ID: 912715054

View in Genome Browser
Species Human (GRCh38)
Location 1:111977563-111977585
Sequence GTGAGCCATCTCATCGGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912715050_912715054 13 Left 912715050 1:111977527-111977549 CCGGTCTCAATTACATAACTGAG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 912715054 1:111977563-111977585 GTGAGCCATCTCATCGGGATCGG 0: 1
1: 0
2: 0
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912715054 Original CRISPR GTGAGCCATCTCATCGGGAT CGG Intronic
900583203 1:3419361-3419383 GTCACACAGCTCATCGGGATGGG + Intronic
905075148 1:35264168-35264190 GTGAGCCATCGCACCTGGCTAGG - Intergenic
907376420 1:54046634-54046656 GTGAGCCATGGCATAGTGATAGG + Intronic
912715054 1:111977563-111977585 GTGAGCCATCTCATCGGGATCGG + Intronic
916226742 1:162496507-162496529 ATGAACCATCTCATCTGGCTGGG + Intergenic
918617267 1:186559928-186559950 GTGACCCATCTCTTTGGAATGGG + Intergenic
920093538 1:203471124-203471146 GTGAGCCACCTCACCGGCCTGGG - Intergenic
920728851 1:208463589-208463611 GTGAAACTTCTCAACGGGATAGG - Intergenic
923527064 1:234780641-234780663 GTGAGCCATCTCAGGGGTATAGG - Intergenic
1064089259 10:12369484-12369506 GAGGGTCATCTCATCGGGATGGG + Intronic
1067187760 10:44044689-44044711 GTGAGCCATCCCCAGGGGATAGG - Intergenic
1068823803 10:61410403-61410425 GTGGGCCCTCTCAGCGGGACTGG - Exonic
1069491584 10:68865913-68865935 GTCAGCCATTTTAACGGGATAGG + Intronic
1072447551 10:95512693-95512715 GTGAGCCATGTCAAAGGGCTCGG - Intronic
1077115386 11:882042-882064 GTGAGCCACCACACCGGGCTGGG - Intronic
1077728438 11:4701666-4701688 GTTAGCCATATCAACGGGGTAGG - Intergenic
1080931574 11:36816963-36816985 GTGAGCCACCTCACCTGGCTAGG + Intergenic
1084749735 11:71196713-71196735 GTGAGCCATTGCATCGGGCAGGG - Intronic
1086311614 11:85541570-85541592 GTAAGCCATCTCAAAGGGTTTGG - Intronic
1094737449 12:33250997-33251019 GTGAGCCATCACATCTGGCCAGG - Intergenic
1107553979 13:41501550-41501572 GTGAGCCACCGCACCGGGCTTGG - Intergenic
1117183806 14:53218762-53218784 GTGAGCCACCTCATCTGGCAGGG + Intergenic
1118244119 14:64091825-64091847 GTGACCCATCTAATCAGGAAAGG - Intronic
1118739226 14:68726718-68726740 TTGGGCCATCACATCTGGATTGG + Intronic
1121338431 14:93091036-93091058 GTGAGCCATCTCCCTGGGAGAGG - Intronic
1121362165 14:93271720-93271742 GTGAGCCATCACACCTGGACAGG - Intronic
1125633328 15:41166604-41166626 GTGAGCCACCACATCAGGCTAGG - Intergenic
1125901497 15:43352409-43352431 ATGAGCCATCACATCCGGCTGGG - Exonic
1126703331 15:51386312-51386334 GTGAGCGATCCCATCGAGCTGGG - Intronic
1129753189 15:78080214-78080236 GTGAGACACCTCATGGGGCTTGG - Intronic
1132341073 15:101078911-101078933 GTGTGCCATCTCCTGGGGAGGGG - Intergenic
1136398843 16:30007008-30007030 GTGAGGCACCTCATGGGGATGGG - Intronic
1139958613 16:70705158-70705180 CTGAGCCATCTGCTGGGGATGGG + Intronic
1146147841 17:30437400-30437422 GTGAGCCATCACACCGGGCTTGG - Intronic
1149225576 17:54465947-54465969 GTGGTTCATCTCATTGGGATTGG - Intergenic
1156199556 18:34814403-34814425 GTGAGCCATCACACCAGCATAGG - Intronic
1158314742 18:56199459-56199481 GTTAGCCATCTAATCAGGGTGGG + Intergenic
1162485689 19:10959362-10959384 GTGAGCCACCTCACCTGGGTGGG - Intergenic
1166188001 19:41154644-41154666 GTGAGCCATCGCACCCGGCTGGG - Intergenic
932165906 2:69506644-69506666 GTGAGCCACCACACCTGGATTGG + Intronic
938572787 2:132576368-132576390 GTGAGCCATCACACCTGGCTAGG - Intronic
941737366 2:168993730-168993752 GTCAGCCCTCTCATTGGGATTGG - Exonic
942426774 2:175868468-175868490 GTTAGCCACCTCCTTGGGATAGG + Intergenic
942462672 2:176179006-176179028 GTGAGTCATATCATTGTGATTGG - Intergenic
1171750651 20:29045208-29045230 GTTAGCCATCTCATGGGAGTAGG - Intergenic
1172849882 20:37953951-37953973 GTGAGCCATCGCACCCGGCTAGG - Intergenic
1174588464 20:51626526-51626548 GTGAGCCACCGCATCTGGTTCGG - Intronic
1176737413 21:10563871-10563893 GTGAGCCACCACACCTGGATGGG - Intronic
1179165881 21:38934762-38934784 GTGAGCCACCTCACCAGGCTGGG + Intergenic
1181156485 22:20924905-20924927 GTGAGCCACCACATCCGGCTGGG - Intronic
1182680436 22:32075192-32075214 GTGAGCCACCACATCTGGCTGGG + Intronic
1183531710 22:38358734-38358756 GTGAGCCACCACACCTGGATGGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184226660 22:43132723-43132745 GTGTGCCATCTCAGCGGGAAGGG - Exonic
954509446 3:51109639-51109661 ATGAGCCATTTCATCTGGCTGGG - Intronic
966960000 3:184926091-184926113 GTGAGCCATCGCATCCGGCCTGG - Intronic
969732802 4:8966756-8966778 GTGAGCCATCACACCCGGCTGGG + Intergenic
971458208 4:26864435-26864457 GTGACCGATCTCATCCAGATAGG + Intronic
973267308 4:48223763-48223785 GTGAGCCACCTCATCAGTGTTGG - Intronic
973783525 4:54313897-54313919 GTGAGTCATCGCATCTGGCTTGG - Intergenic
982268600 4:153564004-153564026 GTGAGCCACCGCATCTGGCTGGG - Intronic
991582915 5:68175095-68175117 GTGAGCCACCACATCCGGTTAGG + Intergenic
995079734 5:108035647-108035669 GTGAGCCACCACATCCGGCTGGG + Intronic
997333190 5:133082741-133082763 GTGAGCCACCTCACCCGGACGGG + Intronic
1000791662 5:165615407-165615429 GTGGTCCATCTCATTGGGACTGG - Intergenic
1001465375 5:171960091-171960113 GTGAGCCACCTCACCTGGCTAGG - Intronic
1002083434 5:176751512-176751534 GTTAGCCATCTCATGGGGCTGGG + Intergenic
1003532468 6:6949069-6949091 GTGAGCCACCACATCTGGCTTGG + Intergenic
1004397382 6:15257515-15257537 TTGACTCATCTCTTCGGGATGGG + Intronic
1006468773 6:34213511-34213533 GTGAGCCACCTCACCAGGCTGGG + Intergenic
1006522445 6:34579044-34579066 GTGAGCCACCACATCTGGCTGGG - Intergenic
1008407690 6:51136780-51136802 GTGGGCCATCTCATTGGGACTGG - Intergenic
1012326117 6:97919950-97919972 TTTTGCCATCTCATCAGGATGGG + Intergenic
1014869594 6:126576497-126576519 GTGAGCCATCCCATGGGAATGGG - Intergenic
1015447580 6:133325538-133325560 ATGATCCATCTGATCAGGATGGG + Intronic
1018513696 6:164554982-164555004 GTCTTCCATCTCATAGGGATAGG - Intergenic
1021670784 7:23032931-23032953 GTGAGCCACCGCACCTGGATGGG + Intergenic
1021693135 7:23249057-23249079 ATGAGCCACCTTATCCGGATGGG + Intronic
1023559615 7:41460047-41460069 GTGAGCCTGCTCTTCGGCATGGG + Intergenic
1024501565 7:50114745-50114767 GTGAGCCACCTCACCCGGCTGGG - Intronic
1029611313 7:101627960-101627982 CTCAGCCATCTCATAGGAATAGG + Intronic
1030583045 7:111383994-111384016 GTGAGCCACCTCACCTGGCTGGG - Intronic
1032104583 7:129016118-129016140 GTGAGCCACCTCATCCAGCTTGG - Intronic
1045028766 8:98115882-98115904 GTGAGCCATCTCAAAGAAATAGG + Intronic
1047864956 8:129013016-129013038 GTGAGGGATCTCAACAGGATAGG + Intergenic
1049198696 8:141329505-141329527 GGGAGCCAGCCCAGCGGGATGGG - Intergenic
1053835670 9:42132417-42132439 GTGAGCCATCACACCGGCCTTGG + Intergenic
1054889035 9:70232309-70232331 CTGAGTCATCTCATTGGGACTGG + Intergenic
1054903806 9:70397181-70397203 GTGAGCCATCACACCGGGCCAGG - Intronic
1058778049 9:108304877-108304899 GTGAGCCAAGTCATCTGGAGGGG + Intergenic
1203492134 Un_GL000224v1:117009-117031 CTGATTCATCTCATCGGGATTGG - Intergenic
1203504758 Un_KI270741v1:58881-58903 CTGATTCATCTCATCGGGATTGG - Intergenic
1196302920 X:114066973-114066995 GTGAGCCATGTCATGTGGGTTGG + Intergenic
1202595681 Y:26537157-26537179 GTGAGCCACCACACCTGGATGGG - Intergenic