ID: 912721075

View in Genome Browser
Species Human (GRCh38)
Location 1:112020696-112020718
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912721070_912721075 -6 Left 912721070 1:112020679-112020701 CCATACATGCTGCCATTTCTCCT No data
Right 912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG No data
912721069_912721075 -2 Left 912721069 1:112020675-112020697 CCTGCCATACATGCTGCCATTTC No data
Right 912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG No data
912721068_912721075 -1 Left 912721068 1:112020674-112020696 CCCTGCCATACATGCTGCCATTT No data
Right 912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG No data
912721067_912721075 25 Left 912721067 1:112020648-112020670 CCATATTTCTGTGTTTCTGCATA No data
Right 912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type