ID: 912713228

View in Genome Browser
Species Human (GRCh38)
Location 1:111964352-111964374
Sequence ACCTGCGGGCTGCAGTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912713220_912713228 20 Left 912713220 1:111964309-111964331 CCTGGGCAGGCTGAAGCCCGGGA No data
Right 912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG No data
912713222_912713228 3 Left 912713222 1:111964326-111964348 CCGGGATGCTAAAGTACAGCCTC No data
Right 912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG No data
912713221_912713228 4 Left 912713221 1:111964325-111964347 CCCGGGATGCTAAAGTACAGCCT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912713228 Original CRISPR ACCTGCGGGCTGCAGTACAC AGG Intronic
No off target data available for this crispr