTGG + Intergenic