ID: 912736455

View in Genome Browser
Species Human (GRCh38)
Location 1:112153336-112153358
Sequence CTGGAATGGAGCTTAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912736449_912736455 9 Left 912736449 1:112153304-112153326 CCAGAAAGAGATGTTCTGGGAAC No data
Right 912736455 1:112153336-112153358 CTGGAATGGAGCTTAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912736455 Original CRISPR CTGGAATGGAGCTTAGTGCA AGG Intergenic