ID: 912733324

View in Genome Browser
Species Human (GRCh38)
Location 1:112128831-112128853
Sequence AGTCATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912733320_912733324 15 Left 912733320 1:112128793-112128815 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG No data
912733318_912733324 22 Left 912733318 1:112128786-112128808 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG No data
912733322_912733324 4 Left 912733322 1:112128804-112128826 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG No data
912733317_912733324 25 Left 912733317 1:112128783-112128805 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG No data
912733319_912733324 16 Left 912733319 1:112128792-112128814 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912733324 Original CRISPR AGTCATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr