ID: 912731345

View in Genome Browser
Species Human (GRCh38)
Location 1:112109069-112109091
Sequence GCTCAACAGCAACTCTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912731343_912731345 -4 Left 912731343 1:112109050-112109072 CCTCCTACTGCATGGTGCTGCTC No data
Right 912731345 1:112109069-112109091 GCTCAACAGCAACTCTTATTTGG No data
912731341_912731345 9 Left 912731341 1:112109037-112109059 CCTGTGTGATAAACCTCCTACTG No data
Right 912731345 1:112109069-112109091 GCTCAACAGCAACTCTTATTTGG No data
912731344_912731345 -7 Left 912731344 1:112109053-112109075 CCTACTGCATGGTGCTGCTCAAC No data
Right 912731345 1:112109069-112109091 GCTCAACAGCAACTCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912731345 Original CRISPR GCTCAACAGCAACTCTTATT TGG Intergenic
No off target data available for this crispr