ID: 912715050

View in Genome Browser
Species Human (GRCh38)
Location 1:111977527-111977549
Sequence CTCAGTTATGTAATTGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912715050_912715054 13 Left 912715050 1:111977527-111977549 CCGGTCTCAATTACATAACTGAG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 912715054 1:111977563-111977585 GTGAGCCATCTCATCGGGATCGG 0: 1
1: 0
2: 0
3: 11
4: 82
912715050_912715053 8 Left 912715050 1:111977527-111977549 CCGGTCTCAATTACATAACTGAG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 912715053 1:111977558-111977580 TAGCAGTGAGCCATCTCATCGGG No data
912715050_912715052 7 Left 912715050 1:111977527-111977549 CCGGTCTCAATTACATAACTGAG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 912715052 1:111977557-111977579 GTAGCAGTGAGCCATCTCATCGG 0: 1
1: 0
2: 1
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912715050 Original CRISPR CTCAGTTATGTAATTGAGAC CGG (reversed) Intronic