ID: 912730873

View in Genome Browser
Species Human (GRCh38)
Location 1:112102277-112102299
Sequence TTCTCTCACTAGTCAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912730873_912730882 27 Left 912730873 1:112102277-112102299 CCAACCCTTGACTAGTGAGAGAA No data
Right 912730882 1:112102327-112102349 TGTTTTATCCCATATGGACTAGG No data
912730873_912730883 28 Left 912730873 1:112102277-112102299 CCAACCCTTGACTAGTGAGAGAA No data
Right 912730883 1:112102328-112102350 GTTTTATCCCATATGGACTAGGG No data
912730873_912730878 21 Left 912730873 1:112102277-112102299 CCAACCCTTGACTAGTGAGAGAA No data
Right 912730878 1:112102321-112102343 TTCCCCTGTTTTATCCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912730873 Original CRISPR TTCTCTCACTAGTCAAGGGT TGG (reversed) Intergenic
No off target data available for this crispr