ID: 912722747

View in Genome Browser
Species Human (GRCh38)
Location 1:112033874-112033896
Sequence GGCTGGACACCCAGGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912722743_912722747 -4 Left 912722743 1:112033855-112033877 CCACAATCTGCCATCTGCAGGCT No data
Right 912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG No data
912722742_912722747 -3 Left 912722742 1:112033854-112033876 CCCACAATCTGCCATCTGCAGGC No data
Right 912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912722747 Original CRISPR GGCTGGACACCCAGGAGAGC TGG Intergenic
No off target data available for this crispr