ID: 912738725

View in Genome Browser
Species Human (GRCh38)
Location 1:112173981-112174003
Sequence ACTCCTTTCCTGGACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912738725_912738729 -7 Left 912738725 1:112173981-112174003 CCCTGCAGGTCCAGGAAAGGAGT No data
Right 912738729 1:112173997-112174019 AAGGAGTCTCCATTTGGATGAGG No data
912738725_912738731 22 Left 912738725 1:112173981-112174003 CCCTGCAGGTCCAGGAAAGGAGT No data
Right 912738731 1:112174026-112174048 TATAAACTGTGAACCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912738725 Original CRISPR ACTCCTTTCCTGGACCTGCA GGG (reversed) Intergenic
No off target data available for this crispr