ID: 912731344

View in Genome Browser
Species Human (GRCh38)
Location 1:112109053-112109075
Sequence GTTGAGCAGCACCATGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912731344_912731346 5 Left 912731344 1:112109053-112109075 CCTACTGCATGGTGCTGCTCAAC No data
Right 912731346 1:112109081-112109103 CTCTTATTTGGCATCTCCTTTGG No data
912731344_912731345 -7 Left 912731344 1:112109053-112109075 CCTACTGCATGGTGCTGCTCAAC No data
Right 912731345 1:112109069-112109091 GCTCAACAGCAACTCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912731344 Original CRISPR GTTGAGCAGCACCATGCAGT AGG (reversed) Intergenic