ID: 912735087

View in Genome Browser
Species Human (GRCh38)
Location 1:112143380-112143402
Sequence CTAAATCAGAATCTATTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912735087_912735090 28 Left 912735087 1:112143380-112143402 CCTATTAATAGATTCTGATTTAG No data
Right 912735090 1:112143431-112143453 TAATCCCATGGTTCTCTTCCTGG No data
912735087_912735089 16 Left 912735087 1:112143380-112143402 CCTATTAATAGATTCTGATTTAG No data
Right 912735089 1:112143419-112143441 AATATAGTATAATAATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912735087 Original CRISPR CTAAATCAGAATCTATTAAT AGG (reversed) Intergenic
No off target data available for this crispr