ID: 912716321

View in Genome Browser
Species Human (GRCh38)
Location 1:111986541-111986563
Sequence TTGCTTTCACAAATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912716321_912716323 -5 Left 912716321 1:111986541-111986563 CCATCCTCAATTTGTGAAAGCAA 0: 1
1: 0
2: 1
3: 15
4: 238
Right 912716323 1:111986559-111986581 AGCAAGCCATGATCACCCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 132
912716321_912716324 -4 Left 912716321 1:111986541-111986563 CCATCCTCAATTTGTGAAAGCAA 0: 1
1: 0
2: 1
3: 15
4: 238
Right 912716324 1:111986560-111986582 GCAAGCCATGATCACCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912716321 Original CRISPR TTGCTTTCACAAATTGAGGA TGG (reversed) Intronic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
902571120 1:17347637-17347659 TTGTTTTCTCACCTTGAGGAGGG + Intronic
905214830 1:36399713-36399735 ATGCTTTCACACATTAATGAAGG - Intergenic
905302055 1:36992172-36992194 TTGCTTTCCCAAACTTGGGAAGG - Intronic
906336911 1:44940857-44940879 TTACTATCACAAATTTAGTATGG - Intronic
910124068 1:83820735-83820757 TTGCTTCCACTCATGGAGGAAGG - Intergenic
911252271 1:95590560-95590582 TTGCTTTCACAGATTATAGAAGG + Intergenic
911517287 1:98882104-98882126 TTGCTGTCACAACTCGGGGAGGG - Intergenic
912305673 1:108563963-108563985 TTGCATTGACAAAGTGAGGATGG + Intronic
912716321 1:111986541-111986563 TTGCTTTCACAAATTGAGGATGG - Intronic
913143913 1:115970479-115970501 TTGCCTTCAATAATTGATGAGGG + Intergenic
914778890 1:150765248-150765270 TTGCTTTCACATCTTTAGGTAGG + Intronic
915534192 1:156524935-156524957 TTGCTTTCAGAAAGTAGGGAGGG - Intergenic
917485977 1:175454953-175454975 TTGCTTCAACTAATAGAGGATGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918328194 1:183430602-183430624 TGTGTTTCACAAGTTGAGGAAGG + Intergenic
918708444 1:187697177-187697199 TTCCTGTCCCAAATTAAGGAGGG + Intergenic
921873968 1:220173513-220173535 TAGTTTTCAAAAATTAAGGAGGG + Intronic
921878369 1:220225527-220225549 TGGCTTTCACAGCTTGAGGGGGG - Intronic
922026444 1:221754197-221754219 TTTCTTCCACAAAATGAGCAGGG - Intergenic
922028457 1:221775609-221775631 TTGGCTTCCCAAAATGAGGACGG + Intergenic
923356857 1:233165345-233165367 TGGTTTTTACAATTTGAGGAAGG + Intronic
924568243 1:245215497-245215519 TGGCTTTCAGAAATGGAAGAGGG - Intronic
1064487515 10:15810341-15810363 TTACTTTCATGATTTGAGGATGG - Intronic
1068372934 10:56142247-56142269 TTGCACTCATGAATTGAGGATGG - Intergenic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1068816906 10:61326339-61326361 TAGCTTTCATAAATTGGGCAGGG + Intergenic
1070215103 10:74370558-74370580 TTGCTTTCTCAAATTTTAGAGGG - Intronic
1070954622 10:80455587-80455609 TTCCCTTCACAAATAGAGAAGGG - Intronic
1071243928 10:83741782-83741804 TTGCTTCCACATATTCAGTATGG + Intergenic
1071249590 10:83803428-83803450 GAGCTTTCACTCATTGAGGAAGG + Intergenic
1073981654 10:109160861-109160883 TTGTCTTCAAAAATTGAGAAAGG - Intergenic
1074316752 10:112368265-112368287 TTTCTTTCACATACTAAGGAAGG + Intergenic
1074822904 10:117194782-117194804 CTGCTTTCACACAATGAGGGCGG + Intergenic
1074965571 10:118487962-118487984 TTGAGCTCACAAAGTGAGGAAGG - Intergenic
1075630214 10:123995999-123996021 TTGCTTCCACAACCTGAAGATGG + Intergenic
1076421923 10:130337995-130338017 CTGATCTCACAAATTGAGAAGGG + Intergenic
1077195978 11:1280385-1280407 TTGCTTTCATACTTTGTGGACGG + Intronic
1078986943 11:16606449-16606471 TTGCTTTCACAGAACGAGGAGGG + Intronic
1079312872 11:19381785-19381807 ATGCCTTCACAAATGGAGGCTGG + Intronic
1080271136 11:30451918-30451940 TTGATTTCTTAAATTGAGAATGG + Intronic
1081611714 11:44566831-44566853 TGGCTTTCACAAGGTCAGGAGGG - Intronic
1082641071 11:55662373-55662395 TTACTTTCACACATGGAGGATGG + Intergenic
1083042797 11:59703934-59703956 TTGCTGCCCCAAATTGAGAAGGG - Intergenic
1084591150 11:70091461-70091483 TTGCTTTCACAACTTGGGGAGGG - Intronic
1085666510 11:78419120-78419142 TCGCTTTTCCAAATTGAGGAGGG - Intergenic
1086473121 11:87138732-87138754 TTGCTTGGACAAATGGTGGATGG + Intronic
1087353219 11:97060111-97060133 TTGCAGTCACAAACTGAGCAAGG + Intergenic
1088847812 11:113682472-113682494 GTGCTTCCTCAAACTGAGGAAGG + Intergenic
1088919801 11:114252535-114252557 GTGCTTTCCAAAATTCAGGAGGG - Intergenic
1089914289 11:122137581-122137603 TTTCTTTAACAAATGGAGGAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092952259 12:13517426-13517448 TTGCTTTCACAAAATAACTAAGG + Intergenic
1093347222 12:18053140-18053162 TTGCTTTGCCAAATTGAGGGAGG + Intergenic
1095660914 12:44734950-44734972 TTCCTTCCATATATTGAGGAAGG + Intronic
1096380632 12:51155006-51155028 TTGCCCTCCCACATTGAGGATGG - Intronic
1096948592 12:55439130-55439152 TTGGTTTCAGAAAATAAGGATGG + Intergenic
1099105886 12:78495939-78495961 TTGCTCTAACCAATTGATGACGG - Intergenic
1099759430 12:86897897-86897919 TGGCTTCAAAAAATTGAGGAGGG + Intergenic
1100112247 12:91259875-91259897 CTGCTTTCACATAGTGAGGGTGG - Intergenic
1101790859 12:107926216-107926238 TTGCTTTCTAAAATTCTGGAAGG + Intergenic
1102736772 12:115168887-115168909 TTGCTTTGACCAATAGAGTATGG + Intergenic
1104217954 12:126753031-126753053 TTTATTTCACAAGTTAAGGAGGG + Intergenic
1105685859 13:22781203-22781225 TTTCTTTCAGAAATTCAGAAAGG - Intergenic
1105834370 13:24195747-24195769 TTGCTTTCCCGAAGAGAGGAAGG + Intronic
1106440914 13:29769160-29769182 TTGCTATCTCAAAATGATGATGG - Intronic
1106597708 13:31161280-31161302 TTGCCATCACAAATTGGAGAAGG - Intronic
1107282195 13:38749687-38749709 TGGCTGTCACAAGTTGGGGAGGG - Intronic
1108266942 13:48720321-48720343 TTGCTTTTACCCCTTGAGGAAGG - Intergenic
1109207258 13:59496394-59496416 TTGTTTTCATAAAATGAGCAAGG + Intergenic
1109786177 13:67177967-67177989 TTGCTTTCCCTTATTGAGCAGGG - Intronic
1110686084 13:78375981-78376003 TTGTTATCTCAAATTGAGGTGGG - Intergenic
1111268126 13:85845889-85845911 ATGCCTTCAAAAATTGATGAAGG - Intergenic
1111449168 13:88391340-88391362 TTGCTTTAGCAAAAGGAGGAAGG + Intergenic
1113077627 13:106483325-106483347 TTACTTTGAGAAATGGAGGAGGG + Intergenic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1117393900 14:55290011-55290033 TTTCTTTTAAAAATTCAGGAGGG + Intronic
1117821544 14:59655447-59655469 TTGTTTTCAGAAATTGACAACGG + Intronic
1119666389 14:76488207-76488229 TTCCTTGCACAAAATGAAGAAGG + Intronic
1120048618 14:79838681-79838703 TTGGTATCACAAAGTGAGAAAGG - Intronic
1121944532 14:98106592-98106614 TTTCTTTAAAAAATTGATGATGG + Intergenic
1121955508 14:98209238-98209260 TTGCTTTCACCAATGGGGGGTGG + Intergenic
1126130292 15:45334399-45334421 TTGCTTTAACCAATAGAGCAGGG - Intergenic
1126943351 15:53790102-53790124 ATGCTTTCACAAATTGCTAAAGG + Intergenic
1128241459 15:66104125-66104147 TTGCCTTCACAAAGGGAGGGAGG - Intronic
1131881680 15:96868860-96868882 TTTCTTTCACAAGTAGAGAAGGG - Intergenic
1131907568 15:97160147-97160169 TTACTTTCTCAAATGTAGGATGG - Intergenic
1132077635 15:98835561-98835583 TAACTTTCCCAAATTGAGGAGGG - Intronic
1132135971 15:99339275-99339297 TTCCGTTCACAAATTGACTATGG + Intronic
1133616302 16:7479907-7479929 TTGCTGACACAAATTGGGAAGGG - Intronic
1133700757 16:8306297-8306319 TTTCCTTCACACAATGAGGATGG - Intergenic
1133961228 16:10495274-10495296 TTGCTCTGAGGAATTGAGGAGGG + Intergenic
1139623578 16:68166503-68166525 TTGCTTTGACAAATGGAGTGTGG - Intronic
1140283398 16:73576263-73576285 TTGTTTTTACAAGTTGATGAAGG - Intergenic
1143311827 17:5998357-5998379 TTTCTTTCTCATAGTGAGGATGG + Intronic
1144352167 17:14407614-14407636 TAGCTCTCACAACTTGAGAATGG - Intergenic
1144597181 17:16580523-16580545 CTGATTTCACAAATGGCGGAGGG + Intergenic
1146042101 17:29465449-29465471 TTGCTTTAAAAAATTAAGTAAGG - Intronic
1148226175 17:45899201-45899223 TTGTTTTCACAACTCGGGGAGGG + Intronic
1149217716 17:54377247-54377269 GTGCTTTCACAAATTGCCTACGG + Intergenic
1149884871 17:60329652-60329674 TTGCTTTTAAGAGTTGAGGAAGG - Intronic
1152391277 17:80005500-80005522 TTGCTTTCTGACACTGAGGAGGG + Intronic
1153209299 18:2742328-2742350 TTGCATTTACAAATTGTAGATGG - Intronic
1155639523 18:27997365-27997387 TTGCTTTCACTAAGTGATGGAGG + Intronic
1159819115 18:73117574-73117596 TTGCTTTCAGACCTTCAGGAAGG - Intergenic
1161143769 19:2664874-2664896 TCGTTGTCACAACTTGAGGATGG - Intronic
1163832898 19:19555605-19555627 TTGCTGTTTCAAAATGAGGAAGG + Intergenic
1163954368 19:20621799-20621821 TTGCTTACACCATTTGAGTAAGG + Exonic
1164881742 19:31738649-31738671 TAGCTTTCACAGATTCTGGAAGG - Intergenic
1166736017 19:45085403-45085425 TGGCTGTCACAACTTGAAGATGG + Intronic
1167050433 19:47074774-47074796 GTGCTGTCACAACTGGAGGAGGG + Intronic
1168484185 19:56747138-56747160 TGGCTGTCACAACTGGAGGAGGG - Intergenic
925506016 2:4564938-4564960 TTCAGTTCACAAAGTGAGGAAGG - Intergenic
926280007 2:11438322-11438344 TTTCTCTCACACATTTAGGAAGG - Intergenic
926415964 2:12650029-12650051 TTACATTCATAAATTGAGGGTGG + Intergenic
929348669 2:40919895-40919917 TTGCTTTCACAAGAAGAGTATGG - Intergenic
929624019 2:43387714-43387736 TTGTTGTCACAAATGAAGGAGGG + Intronic
931959239 2:67463752-67463774 TTTATTTTACAAATAGAGGAAGG - Intergenic
932302973 2:70680541-70680563 TTTCTTTCAAAAATGGGGGAAGG - Intronic
935850730 2:107216196-107216218 TGGCTTTCACAAATTCACAAAGG + Intergenic
935859850 2:107317223-107317245 TGGCTTGCACAAGTTGAGCATGG + Intergenic
937030074 2:118731666-118731688 TGGGTTTAACAAATAGAGGAGGG + Intergenic
938963169 2:136361259-136361281 TTTCTTCCACAGATTGTGGAAGG + Intergenic
939426058 2:142038081-142038103 TTGCTTTAAATAATTGAAGAGGG - Intronic
939755880 2:146109794-146109816 TTGCTTTGGCAAATAGAGTATGG + Intergenic
941744653 2:169073953-169073975 TGGTTTTCACAACTTGGGGAGGG + Intronic
943091599 2:183382099-183382121 TTGCTTCCACAAAATGAGGGAGG + Intergenic
943814594 2:192236680-192236702 TTGCTTTCACAAATTATTGTTGG - Intergenic
944232006 2:197405095-197405117 TTGCTTTTAAAAATTAAGAATGG - Exonic
944273451 2:197807951-197807973 ATGTTTTCACAAATTATGGAGGG - Intronic
946149138 2:217752609-217752631 TTCCATTCACAAGTTGAGGAGGG + Intronic
947168983 2:227291772-227291794 GTGCTTTGTCAAATTGAGGTTGG + Intronic
1169085301 20:2822374-2822396 TTGCTTTAAAAAATGGAGGCTGG - Intergenic
1169240183 20:3970554-3970576 TTGCTTAAACAATTTGATGACGG - Intronic
1169824541 20:9752858-9752880 TTGCTTTGACCAATTGAAGGAGG + Intronic
1170021888 20:11845709-11845731 TTGCTTTGAGAAATTGAGGGTGG - Intergenic
1171295839 20:24016090-24016112 TTGCTTTCTGAAATTGTGCAGGG + Intergenic
1173229095 20:41180328-41180350 GAACTTTCAGAAATTGAGGAAGG + Exonic
1173759977 20:45551021-45551043 TTACTTTCAAAAAATGAGTATGG - Intergenic
1174983848 20:55427426-55427448 TTTCTTTAACAATTTGATGATGG + Intergenic
1178217782 21:30621111-30621133 TTGTTTTCTCATATTCAGGATGG + Intergenic
1178546468 21:33496727-33496749 TTTCTTTTGCAAATTGAGGGAGG - Intergenic
1182604796 22:31494842-31494864 CAGCTTTGACAAATTTAGGAGGG - Intronic
1182720698 22:32396542-32396564 ATGCATTCACATATTGAGAAAGG - Intronic
1182825542 22:33261649-33261671 TTGATTCCAGAAGTTGAGGAGGG + Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
949179123 3:1105557-1105579 TGGCTTTCACAAACTCAGAATGG + Intronic
950733358 3:14981952-14981974 GTGCTTTCTCAGATTGAGGGTGG + Intronic
950961608 3:17114069-17114091 TTGCTTTCACAAAAACAGCAGGG + Intergenic
951950707 3:28197381-28197403 TGGCTGTCACAACTGGAGGATGG - Intergenic
953151916 3:40332655-40332677 TTGCTTTCAGAAATTTGAGATGG + Intergenic
955227882 3:57076113-57076135 TTGCTTTAATAAATTGATTAAGG + Intronic
955751710 3:62190198-62190220 TGGTTGTCACAAGTTGAGGACGG + Intronic
956742075 3:72282960-72282982 CTGCTTTCACAAATGGAATATGG + Intergenic
957109038 3:75929480-75929502 TAGCTTTCATAAATTGAGACTGG + Intronic
958887818 3:99747797-99747819 TTATTTTAAAAAATTGAGGAAGG - Intronic
959080829 3:101799284-101799306 TTAATTTTACAAATTGTGGAAGG - Intronic
963671258 3:148254693-148254715 TTGCTTTAACAAACTGAAGCAGG - Intergenic
965294647 3:166928137-166928159 CTGCTTAGAAAAATTGAGGAAGG + Intergenic
966640285 3:182182045-182182067 TTGGTTTCATAAACTTAGGATGG + Intergenic
971748754 4:30619198-30619220 TTGCTTTCCCAAGTTAAGGGTGG - Intergenic
971957546 4:33441185-33441207 TTTCTTTCCCAAATTCAAGATGG + Intergenic
973060242 4:45715394-45715416 TTGCTTACCCCCATTGAGGAGGG - Intergenic
973964026 4:56142010-56142032 TTACTTTCACAATTTGGAGAAGG - Intergenic
974338897 4:60588217-60588239 TCACTTTCACAAATTAAGAAAGG + Intergenic
974907139 4:68072250-68072272 TTGCTTACAAAAATTAAAGAGGG + Intronic
975357445 4:73424599-73424621 TTGCTTCCAAAAATAGAGTATGG - Intergenic
976587786 4:86818255-86818277 TTCCTTTCACAAATTCTAGAGGG + Intergenic
980506693 4:133733137-133733159 TTGCTTTAATAAGTTGATGAGGG + Intergenic
980708790 4:136536962-136536984 TTGCTTTCAAAAATAGAGTGGGG + Intergenic
980832216 4:138144753-138144775 AAGCTTTCACAAATTGATGGAGG + Intergenic
981744859 4:148042913-148042935 CTGCCTCTACAAATTGAGGAGGG - Intronic
984892888 4:184509133-184509155 CTGCTTTAACCAATAGAGGATGG + Intergenic
985230115 4:187806695-187806717 TTGCTTTCACATATTGTTGGTGG + Intergenic
987222925 5:15808921-15808943 TTGTCTTCAGAAATTCAGGATGG - Intronic
987628093 5:20429391-20429413 TTGCTTTCACAATCTGTGAAAGG - Intronic
987640607 5:20607025-20607047 TGGCTTTCAAAGATGGAGGAAGG + Intergenic
988417799 5:30968165-30968187 TTGCTTTGAGGAATTGAGGTTGG - Intergenic
991115104 5:62945996-62946018 TTTCTTTGACAAATTAAGTAGGG + Intergenic
992867365 5:80971258-80971280 ATGGTGTCACAAATTAAGGATGG - Intronic
993138784 5:84003334-84003356 CTGCTGCCACAAAGTGAGGAGGG + Intronic
993639062 5:90380517-90380539 TTTCTCTCTGAAATTGAGGAGGG - Intergenic
994565256 5:101437728-101437750 TTACTTTCACCAAATGAGCACGG - Intergenic
995316664 5:110782383-110782405 TTGCTTCCACACATGGAGAAAGG + Intergenic
998187367 5:139991367-139991389 TGTCTTTCATAAATTGAGTAGGG - Intronic
1000127652 5:158262396-158262418 TTGCTTTCTCAAATTTACTAGGG + Intergenic
1004515400 6:16318215-16318237 CTGTTTTCACAAATTGCGAAGGG + Intronic
1004827070 6:19434298-19434320 TTGCTGTCACACATTGAAGAAGG + Intergenic
1005070038 6:21853555-21853577 TTGCTTTCACTAATTCAGATGGG + Intergenic
1005304696 6:24502257-24502279 TTGCCTTCAAAAATTCAGGTGGG - Intronic
1007898451 6:45386703-45386725 ATGGTTTAACAAAATGAGGAAGG + Intronic
1008671282 6:53771866-53771888 CTGCTTTCACTCATGGAGGAAGG + Intergenic
1008921692 6:56849764-56849786 TTGCTTTCAGTAATGAAGGAGGG - Intronic
1010916505 6:81625578-81625600 TTCCTTTCAATAATTTAGGAGGG - Intronic
1011091544 6:83607480-83607502 TTGTTGTCACAAACTGAGAAAGG - Intronic
1011411100 6:87067311-87067333 TTTCTTTGACAAAGAGAGGAGGG + Intergenic
1011865392 6:91819890-91819912 TTGCTTCCAAAAACTTAGGATGG + Intergenic
1012352883 6:98275337-98275359 TTGGTTACAGAAATTGAAGATGG + Intergenic
1012417045 6:99022860-99022882 TAGCTTTCACCATTTAAGGAAGG - Intergenic
1013632548 6:111999324-111999346 TGGCTTTCACACATGGATGAGGG - Intergenic
1014012972 6:116497935-116497957 ATGGTTTAACAAATTGAGGCTGG - Intronic
1014580957 6:123136884-123136906 TTGCTGCCACCAAGTGAGGAAGG + Intergenic
1014807186 6:125843242-125843264 TGGCTTTGAAAAATGGAGGAAGG + Intronic
1014983399 6:127973145-127973167 TTGCTTTCAGAAATGGTGGCGGG - Exonic
1019850172 7:3546963-3546985 TTGATTTAACTAATTGAGGGAGG + Intronic
1020692243 7:11370041-11370063 ATGCCTTAACAAATTCAGGAAGG - Intergenic
1020888473 7:13849427-13849449 TTGCTTTCACAGGTTCAGGATGG + Intergenic
1020988297 7:15163829-15163851 TTGCTTTCACAGAATGAGTTAGG + Intergenic
1021710163 7:23408172-23408194 TTTCTCACAAAAATTGAGGAAGG + Intronic
1022379794 7:29848994-29849016 ATGCTTTCACTAATTCAGGTGGG + Intronic
1022921583 7:35021331-35021353 TTGCTTTCTCAGAATAAGGATGG + Intronic
1023085848 7:36569237-36569259 TTGCTAAAACAAAATGAGGAAGG + Intronic
1030005523 7:105114871-105114893 TTTGTTGGACAAATTGAGGATGG - Intronic
1030569160 7:111200544-111200566 TTACATTTAAAAATTGAGGAAGG + Intronic
1030765691 7:113406644-113406666 TTGTTTTCACAAATAAAGTAAGG - Intergenic
1030876669 7:114821501-114821523 TTGTCTTTTCAAATTGAGGAAGG + Intergenic
1031322243 7:120345762-120345784 TTGCTTTCACATTTTGGTGATGG + Intronic
1033426429 7:141248825-141248847 TATCTTTCATAAATTGAGGGTGG - Intronic
1033720359 7:144052384-144052406 TTTCTTTAACACATTGAGTATGG + Intergenic
1034512416 7:151546804-151546826 TTAGTTTCACAAACAGAGGAAGG + Intergenic
1037644375 8:20777567-20777589 TTGGCTTCAAAAATGGAGGAAGG + Intergenic
1038186143 8:25276712-25276734 TTGATTTCACAAAATTAGAATGG + Intronic
1038581944 8:28755371-28755393 ATGCTTTGACAAAGTGAAGAGGG + Intronic
1042393348 8:68261731-68261753 TGGCTTTCATAAATGAAGGAAGG - Intergenic
1042594194 8:70428205-70428227 GTGCTTTGAGAAGTTGAGGAGGG + Intergenic
1042798370 8:72689068-72689090 TAACTTTCACATATTGAGGAAGG + Intronic
1043844250 8:85146276-85146298 TTCCTTTCAGAAATAGAAGAGGG - Intergenic
1044339537 8:91030984-91031006 CTGCTTTGACAAATAGAGGATGG + Intronic
1044870308 8:96613628-96613650 TTGCTTTGGCAAATTAAGTATGG - Intergenic
1044894508 8:96877061-96877083 TTGCTTTTATAAATTGCAGAAGG + Intronic
1045328716 8:101137035-101137057 TTGCATTCACAAATGGTGGAGGG + Intergenic
1047781188 8:128112474-128112496 TTTCTTTGACAGATTGATGAAGG - Intergenic
1050521102 9:6500683-6500705 GTGCTTTCACATCTTGTGGAAGG + Exonic
1050724531 9:8632713-8632735 TTGCTTACACAATTTGACAAAGG - Intronic
1050845849 9:10217377-10217399 TTGCTTTGAGATATGGAGGAGGG - Intronic
1053595033 9:39551872-39551894 TTGCTTCCACACATGGCGGAAGG - Intergenic
1053852815 9:42306900-42306922 TTGCTTCCACACATGGCGGAAGG - Intergenic
1054571221 9:66813101-66813123 TTGCTTCCACACATGGCGGAAGG + Intergenic
1055718059 9:79140501-79140523 TTGCATTCACAGAGTGAGGTAGG + Intergenic
1058210711 9:102166066-102166088 TTCCTTTCATAAAGTCAGGAAGG - Intergenic
1060860250 9:126948217-126948239 TTTCTTTTAAAAATTGAGGCTGG + Intronic
1186858495 X:13648468-13648490 TTGCTTTCACCATGTGAAGAAGG - Intergenic
1188848573 X:35104094-35104116 GTGCATTCCCAGATTGAGGATGG - Intergenic
1188914695 X:35895925-35895947 TTGCTTTCACTACTTGATTATGG - Intergenic
1189295344 X:39913848-39913870 CTGCTTTGACTAATGGAGGATGG - Intergenic
1194058958 X:89173454-89173476 TGGCTTTCAGAAACTGAGGTTGG + Intergenic
1194670103 X:96721568-96721590 TTACTTTCAGAATTTGAGCAAGG - Intronic
1196308441 X:114132061-114132083 TTACTTTCACAAAGTGACTAGGG + Intergenic
1197059986 X:122166221-122166243 TTGTTATCAGAAAATGAGGATGG + Intergenic
1197560936 X:128020922-128020944 TTGCTTTCACAACTTGACTCTGG - Intergenic
1199458512 X:148056684-148056706 TGGCTTTCATATATTGAGCATGG + Intergenic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic
1201897442 Y:19007227-19007249 TGGCTTTCAGAAATTTAGGTAGG - Intergenic