ID: 912731346 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:112109081-112109103 |
Sequence | CTCTTATTTGGCATCTCCTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912731343_912731346 | 8 | Left | 912731343 | 1:112109050-112109072 | CCTCCTACTGCATGGTGCTGCTC | No data | ||
Right | 912731346 | 1:112109081-112109103 | CTCTTATTTGGCATCTCCTTTGG | No data | ||||
912731344_912731346 | 5 | Left | 912731344 | 1:112109053-112109075 | CCTACTGCATGGTGCTGCTCAAC | No data | ||
Right | 912731346 | 1:112109081-112109103 | CTCTTATTTGGCATCTCCTTTGG | No data | ||||
912731341_912731346 | 21 | Left | 912731341 | 1:112109037-112109059 | CCTGTGTGATAAACCTCCTACTG | No data | ||
Right | 912731346 | 1:112109081-112109103 | CTCTTATTTGGCATCTCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912731346 | Original CRISPR | CTCTTATTTGGCATCTCCTT TGG | Intergenic | ||