ID: 912715054

View in Genome Browser
Species Human (GRCh38)
Location 1:111977563-111977585
Sequence GTGAGCCATCTCATCGGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912715050_912715054 13 Left 912715050 1:111977527-111977549 CCGGTCTCAATTACATAACTGAG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 912715054 1:111977563-111977585 GTGAGCCATCTCATCGGGATCGG 0: 1
1: 0
2: 0
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912715054 Original CRISPR GTGAGCCATCTCATCGGGAT CGG Intronic