ID: 912723971

View in Genome Browser
Species Human (GRCh38)
Location 1:112042862-112042884
Sequence CGGGGGTGACCCCATTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912723971_912723978 3 Left 912723971 1:112042862-112042884 CCAGGGGAATGGGGTCACCCCCG No data
Right 912723978 1:112042888-112042910 TCATCCCAGGCTGCCACACTGGG No data
912723971_912723972 -10 Left 912723971 1:112042862-112042884 CCAGGGGAATGGGGTCACCCCCG No data
Right 912723972 1:112042875-112042897 GTCACCCCCGATCTCATCCCAGG No data
912723971_912723984 28 Left 912723971 1:112042862-112042884 CCAGGGGAATGGGGTCACCCCCG No data
Right 912723984 1:112042913-112042935 CGAAGATGGAGTTGTTCCCCTGG No data
912723971_912723977 2 Left 912723971 1:112042862-112042884 CCAGGGGAATGGGGTCACCCCCG No data
Right 912723977 1:112042887-112042909 CTCATCCCAGGCTGCCACACTGG No data
912723971_912723981 14 Left 912723971 1:112042862-112042884 CCAGGGGAATGGGGTCACCCCCG No data
Right 912723981 1:112042899-112042921 TGCCACACTGGGACCGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912723971 Original CRISPR CGGGGGTGACCCCATTCCCC TGG (reversed) Intergenic
No off target data available for this crispr