ID: 912731344 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:112109053-112109075 |
| Sequence | GTTGAGCAGCACCATGCAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912731344_912731346 | 5 | Left | 912731344 | 1:112109053-112109075 | CCTACTGCATGGTGCTGCTCAAC | No data | ||
| Right | 912731346 | 1:112109081-112109103 | CTCTTATTTGGCATCTCCTTTGG | No data | ||||
| 912731344_912731345 | -7 | Left | 912731344 | 1:112109053-112109075 | CCTACTGCATGGTGCTGCTCAAC | No data | ||
| Right | 912731345 | 1:112109069-112109091 | GCTCAACAGCAACTCTTATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912731344 | Original CRISPR | GTTGAGCAGCACCATGCAGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||