ID: 912731343

View in Genome Browser
Species Human (GRCh38)
Location 1:112109050-112109072
Sequence GAGCAGCACCATGCAGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912731343_912731345 -4 Left 912731343 1:112109050-112109072 CCTCCTACTGCATGGTGCTGCTC No data
Right 912731345 1:112109069-112109091 GCTCAACAGCAACTCTTATTTGG No data
912731343_912731346 8 Left 912731343 1:112109050-112109072 CCTCCTACTGCATGGTGCTGCTC No data
Right 912731346 1:112109081-112109103 CTCTTATTTGGCATCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912731343 Original CRISPR GAGCAGCACCATGCAGTAGG AGG (reversed) Intergenic