ID: 912734398

View in Genome Browser
Species Human (GRCh38)
Location 1:112137253-112137275
Sequence ATGGGTATTGAGCTGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912734396_912734398 -10 Left 912734396 1:112137240-112137262 CCCAATAATGTGCATGGGTATTG No data
Right 912734398 1:112137253-112137275 ATGGGTATTGAGCTGTAGCCAGG No data
912734392_912734398 26 Left 912734392 1:112137204-112137226 CCACTACAGCACACTGACTCCAC No data
Right 912734398 1:112137253-112137275 ATGGGTATTGAGCTGTAGCCAGG No data
912734393_912734398 7 Left 912734393 1:112137223-112137245 CCACATTTGCATATAATCCCAAT No data
Right 912734398 1:112137253-112137275 ATGGGTATTGAGCTGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912734398 Original CRISPR ATGGGTATTGAGCTGTAGCC AGG Intergenic
No off target data available for this crispr