ID: 912721091

View in Genome Browser
Species Human (GRCh38)
Location 1:112020759-112020781
Sequence GTCTCTCCCTTCTGCCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912721081_912721091 11 Left 912721081 1:112020725-112020747 CCCTTGCTGCCACATCTTCTCCA No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721087_912721091 -9 Left 912721087 1:112020745-112020767 CCAAATGGCTGGGTGTCTCTCCC No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721084_912721091 2 Left 912721084 1:112020734-112020756 CCACATCTTCTCCAAATGGCTGG No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721077_912721091 29 Left 912721077 1:112020707-112020729 CCACTGGACCGGCGCCCACCCTT No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721080_912721091 14 Left 912721080 1:112020722-112020744 CCACCCTTGCTGCCACATCTTCT No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721082_912721091 10 Left 912721082 1:112020726-112020748 CCTTGCTGCCACATCTTCTCCAA No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721078_912721091 21 Left 912721078 1:112020715-112020737 CCGGCGCCCACCCTTGCTGCCAC No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data
912721079_912721091 15 Left 912721079 1:112020721-112020743 CCCACCCTTGCTGCCACATCTTC No data
Right 912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912721091 Original CRISPR GTCTCTCCCTTCTGCCGGGT GGG Intergenic
No off target data available for this crispr